{ "html_url": "https://licitia.com.mx/adjudicacion/aa-08-izc-008izc999-n-95-2023", "canonical": "https://licitia.com.mx/adjudicacion/aa-08-izc-008izc999-n-95-2023", "id": "4c504e39f04f4d3e8583cb77ddd414e2", "procedure_number": "AA-08-IZC-008IZC999-N-95-2023", "file_number": "E-2023-00049831", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "description": { "short": "Equipos especializados, sustancias y materiales químicos, físico químico o bioquímico, para proyectos de investigación científica y desarrollo tecnológico.", "detailed": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LABORATORIO PARA CAMPUS VERACRUZ DEL COLEGIO DE POSTGRADUADOS" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "COLEGIO DE POSTGRADUADOS", "acronym": "COLPOS", "branch": "08 - AGRICULTURA Y DESARROLLO RURAL", "buying_unit": "DEPARTAMENTO DE ADQUISICIONES Y CONTRATOS", "requesting_unit": "unidad requiriente data", "requesting_group": "DEPARTAMENTO DE ADQUISICIONES Y CONTRATOS", "entity": null, "slug": "colpos", "unit_slug": "departamento-de-adquisiciones-y-contratos-008izc999" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2023, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "38", "exception_basis": "Art. 41 fr. XVII", "internal_control_number": "VER-2023-17", "supply_source_number": null }, "schedule": { "published_at": "2023-07-11T18:18:57.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2023-07-14T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1-METHYLBUTYL ACETATE, 100 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "2", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "ACCESS RT-PCR SYSTEM KIT DE 500 MUESTRAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "3", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "ACETATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "4", "cucop_code": "25101-0040", "specific_item_code": "25101", "cucop_description": "SULFATO DE AMONIO", "description": "ACETATO DE SODIO R.A, CRISTAL 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "5", "cucop_code": "25101-0041", "specific_item_code": "25101", "cucop_description": "HULE SINTETICO Y ELASTOMEROS", "description": "ACETONA =99.5% 4 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "6", "cucop_code": "25101-0042", "specific_item_code": "25101", "cucop_description": "PASTA AL SULFATO", "description": "ACETONA GARRAFA 20 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "7", "cucop_code": "25101-0043", "specific_item_code": "25101", "cucop_description": "PASTA DE BAGAZO VISCOSA", "description": "ÁCIDO ACÉTICO AL 98 % PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "8", "cucop_code": "25101-0044", "specific_item_code": "25101", "cucop_description": "PASTA MECANICA", "description": "ÁCIDO ACÉTICO GLACIAL PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "9", "cucop_code": "25101-0046", "specific_item_code": "25101", "cucop_description": "PULIMENTOS Y LUSTRADORES", "description": "ÁCIDO ANHIDRIDO ACÉTICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "10", "cucop_code": "25101-0046", "specific_item_code": "25101", "cucop_description": "PULIMENTOS Y LUSTRADORES", "description": "ÁCIDO CLORHIDRICO GRADO ANALITICO 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "11", "cucop_code": "25101-0047", "specific_item_code": "25101", "cucop_description": "SULFATO DE ALUMINIO", "description": "ÁCIDO CLORHIDRICO GRADO REACTIVO DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "12", "cucop_code": "25101-0048", "specific_item_code": "25101", "cucop_description": "ABRASIVOS", "description": "ÁCIDO FOSFOMOLIBDICO PRESENTACIÓN DE 500 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "13", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ÁCIDO FOSFOWOLFRÁMICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "14", "cucop_code": "25101-0050", "specific_item_code": "25101", "cucop_description": "DESEMULSIONANTE", "description": "ÁCIDO HEXANÓICO DE 1 KILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "15", "cucop_code": "25101-0051", "specific_item_code": "25101", "cucop_description": "ETHER", "description": "ÁCIDO LACTICO AL 88% PRESENTACIÓN 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "16", "cucop_code": "25101-0052", "specific_item_code": "25101", "cucop_description": "GLICERINA", "description": "ÁCIDO NÍTRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "17", "cucop_code": "25101-0053", "specific_item_code": "25101", "cucop_description": "POLIURETANO", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "18", "cucop_code": "25101-0054", "specific_item_code": "25101", "cucop_description": "RODAMINA", "description": "ÁCIDO SULFURICO GRADO ANALITICO 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "19", "cucop_code": "25101-0055", "specific_item_code": "25101", "cucop_description": "SAFRANINA", "description": "ÁCIDO SULFURICO GRADO REACTIVO 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "20", "cucop_code": "25101-0056", "specific_item_code": "25101", "cucop_description": "SULFATO DE SODIO", "description": "ÁCIDO SULFURICO GRADO REACTIVO DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "21", "cucop_code": "25101-0057", "specific_item_code": "25101", "cucop_description": "SULFATO DE ZINC", "description": "ÁCIDO VALÉRICO DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "22", "cucop_code": "25101-0058", "specific_item_code": "25101", "cucop_description": "SULFITO DE BISMUTO", "description": "AGAR BACTERIOLOGICO FRASCO DE 250 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "23", "cucop_code": "25101-0059", "specific_item_code": "25101", "cucop_description": "SULFURO DE SODIO", "description": "AGAR BACTERIOLÓGICO. FRASCO CON 500 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "24", "cucop_code": "25101-0060", "specific_item_code": "25101", "cucop_description": "TIOSULFATO DE SODIO", "description": "AGAR CEREBRO CORAZON FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "25", "cucop_code": "25101-0061", "specific_item_code": "25101", "cucop_description": "CLORURO DE POTASIO", "description": "AGAR MÉTODOS ESTANDAR FRASCO 450G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "26", "cucop_code": "25101-0062", "specific_item_code": "25101", "cucop_description": "AGUA DESIONIZADA", "description": "AGAR NUTRITIVO FRASCO (450GR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "27", "cucop_code": "25101-0063", "specific_item_code": "25101", "cucop_description": "AGUA BIDESTILADA", "description": "AGAR PAPA DEXTROSA PDA FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAROSA ULTRA PURA 100 GRAMOS. GRADO BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA BOTELLAS DE 1 LITRO CADA UNO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA GALÓN DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA GARRAFÓN DE 19 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA OXIGENADA 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL AMÍLICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETILICO AL 96% CON 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ISOAMILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ISOPROPILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL METILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALGINATO DE SODIO EN POLVO GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANHIDRIDO ACÉTICO AL 99% DE PUREZA PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BACTOZOLTM. KIT PARA AISLACIÓN DE ADN BACTERIANO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BPW AGUA PEPTONADA TAMPONADA 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE CARGA PARA ELECTROFORESIS DE 1 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 10 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 4 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 7 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBON ACTIVADO 100G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBORUMDUM -CARBURO DE SILICONA CALIBRE FINO FRASCO DE 250 GR (SILICON CARBIDE -400 MESH PARTICLE SIZE, =97.5% SINÓNIMOS: CARBON SILICIDE, CARBORUNDUM, METHANIDYLIDYNESILANYLIUM, SILICON MONOCARBIDE 250 G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CGINT GGCCTCCCGCCTCCGGGCGG 25 NM ESTÁNDAR DESALADO 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CGINT: GGCCTCCCGCCTCCGGGCGG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFORMO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE CALCIO ANHÍDRO ACS DE 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE HIERRO (III) PRESENTACIÓN DE 500 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE POTASIO (KCL) FRASCO DE 100 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE POTASIO R.A. 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO MERCÚRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE PARA TEÑIR ÁCIDOS NUCLEICOS GEL RED® 10 000 X 0.5 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE PARA TEÑIR GELES DE ELECTROFORESIS (SUSTITUTO DE BROMURO DE ETIDIO) DE 500 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-GLUCOSA ANHIDRA ACS (DEXTROSA) PARA MICROBIOLOGÍA (MEDIO DE CULTIVO). FRASCO DE 250 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIHIDRÓGENO FOSFATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DNA POLIMERASA GOTAQ® FLEXI DNA. PARA AMPLIFICACIÓN DE ADN POR PCR. 500 UNIDADES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA TAQ POLIMERASA. 500 UNIDADES. LA BIOLASA (ADN POLIMERASA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESCALERA BAJA PCR 20 PB, PARA ELECTROPHORESIS DE FRAGMNETOS DE PCR CON 40 µG.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTER DEL ÁCIDO 2-AMINOETILDIFENIL BÓRICO (AEDBE) PRESENTACIÓN 5 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHYL 4-[BENZYL(METHYL)AMINO]BUTANOATE PH017049-1G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO PARA MICROBIOLOGÍA. FRASCO DE 500 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE TÉ VERDE ESTANDARIZADO EN CAPSULAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FENOLFTALEÍNA 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DE CALCIO CA3(PO4)2 (FOSFATO TRICÁLCICO). FRASCO DE 250 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICEROL PURO GRADO REACTIVO PRESENTACIÓN 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXANO GA LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXYL ACETATE, 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE POTASIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDROXIDO DE SODIO GRADO REACTIVO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO PRESENTACIÓN 500 GR POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISODINE FRASCO (500 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS 1: TCCGTAGGTGAACCTGCGG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS 4: TCCTCCGCTTATTGATATGC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS1 TCCGTAGGTGAACCTGCGG 25 NM ESTÁNDAR DESALADO 19", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS4 TCCTCCGCTTATTGATATGC 25 NM ESTÁNDAR DESALADO 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT CEC-CI (COLIFORM&E. COLI COLOR INDICATOR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE LIMPIEZA DE GEL Y PCR QIAQUICK (100). PARA PURIFICACIÓN DE FRAGMENTOS DE PCR Y EXTRACCIONES EN GEL DE 100 REACCIONES (AL MENOS 80-100 REACCIONES EN GEL O 100 PCR).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LINALOOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA ADN. BH 50BP DNA LADDER RTU. (17 BANDS, 50-1,500BPS) CODIGO DM012-R500. 500 MICROLITROS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA GELES DE ADN: BH 100 BP DNA LADDER RTU. DM001-R500. 500 MICROLITROS (11 BANDS, 100-1,500BPS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO BASAL DE MURASHIGE Y SKOOG 50 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO B-KING PARA CULTIVO DE BACTERIAS 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO PDA. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO TCBS. PARA CRECIMIENTO DE VIBRIOS. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO PDA MCD-LAB CAT. 7041", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL AL 99% DE PUREZA PRESENTACIÓN 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOLIBDATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-BUTANOL PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NINHIDRINA PRESENTACIÓN DE 10 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO BÁSICO DE BISMUTO (III) PRESENTACIÓN DE 100 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE AMONIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE BISMUTO PENTAHIDRATADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE CALCIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO (KNO3). FRASCO DE 100 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO PRESENTACIÓN EN FRASCO DE 1 KG EN POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PCR CORE KIT WITH TAQ DNA POLYMERASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEPTONA EXTRACTO DE CARNE FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDO DE HIDROGENO 30% GRADO REACTIVO 4 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PÉROXIDO DE HIDRÓGENO AL 30% RA, PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHYTAGEL FRASCO (250G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLY(VINYLPOLYPYRROLIDONE) 100 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PÚRPURA DE BROMOCRESOL FRASCO DE 250 G PARA USO MICROBIOLÓGICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUELATO DE HIERRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUICK-RNA MICROPREP ZYMO RESEARCH KIT DE 200 MUESTRAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUITOSANO EN POLVO DE ALTA DENSIDAD GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO FOLIN-CIOCALTEU FENOL REAGENT, \"N 500 ML,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA AMONIO RANGO MEDIO HI93715-01 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706A-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706B-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750A-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750B-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA SULFATO RANGO MEDIO HI93751-01 CAJA CON 100 PBAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706A-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706B-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA NITRITOS , PAQUETE CON 100 REACTIVOS HI93708-01", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROJO CONGO 25 G G PARA USO MICROBIOLÓGICO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RVS 12.75G RAPPAPORT-VASSILIADIS-SOYA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SACAROSA FRASCO DE 450G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SET DE DNTPS PARA PCR POR SEPARADO. 4 X 25 UMOL (4X250UL)/ 4 X 100 UMOL (4X1ML) / 4 X 100 UMOL (4X4X250UL) / 4 X 500 UMOL (4X5X1 ML) / 4 X 1000 UMOL (4×10 ML). EL SET CONSISTE EN CUATRO SOLUCIONES 100 MM SEPARADAS DE: DATP, DCTP, DGTP Y DTTP RESPECTIVAMENTE. ULTRAPURO: >99% TRIFOSFATO POR HPLC.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SILICON STANDARD PARA AAS TRACECERT 1000 MG/L SI IN NAOH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIO HEXAMETAFOSFATO 65-70% DE 5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 10 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 4. 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 7 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "STANDAR CONDUCTIVIDAD ELECTRICA 1413 µS/CM 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO CÚPRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE CALCIO (CASO4). FCO DE 250 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE COBRE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE MAGNESIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE MANGANESO ANHIDRO MNSO4 FCO DE 100 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE ZINC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TARTRATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRICLORURO FÉRRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPTONA (DIGERIDO PANCREÁTICO DE CASEÍNA) 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPTONA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WP200I GAMMA IRRAD COLILERT 100ML 200PK(AMPOLLETAS PARA DETECCIÓN DE COLIFORMES Y E. COLI) PARA 100 ML. AYAG981297300. 12352200.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WPSE020I GAMMA IR PSEUDALERT 100ML 20PK. AYAG981807600. 12352200", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "YODURO DE POTASIO PRESENTACIÓN DE 100 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZYMOBIOMICS DNA MICROPREP KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZYMOBIOMICS DNA MINIPREP KIT (LYSIS TUBES) 50 PREPS. D4300", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO CLORHÍDTICO VALORADO 0.1 N PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODFIO LENTEJAS J.T. BAKER PRESENTACIÓN 5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CITRATO DE TRISÓDICO DIHIDRATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-AMINOÁCIDOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTÁNDAR DE AMINOÁCIDO PRESENTACIÓN 5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "162", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIODIGLICOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NORLEUCINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NORVALINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CATALIZADORES KJELDAHL PARA LA DETECCIÓN DEL NITRÓGENO PRESENTACIÓN 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 4L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "167", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXANO GRADO REACTIVO PRESENTACIÓN 20 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "168", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOL. ESTANDAR DE FOSOFORO 100 ML. 170340-0100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTANDAR DE CALCIO 100 ML. 119778-0100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "170", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO GIBERELICO -BIOGIB 10GR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "171", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO FOSFORICO RA. 2.5 LTS. 0260-05", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "172", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO PVO. 500 GRS. 3506-01", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "173", "cucop_code": "25501-0002", "specific_item_code": "25501", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 1000 ML. MEMBRANA 47 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "174", "cucop_code": "25501-0002", "specific_item_code": "25501", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 500 ML. MEMBRANA 47 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "175", "cucop_code": "25501-0065", "specific_item_code": "25501", "cucop_description": "BANDEJA", "description": "BANDEJAS PARA CUANTIFICACIÓN DE BACTERIAS UTILIZANDO LOS KITS RÁPIDOS DE IDEXX CON 97 POCILLOS PAQUETE DE 100 PIEZAS NO. DE PARTE 98-21675-00 (100-PACK STERILE 97-WELL QUANTI TRAY/200(PAQUETE DE 100 CHAROLAS QUANTI-TRAY/200 CADA UNA DE 97 POZOS) AYAG982167500 ( 41122800))", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "176", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 15.9X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "177", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 22.2X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "178", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 38.1X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "179", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 50.8X 8MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "180", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 10X3 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "181", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 7X2 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "182", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "BIORREACTORES BIT CON ESPONJA DE 1 LT QUE CONTIENE CADA UNO LO SIGUIENTE: 2 FRASCO DE VIDRIO 1.0 LT. 2 TAPA DE PLASTICO ESTERILIZABLE C/2 PERFORACIONES 2 EMPAQUE PLANO DE SILICON DE 70X7X1MM LUZ. 55 MM 4 CONECTOR PASAMURO ESTERILIZABLE DE PLASTICO 8 MM. 8 EMPAQUE PLANO D/SILICON DE 16X5X2MM LUZ 8 MM 2 FILTRO HIDROFOBICO ESTERILIZABLE 50 MM D/DIAMY 0.2 UM 2 ABRAZADERA DE MUELLE PARA MANGUERA 8.9 - 9.3 MM 4 ABRAZADERA DE ALAMBRE PARA MANGUERA 9.4 -10.4 MM 0.7 MANGUERA ESTERILIZABLE DE SILICÓN PLATINIZADA 6 MM. DIAM. INT. 1 TUBO DE ACERO INOX DE 8 MM D/DIAM. DE 13 CM. C/ARANDELA 1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "183", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "BLOQUE PARA BAÑO SECO ANALOGO PARA 20 TUBOS DE 13MM , 2.0 ML ( 9 CM X 7.5 CM X 4 CM ALTO. APROX.)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "184", "cucop_code": "25501-0132", "specific_item_code": "25501", "cucop_description": "TUBO SALOMÓNICO", "description": "BOTELLAS PLÁSTICAS CON MARCA DE LÍNEA A UN VOLUMEN DE 100 ML PAQUETE CON 200 PIEZAS (200-PACK 120ML VESSEL WITH 100ML) AYAG980615900 (41115822)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "185", "cucop_code": "25501-0130", "specific_item_code": "25501", "cucop_description": "BULBO DE LATEX", "description": "BULBO DE HULE 2 ML DE CAPACIDAD 50 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "186", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "BURETA 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "187", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "BURETA 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "188", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJA DE PETRI VIDRIO, 6 CM DIAMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "189", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "CAJA PARA 100 PORTAOBJETOS COLOR NEGRA CON CORCHO- MEDIDAS 208X175X34 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "190", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJA PETRI DE PLASTICO ESTERIL 90 X 15 MM DESECHABLES INDIVIDUALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "191", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI DE POLIESTIRENO DESECHABLES DE 90 X 15 MM, CON 4 DIVISIONES. ESTÉRILES. CAJA DE 540 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "192", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI DE POLIESTIRENODESECHABLES DE 90 X 15 MM. SIN DIVISION. ESTÉRILES. CAJA DE 540 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "193", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI PLÁSTICAS ESTÉRILES 90 X 15 CM.PAQUETE DE 500 PZAS. PARA CRECIMIENTO MICROBIANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "194", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "COLILERT/COLILERT-18 COMPARATOR. PREDISPE. AYAG980922700.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "195", "cucop_code": "25501-0107", "specific_item_code": "25501", "cucop_description": "CRONOMETRO", "description": "CONÓMETRO CON 4 CANALES Y ALARMA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "196", "cucop_code": "25501-0009", "specific_item_code": "25501", "cucop_description": "CRISOL", "description": "CRISOL DE PORCELANA FORMA ALTA CON TAPA 100 ML COORSTEK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "197", "cucop_code": "25501-0107", "specific_item_code": "25501", "cucop_description": "CRONOMETRO", "description": "CRONÓMETRO DE FACIL USO 1 S A 99 MIN, 59 S.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "198", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETA DE CUARZO UV-VIS 10 MM, 3.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "199", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETA DE CUARZO UV-VIS 5 MM 1.7 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "200", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETAS DE VIDRIO PARA H1832XX SERIE. CAJA CON 4 PZA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "201", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "DATA LOGGER (REGISTRADOR DE DATOS) DE TEMPERATURA/HUMEDAD RELATIVA U23-001", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "202", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO C.E. HI76310", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "203", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO PH HI1110", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "204", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO PH HI1131", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "205", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "ELECTROLYTE SOLUCION HI7071", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "206", "cucop_code": "25501-0016", "specific_item_code": "25501", "cucop_description": "EMBUDO SEPARADOR", "description": "EMBUDO DE VIDRIO TALLO CORTO ANGULO 58*", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "207", "cucop_code": "25501-0123", "specific_item_code": "25501", "cucop_description": "EXTRACTOR SOXHLET", "description": "EQUIPO DE EXTRACCION SOXHLET MATRAZ 250 ML.EBULLICION, CONDENSADOR ALLIHN, JUNTA INFERIOR 24/40, SUPERIOR 45/50, ALTURA APROX. 711 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "208", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "EQUIPO DE ULTRASONIDO PORTATIL. PUEDE SER MINDRAY DP10H CON 1 TRANSDUCTOR LINEAL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "209", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "ESPATULA TIPO HEYMAN UN EXTREMO PLANO Y OTRO ACANALADO LONGITUD 150 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "210", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCO PARA DILUCIÓN DE LECHE BOCA ANCHA DE VIDRIO DE BOROSILICATO, CON AFORO A 99 ML, INCLUYA TAPA FENÓLICA ROSCADA Y SELLO DE HULE ESTERILIZABLE EN AUTOCLAVE. CAPACIDAD DE 160 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "211", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCOS ÁMBAR DE 50 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "212", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCOS SELLADOS HERMÉTICAMENTE CON ARILLO DE GOMA DE 800 ML-1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "213", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "FUENTE DE PODER PARA CAMARA DE ELECTROFORESIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "214", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ENFRIADORA PARA 32 TUBOS TRUE NORTH MINI-COOLER, 32 POCILLOS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "215", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ENFRIADORA PARA 96 TUBOS DE 0.2 ML 120729 PCR COOLER, 96 POCILLOS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "216", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA CONGELACIÓN . PARA LA PROTECCIÓON DE ENZIMAS, CÉLULAS, REACTIVOS Y SOLUCIONES QUE DEBEN MANTENERSE A BAJA TEMPERATURA (-20 C) MIENTRAS SE UTILIZAN EN LABORATOIRO. CAPACIDAD DE 18 VIALES DE 0.2 A 2.0 ML. DE POLICARBONATO CON TAPA DE ROSCA DE POLIETILENO. MEDIDAS APROXIMADAS DE 117 DE DIÁMETRO X 86 MM DE ALTURA, O BIEN DE 243 MM LARGO X 157 MM DE ANCHO X 146 MM DE ALTO. CIRCULAR O RECTANGULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "217", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS 4 WAY RACK X PIEZA. PARA TUBOS DE 50, 15, 1.5/2.0 Y 0.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "218", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS CONICOS TUBOS DE 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "219", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS ROTABLE. CUENTE CON 4 MÓDULOS GIRATORIOS INTERCONECTADOS CON CAPACIDAD PARA DIFERENTES TUBOS CÓNICOS DE 15- 50 ML Y 1.5 ML. ESTERIZABLE EN AUTOCLAVE. CADA MÓDULO DE DIFEREENTE COLOR: VIOLETA, AMARILLO, AZUL Y VERDE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "220", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ROTATORIA CAPACIDAD 10 A 17 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "221", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "HEMATOCÍMETRO O CÁMARA DE NEUBAUER. PARA DETERMINAR LA CONCENTRACIÓN DE CÉLULAS EN UN MEDIO LÍQUIDO. INCLUYA DOS PORTAOBJETOS PARA EL HEMATOCITÓMETRO CON ESPESOR DE 0.4 MM. 0.100 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "222", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "JUEGO DE MICROPIPETAS FINNPIPETTE FINNP70700 CON 4 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "223", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "KIT SINGLE PATH SAMONELLA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "224", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "LUXÓMETRO O EXPOSÍMETRO. MIDA MÍNIMO DE 0 A 50,000 LUXES. CUENTE CON INDICADOR DE BATERÍA BAJA Y TEMPORIZADOR PARA APAGADO AUTOMÁTICO.INCLUYA BATERÍA Y ESTUCHE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "225", "cucop_code": "25501-0079", "specific_item_code": "25501", "cucop_description": "PAÑUELOS ANTIESTATICOS", "description": "MASCARA PARA GASES (GRANDE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "226", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRACES ERLENMEYER DE 500 MILILITROS TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "227", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "228", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "229", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "230", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "231", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "232", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 1000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "233", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 100ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "234", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 20 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "235", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 2000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "236", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 30 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "237", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 300ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "238", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 40 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "239", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ESMERILADO SOXHLET 250 ML, 24/40", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "240", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "MEDIDOR DE CALIDAD DE AGUA PH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "241", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "MEDIDOR DE PH, TEMPERATURA, ACIDEZ Y ALCALINIDAD PARA SUELO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "242", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "MICROTUBOS COLOR AMBAR DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 500 A 1000 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "243", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "MICROTUBOS TRANSPARENTE DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 1,000 PZAS. PARA EXTRACCIÓN DE ADN. BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "244", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 0.1-2.5 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "245", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 1000-10000 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "246", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 100-1000 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "247", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 20-200 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "248", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 5-10 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "249", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 10-100 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "250", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO DE PORCELANA CON PISTILO DE 125 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "251", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO DE PORCELANA CON PISTILO DE 65 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "252", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 50 ML (MEDIDAS 70 MM X 47 MM DE DIÁMETRO INTERNO).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "253", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 65 O 80 ML (MEDIDASAPROX. 80 MM X 53 MM DE DIÁMETRO INTERNO)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "254", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "OWL A3-1 LARGE-GEL ELECTROPHORESISSYSTEMWELL-SUITED FOR PLANT GENOMICS STUDIES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "255", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PALL FILTROS ESTÉRILES ACRODISC™ PARA JERINGAS CON MEMBRANA SUPOR™ CON MEMBRANAS DE POLIESTERSULFONA (PES). PALL. CAT. 4611 (0,1 µM 25 MM). CAJA DE 50 PZAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "256", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO NO. 42 WHATMAN,DIÁMETRO 110MM, PAQUETE CON 100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "257", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO WHATMAN NO. 1, DIAMETRO 110 MM CAJA CON 100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "258", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL PARAFILM 100 MM X 75 M \"M\"SEALING", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "259", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "PICNOMETRO CALIBRADO DE 50 ML. PICNÓMETROS SON FABRICADO EN VIDRIO SEGÚN LA NORMA ISO 3507. TANTO EL CUERPO COMO EL TAPÓN LLEVAN EL MISMO NÚMERO DE CÓDIGO DE IDENTIFICACIÓN. CALIBRADO JUNTO CON EL TAPÓN CON UNA PRECISIÓN DE 0,001 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "260", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS 2 DEDOS CON NUEZ GIRATORIA, 12-45 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "261", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS DE DISECCION LARGAS DE 30CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "262", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA PAPEL DE ACERO INOXIDABLE CON PUNTA CURVA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "263", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA REFRIGERANTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "264", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA VASO CUBIERTA DE VINILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "265", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS SENCILLA PARA BURETARECUBIERTA DE VINILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "266", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS TIPO RELOJERO LARGAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "267", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETA DE VIDRIO DE 1100 MILILITROS PARA DETERMINAR TEXTURA DEL SUELO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "268", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO DE 500 MILILITROS (ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "269", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 10 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "270", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 100 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "271", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 25 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "272", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 50 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "273", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS AMARILLAS DE 20 A 200 µL,PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "274", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA AMARILLAS (20 A 200 UL) EN RACK ESTÉRILES DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS LA CAJA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "275", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA AZULES (1000 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS TOTALES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "276", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA BLACAS (0.5-10 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS EN TOTAL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "277", "cucop_code": "25501-0043", "specific_item_code": "25501", "cucop_description": "SOPORTE PARA LABORATORIO", "description": "SOPORTE UNIVERSAL CON VARILLA DE 60 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "278", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "TAPA P/ TUBO DE ENSAYE DEL Nº 9820", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "279", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOHIGRÓMETRO DIGITAL PARA INTERIOR Y EXTERIOR CON REGISTRO DE TEMPERATURA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "280", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOHIGRÓMETRO PARA INTERIOR Y EXTERIOR. PARA REGISTRO DE TEMPERATURA Y HUMEDAD. REGISTRE MÁXIMOS Y MÍNIMOS DE DICHAS VARIABLES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "281", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO DE MERCURIO PARA LABORATORIO, FONDO AMARILLO. DE -20 A 110 C. DIVISIÓN DE UN GRADO. LONGITUD DE 322 MM. INMERSION TOTAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "282", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "283", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "284", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -10 A 260", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "285", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -100 A 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "286", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -20 A 250", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "287", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -50 A 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "288", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO INFRARRORO TIPO PISTOLA CON LASER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "289", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO MÁXIMO MÍNIMO PARA INVERNADERO O JARDÍN, TEMPERATURAS MÁXIMAS Y MÍNIMAS, ACCESORIOS DE INVERNADERO PARA INTERIORES Y EXTERIORES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "290", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "TROMPA DE VACIO 6140-0010", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "291", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO DE ENSAYE Nº 9820", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "292", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO PARA DIGESTION LABCONCO 250ML, COD. 23030 Ó 23040. CAJA CON 25", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "293", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE ENSAYE DE VIDRIO DE BOROSILICATO (10X75 MM) PARA CULTIVO MICROBIOLÓGICO. AUTOCLAVABLES. SIN LABIO. QUÍMICA. CON ÁREA PARA MARCAR EN ESMALTE DE CERÁMICA BLANCA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "294", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE FONDO PLANO DE 20 X 120 MM. DE FABRICACIÓN NACIONAL. 10 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "295", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 15 ML, GRADUADOS. TIPO FALCON. BOLSA DE 500 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "296", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 50 ML DE FONDO PLANO, GRADUADOS. TIPO FALCON. BOLSA DE 50 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "297", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS EPPENDORF DE 1.5 ML, PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "298", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS EPPENDORF DE 2 ML, PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "299", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO 100 ML TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "300", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "301", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 100 ML 1 CAJA CON 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "302", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "303", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 2000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "304", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 50 MILILITROS TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "305", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 50 ML PAQUETE CON 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "306", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES AMBAR DE 5 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "307", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES AMBAR DE 50 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "308", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "Y&M-CI(YEAST & MOLD COLOR INDICATOR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "309", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1001 PH PROBE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "310", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1004 AMMONIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "311", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1005 CHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "312", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1006 NITRITE PROBE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "313", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 2002 GALVANIC DO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "314", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "FILTRO DE VIDRIO SINTERIZADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "315", "cucop_code": "25501-0009", "specific_item_code": "25501", "cucop_description": "CRISOL", "description": "CRISOLES DE PORCELANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "316", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PLIEGO DE PAPEL FILTRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "317", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "CHAROLA PARA HORNEAR DE ALUMINIO - 13 X 18 X 1\", MEDIA CHAROLA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "318", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PRENSA PARA TORTILLAS, 15.24 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "319", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "RODILLO DE MADERA DE 17.6 PULGADAS PARA HORNEAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "320", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PALA MISERABLE SILICON", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "321", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "BOWL, TAZÓN DE ACERO INOXIDABLE MEDIANO DE 28CM X 11.5CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" } ] } ], "awards": [ { "id": "C-2023-00071312", "internal_reference": "CP-VER-PD-AD-017/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "normalized_name": "COMERCIALIZADORA ALPHALAB", "rfc_type": null, "slug": "comercializadora-alphalab" }, "contract_period": { "published_at": "2023-07-11T18:18:57.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "704757.13", "tax": "112664.49", "total": "817421.62", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "1-METHYLBUTYL ACETATE, 100 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2421.76", "subtotal": "2421.76", "tax": "387.48", "other_taxes": null, "total": "2809.24" }, { "number": "0", "cucop_code": "25101-0039", "description": "ACETATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162.67", "subtotal": "162.67", "tax": "26.03", "other_taxes": null, "total": "188.7" }, { "number": "0", "cucop_code": "25101-0040", "description": "ACETATO DE SODIO R.A, CRISTAL 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1185.33", "subtotal": "1185.33", "tax": "189.65", "other_taxes": null, "total": "1374.98" }, { "number": "0", "cucop_code": "25101-0041", "description": "ACETONA =99.5% 4 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1060.67", "subtotal": "1060.67", "tax": "169.71", "other_taxes": null, "total": "1230.38" }, { "number": "0", "cucop_code": "25101-0042", "description": "ACETONA GARRAFA 20 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2970.67", "subtotal": "2970.67", "tax": "475.31", "other_taxes": null, "total": "3445.98" }, { "number": "0", "cucop_code": "25101-0043", "description": "ÁCIDO ACÉTICO AL 98 % PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339.33", "subtotal": "339.33", "tax": "54.29", "other_taxes": null, "total": "393.62" }, { "number": "0", "cucop_code": "25101-0044", "description": "ÁCIDO ACÉTICO GLACIAL PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339.33", "subtotal": "339.33", "tax": "54.29", "other_taxes": null, "total": "393.62" }, { "number": "0", "cucop_code": "25101-0046", "description": "ÁCIDO ANHIDRIDO ACÉTICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94" }, { "number": "0", "cucop_code": "25101-0046", "description": "ÁCIDO CLORHIDRICO GRADO ANALITICO 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "236", "subtotal": "236", "tax": "37.76", "other_taxes": null, "total": "273.76" }, { "number": "0", "cucop_code": "25101-0047", "description": "ÁCIDO CLORHIDRICO GRADO REACTIVO DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "781.33", "subtotal": "781.33", "tax": "125.01", "other_taxes": null, "total": "906.34" }, { "number": "0", "cucop_code": "25101-0049", "description": "ÁCIDO FOSFOWOLFRÁMICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3781.76", "subtotal": "3781.76", "tax": "605.08", "other_taxes": null, "total": "4386.84" }, { "number": "0", "cucop_code": "25101-0053", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74" }, { "number": "0", "cucop_code": "25101-0054", "description": "ÁCIDO SULFURICO GRADO ANALITICO 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74" }, { "number": "0", "cucop_code": "25101-0055", "description": "ÁCIDO SULFURICO GRADO REACTIVO 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74" }, { "number": "0", "cucop_code": "25101-0056", "description": "ÁCIDO SULFURICO GRADO REACTIVO DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1016.67", "subtotal": "1016.67", "tax": "162.67", "other_taxes": null, "total": "1179.34" }, { "number": "0", "cucop_code": "25101-0057", "description": "ÁCIDO VALÉRICO DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2206.47", "subtotal": "2206.47", "tax": "353.04", "other_taxes": null, "total": "2559.51" }, { "number": "0", "cucop_code": "25101-0058", "description": "AGAR BACTERIOLOGICO FRASCO DE 250 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1905.77", "subtotal": "1905.77", "tax": "304.92", "other_taxes": null, "total": "2210.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "257.69", "subtotal": "257.69", "tax": null, "other_taxes": null, "total": "257.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA BOTELLAS DE 1 LITRO CADA UNO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "68", "subtotal": "68", "tax": "10.88", "other_taxes": null, "total": "78.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA GALÓN DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "99.33", "subtotal": "99.33", "tax": "15.89", "other_taxes": null, "total": "115.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA GARRAFÓN DE 19 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "346.4", "subtotal": "346.4", "tax": null, "other_taxes": null, "total": "346.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL AMÍLICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "354.67", "subtotal": "354.67", "tax": "56.75", "other_taxes": null, "total": "411.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETILICO AL 96% CON 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "916.01", "subtotal": "916.01", "tax": "146.56", "other_taxes": null, "total": "1062.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ISOAMILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3570", "subtotal": "3570", "tax": "571.2", "other_taxes": null, "total": "4141.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ISOPROPILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1058.67", "subtotal": "1058.67", "tax": "169.39", "other_taxes": null, "total": "1228.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL METILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "758", "subtotal": "758", "tax": "121.28", "other_taxes": null, "total": "879.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALGINATO DE SODIO EN POLVO GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "686.21", "subtotal": "686.21", "tax": "109.79", "other_taxes": null, "total": "796" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANHIDRIDO ACÉTICO AL 99% DE PUREZA PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3833.53", "subtotal": "3833.53", "tax": "613.36", "other_taxes": null, "total": "4446.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "BACTOZOLTM. KIT PARA AISLACIÓN DE ADN BACTERIANO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5266", "subtotal": "5266", "tax": "842.56", "other_taxes": null, "total": "6108.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "BPW AGUA PEPTONADA TAMPONADA 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1635.33", "subtotal": "1635.33", "tax": "261.65", "other_taxes": null, "total": "1896.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 10 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 4 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 7 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBON ACTIVADO 100G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "96.67", "subtotal": "96.67", "tax": "15.47", "other_taxes": null, "total": "112.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBORUMDUM -CARBURO DE SILICONA CALIBRE FINO FRASCO DE 250 GR (SILICON CARBIDE -400 MESH PARTICLE SIZE, =97.5% SINÓNIMOS: CARBON SILICIDE, CARBORUNDUM, METHANIDYLIDYNESILANYLIUM, SILICON MONOCARBIDE 250 G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1461.76", "subtotal": "1461.76", "tax": "233.88", "other_taxes": null, "total": "1695.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "CGINT GGCCTCCCGCCTCCGGGCGG 25 NM ESTÁNDAR DESALADO 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "CGINT: GGCCTCCCGCCTCCGGGCGG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROFORMO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "383.33", "subtotal": "383.33", "tax": "61.33", "other_taxes": null, "total": "444.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE CALCIO ANHÍDRO ACS DE 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "992", "subtotal": "992", "tax": "158.72", "other_taxes": null, "total": "1150.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE HIERRO (III) PRESENTACIÓN DE 500 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1255.33", "subtotal": "1255.33", "tax": "200.85", "other_taxes": null, "total": "1456.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO MERCÚRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "485.33", "subtotal": "485.33", "tax": "77.65", "other_taxes": null, "total": "562.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIHIDRÓGENO FOSFATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2284.12", "subtotal": "2284.12", "tax": "365.46", "other_taxes": null, "total": "2649.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTER DEL ÁCIDO 2-AMINOETILDIFENIL BÓRICO (AEDBE) PRESENTACIÓN 5 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2544.12", "subtotal": "2544.12", "tax": "407.06", "other_taxes": null, "total": "2951.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHYL 4-[BENZYL(METHYL)AMINO]BUTANOATE PH017049-1G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4292.35", "subtotal": "4292.35", "tax": "686.78", "other_taxes": null, "total": "4979.13" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE TÉ VERDE ESTANDARIZADO EN CAPSULAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1151.15", "subtotal": "1151.15", "tax": "184.18", "other_taxes": null, "total": "1335.33" }, { "number": "0", "cucop_code": "25101-0037", "description": "FENOLFTALEÍNA 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "41.2", "subtotal": "41.2", "tax": "6.59", "other_taxes": null, "total": "47.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DE CALCIO CA3(PO4)2 (FOSFATO TRICÁLCICO). FRASCO DE 250 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "264", "subtotal": "264", "tax": "42.24", "other_taxes": null, "total": "306.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICEROL PURO GRADO REACTIVO PRESENTACIÓN 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "352.67", "subtotal": "352.67", "tax": "56.43", "other_taxes": null, "total": "409.1" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXANO GA LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "420.67", "subtotal": "420.67", "tax": "67.31", "other_taxes": null, "total": "487.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXYL ACETATE, 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1241.76", "subtotal": "1241.76", "tax": "198.68", "other_taxes": null, "total": "1440.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "364.67", "subtotal": "364.67", "tax": "58.35", "other_taxes": null, "total": "423.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDROXIDO DE SODIO GRADO REACTIVO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "132", "subtotal": "132", "tax": "21.12", "other_taxes": null, "total": "153.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISODINE FRASCO (500 ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "203.13", "subtotal": "203.13", "tax": "32.5", "other_taxes": null, "total": "235.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS 1: TCCGTAGGTGAACCTGCGG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS 4: TCCTCCGCTTATTGATATGC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS1 TCCGTAGGTGAACCTGCGG 25 NM ESTÁNDAR DESALADO 19", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS4 TCCTCCGCTTATTGATATGC 25 NM ESTÁNDAR DESALADO 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE LIMPIEZA DE GEL Y PCR QIAQUICK (100). PARA PURIFICACIÓN DE FRAGMENTOS DE PCR Y EXTRACCIONES EN GEL DE 100 REACCIONES (AL MENOS 80-100 REACCIONES EN GEL O 100 PCR).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8411.25", "subtotal": "8411.25", "tax": "1345.8", "other_taxes": null, "total": "9757.05" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO BASAL DE MURASHIGE Y SKOOG 50 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2610.9", "subtotal": "2610.9", "tax": "417.74", "other_taxes": null, "total": "3028.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO B-KING PARA CULTIVO DE BACTERIAS 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL AL 99% DE PUREZA PRESENTACIÓN 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1885", "subtotal": "1885", "tax": "301.6", "other_taxes": null, "total": "2186.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOLIBDATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "373.33", "subtotal": "373.33", "tax": "59.73", "other_taxes": null, "total": "433.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-BUTANOL PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1594.71", "subtotal": "1594.71", "tax": "255.15", "other_taxes": null, "total": "1849.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "NINHIDRINA PRESENTACIÓN DE 10 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "391.33", "subtotal": "391.33", "tax": "62.61", "other_taxes": null, "total": "453.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO BÁSICO DE BISMUTO (III) PRESENTACIÓN DE 100 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "694", "subtotal": "694", "tax": "111.04", "other_taxes": null, "total": "805.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE AMONIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2420", "subtotal": "2420", "tax": "387.2", "other_taxes": null, "total": "2807.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE BISMUTO PENTAHIDRATADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "694", "subtotal": "694", "tax": "111.04", "other_taxes": null, "total": "805.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "165.67", "subtotal": "165.67", "tax": "26.51", "other_taxes": null, "total": "192.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO (KNO3). FRASCO DE 100 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "158.87", "subtotal": "158.87", "tax": "25.42", "other_taxes": null, "total": "184.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2264", "subtotal": "2264", "tax": "362.24", "other_taxes": null, "total": "2626.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO PRESENTACIÓN EN FRASCO DE 1 KG EN POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "174.67", "subtotal": "174.67", "tax": "27.95", "other_taxes": null, "total": "202.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDO DE HIDROGENO 30% GRADO REACTIVO 4 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1107.33", "subtotal": "1107.33", "tax": "177.17", "other_taxes": null, "total": "1284.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "PÉROXIDO DE HIDRÓGENO AL 30% RA, PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "279.33", "subtotal": "279.33", "tax": "44.69", "other_taxes": null, "total": "324.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHYTAGEL FRASCO (250G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3301.76", "subtotal": "3301.76", "tax": "528.28", "other_taxes": null, "total": "3830.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLY(VINYLPOLYPYRROLIDONE) 100 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2887.65", "subtotal": "2887.65", "tax": "462.02", "other_taxes": null, "total": "3349.67" }, { "number": "0", "cucop_code": "25101-0037", "description": "PÚRPURA DE BROMOCRESOL FRASCO DE 250 G PARA USO MICROBIOLÓGICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6057.06", "subtotal": "6057.06", "tax": "969.13", "other_taxes": null, "total": "7026.19" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUICK-RNA MICROPREP ZYMO RESEARCH KIT DE 200 MUESTRAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "24250", "subtotal": "24250", "tax": "3880", "other_taxes": null, "total": "28130" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706A-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706B-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706A-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706B-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "RVS 12.75G RAPPAPORT-VASSILIADIS-SOYA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "65284.66", "subtotal": "65284.66", "tax": "10445.55", "other_taxes": null, "total": "75730.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "SACAROSA FRASCO DE 450G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "655.55", "subtotal": "655.55", "tax": "104.89", "other_taxes": null, "total": "760.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "SILICON STANDARD PARA AAS TRACECERT 1000 MG/L SI IN NAOH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1351.18", "subtotal": "1351.18", "tax": "216.19", "other_taxes": null, "total": "1567.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIO HEXAMETAFOSFATO 65-70% DE 5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7253.53", "subtotal": "7253.53", "tax": "1160.56", "other_taxes": null, "total": "8414.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "579.33", "subtotal": "579.33", "tax": "92.69", "other_taxes": null, "total": "672.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "579.33", "subtotal": "579.33", "tax": "92.69", "other_taxes": null, "total": "672.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 10 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 4. 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 7 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO CÚPRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "314", "subtotal": "314", "tax": "50.24", "other_taxes": null, "total": "364.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE CALCIO (CASO4). FCO DE 250 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400.67", "subtotal": "400.67", "tax": "64.11", "other_taxes": null, "total": "464.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE COBRE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "314", "subtotal": "314", "tax": "50.24", "other_taxes": null, "total": "364.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE MAGNESIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162", "subtotal": "162", "tax": "25.92", "other_taxes": null, "total": "187.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE MANGANESO ANHIDRO MNSO4 FCO DE 100 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162", "subtotal": "162", "tax": "25.92", "other_taxes": null, "total": "187.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "210.67", "subtotal": "210.67", "tax": "33.71", "other_taxes": null, "total": "244.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE ZINC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "176", "subtotal": "176", "tax": "28.16", "other_taxes": null, "total": "204.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "TARTRATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "352", "subtotal": "352", "tax": "56.32", "other_taxes": null, "total": "408.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRICLORURO FÉRRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "310", "subtotal": "310", "tax": "49.6", "other_taxes": null, "total": "359.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "452", "subtotal": "452", "tax": "72.32", "other_taxes": null, "total": "524.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "452", "subtotal": "452", "tax": "72.32", "other_taxes": null, "total": "524.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "WP200I GAMMA IRRAD COLILERT 100ML 200PK(AMPOLLETAS PARA DETECCIÓN DE COLIFORMES Y E. COLI) PARA 100 ML. AYAG981297300. 12352200.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31679.73", "subtotal": "31679.73", "tax": "5068.76", "other_taxes": null, "total": "36748.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "WPSE020I GAMMA IR PSEUDALERT 100ML 20PK. AYAG981807600. 12352200", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4335.86", "subtotal": "4335.86", "tax": "693.74", "other_taxes": null, "total": "5029.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "YODURO DE POTASIO PRESENTACIÓN DE 100 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "627.33", "subtotal": "627.33", "tax": "100.37", "other_taxes": null, "total": "727.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZYMOBIOMICS DNA MICROPREP KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2187.5", "subtotal": "2187.5", "tax": "350", "other_taxes": null, "total": "2537.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZYMOBIOMICS DNA MINIPREP KIT (LYSIS TUBES) 50 PREPS. D4300", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11125", "subtotal": "11125", "tax": "1780", "other_taxes": null, "total": "12905" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO CLORHÍDTICO VALORADO 0.1 N PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "92.86", "subtotal": "92.86", "tax": "14.86", "other_taxes": null, "total": "107.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODFIO LENTEJAS J.T. BAKER PRESENTACIÓN 5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1582.14", "subtotal": "1582.14", "tax": "253.14", "other_taxes": null, "total": "1835.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "550", "subtotal": "550", "tax": "88", "other_taxes": null, "total": "638" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "585.71", "subtotal": "585.71", "tax": "93.71", "other_taxes": null, "total": "679.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "CITRATO DE TRISÓDICO DIHIDRATO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "296.43", "subtotal": "296.43", "tax": "47.43", "other_taxes": null, "total": "343.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-AMINOÁCIDOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7913.33", "subtotal": "7913.33", "tax": "1266.13", "other_taxes": null, "total": "9179.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTÁNDAR DE AMINOÁCIDO PRESENTACIÓN 5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2782.67", "subtotal": "2782.67", "tax": "445.23", "other_taxes": null, "total": "3227.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "NORLEUCINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2464", "subtotal": "2464", "tax": "394.24", "other_taxes": null, "total": "2858.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "NORVALINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2724", "subtotal": "2724", "tax": "435.84", "other_taxes": null, "total": "3159.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 4L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1162.86", "subtotal": "1162.86", "tax": "186.06", "other_taxes": null, "total": "1348.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXANO GRADO REACTIVO PRESENTACIÓN 20 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3017.86", "subtotal": "3017.86", "tax": "482.86", "other_taxes": null, "total": "3500.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOL. ESTANDAR DE FOSOFORO 100 ML. 170340-0100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3101.33", "subtotal": "3101.33", "tax": "496.21", "other_taxes": null, "total": "3597.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTANDAR DE CALCIO 100 ML. 119778-0100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "969.33", "subtotal": "969.33", "tax": "155.09", "other_taxes": null, "total": "1124.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO GIBERELICO -BIOGIB 10GR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "315.54", "subtotal": "315.54", "tax": "50.49", "other_taxes": null, "total": "366.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO FOSFORICO RA. 2.5 LTS. 0260-05", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2376.34", "subtotal": "2376.34", "tax": "380.21", "other_taxes": null, "total": "2756.55" }, { "number": "0", "cucop_code": "25501-0002", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 1000 ML. MEMBRANA 47 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8076.87", "subtotal": "8076.87", "tax": "1292.3", "other_taxes": null, "total": "9369.17" }, { "number": "0", "cucop_code": "25501-0002", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 500 ML. MEMBRANA 47 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11973.69", "subtotal": "11973.69", "tax": "1915.79", "other_taxes": null, "total": "13889.48" }, { "number": "0", "cucop_code": "25501-0065", "description": "BANDEJAS PARA CUANTIFICACIÓN DE BACTERIAS UTILIZANDO LOS KITS RÁPIDOS DE IDEXX CON 97 POCILLOS PAQUETE DE 100 PIEZAS NO. DE PARTE 98-21675-00 (100-PACK STERILE 97-WELL QUANTI TRAY/200(PAQUETE DE 100 CHAROLAS QUANTI-TRAY/200 CADA UNA DE 97 POZOS) AYAG982167500 ( 41122800))", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7083.03", "subtotal": "7083.03", "tax": "1133.28", "other_taxes": null, "total": "8216.31" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 15.9X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "82.74", "subtotal": "82.74", "tax": "13.24", "other_taxes": null, "total": "95.98" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 22.2X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "95.08", "subtotal": "95.08", "tax": "15.21", "other_taxes": null, "total": "110.29" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 38.1X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100.78", "subtotal": "100.78", "tax": "16.12", "other_taxes": null, "total": "116.9" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 50.8X 8MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149.33", "subtotal": "149.33", "tax": "23.89", "other_taxes": null, "total": "173.22" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 10X3 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "82.56", "subtotal": "82.56", "tax": "13.21", "other_taxes": null, "total": "95.77" }, { "number": "0", "cucop_code": "25501-0102", "description": "BIORREACTORES BIT CON ESPONJA DE 1 LT QUE CONTIENE CADA UNO LO SIGUIENTE: 2 FRASCO DE VIDRIO 1.0 LT. 2 TAPA DE PLASTICO ESTERILIZABLE C/2 PERFORACIONES 2 EMPAQUE PLANO DE SILICON DE 70X7X1MM LUZ. 55 MM 4 CONECTOR PASAMURO ESTERILIZABLE DE PLASTICO 8 MM. 8 EMPAQUE PLANO D/SILICON DE 16X5X2MM LUZ 8 MM 2 FILTRO HIDROFOBICO ESTERILIZABLE 50 MM D/DIAMY 0.2 UM 2 ABRAZADERA DE MUELLE PARA MANGUERA 8.9 - 9.3 MM 4 ABRAZADERA DE ALAMBRE PARA MANGUERA 9.4 -10.4 MM 0.7 MANGUERA ESTERILIZABLE DE SILICÓN PLATINIZADA 6 MM. DIAM. INT. 1 TUBO DE ACERO INOX DE 8 MM D/DIAM. DE 13 CM. C/ARANDELA 1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3518.65", "subtotal": "3518.65", "tax": "562.98", "other_taxes": null, "total": "4081.63" }, { "number": "0", "cucop_code": "25501-0102", "description": "BLOQUE PARA BAÑO SECO ANALOGO PARA 20 TUBOS DE 13MM , 2.0 ML ( 9 CM X 7.5 CM X 4 CM ALTO. APROX.)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4098.72", "subtotal": "4098.72", "tax": "655.8", "other_taxes": null, "total": "4754.52" }, { "number": "0", "cucop_code": "25501-0132", "description": "BOTELLAS PLÁSTICAS CON MARCA DE LÍNEA A UN VOLUMEN DE 100 ML PAQUETE CON 200 PIEZAS (200-PACK 120ML VESSEL WITH 100ML) AYAG980615900 (41115822)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5445.32", "subtotal": "5445.32", "tax": "871.25", "other_taxes": null, "total": "6316.57" }, { "number": "0", "cucop_code": "25501-0130", "description": "BULBO DE HULE 2 ML DE CAPACIDAD 50 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "140", "subtotal": "140", "tax": "22.4", "other_taxes": null, "total": "162.4" }, { "number": "0", "cucop_code": "25501-0122", "description": "BURETA 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "652.4", "subtotal": "652.4", "tax": "104.38", "other_taxes": null, "total": "756.78" }, { "number": "0", "cucop_code": "25501-0122", "description": "BURETA 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3924.62", "subtotal": "3924.62", "tax": "627.94", "other_taxes": null, "total": "4552.56" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJA DE PETRI VIDRIO, 6 CM DIAMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "36.4", "subtotal": "36.4", "tax": "5.82", "other_taxes": null, "total": "42.22" }, { "number": "0", "cucop_code": "25501-0101", "description": "CAJA PARA 100 PORTAOBJETOS COLOR NEGRA CON CORCHO- MEDIDAS 208X175X34 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "201.68", "subtotal": "201.68", "tax": "32.27", "other_taxes": null, "total": "233.95" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJA PETRI DE PLASTICO ESTERIL 90 X 15 MM DESECHABLES INDIVIDUALES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33.13", "subtotal": "33.13", "tax": "5.3", "other_taxes": null, "total": "38.43" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI DE POLIESTIRENO DESECHABLES DE 90 X 15 MM, CON 4 DIVISIONES. ESTÉRILES. CAJA DE 540 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1639.2", "subtotal": "1639.2", "tax": "262.27", "other_taxes": null, "total": "1901.47" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI DE POLIESTIRENODESECHABLES DE 90 X 15 MM. SIN DIVISION. ESTÉRILES. CAJA DE 540 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1639.2", "subtotal": "1639.2", "tax": "262.27", "other_taxes": null, "total": "1901.47" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI PLÁSTICAS ESTÉRILES 90 X 15 CM.PAQUETE DE 500 PZAS. PARA CRECIMIENTO MICROBIANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1526.67", "subtotal": "1526.67", "tax": "244.27", "other_taxes": null, "total": "1770.94" }, { "number": "0", "cucop_code": "25501-0102", "description": "COLILERT/COLILERT-18 COMPARATOR. PREDISPE. AYAG980922700.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "595.93", "subtotal": "595.93", "tax": "95.35", "other_taxes": null, "total": "691.28" }, { "number": "0", "cucop_code": "25501-0107", "description": "CONÓMETRO CON 4 CANALES Y ALARMA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1288.42", "subtotal": "1288.42", "tax": "206.15", "other_taxes": null, "total": "1494.57" }, { "number": "0", "cucop_code": "25501-0009", "description": "CRISOL DE PORCELANA FORMA ALTA CON TAPA 100 ML COORSTEK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282.86", "subtotal": "282.86", "tax": "45.26", "other_taxes": null, "total": "328.12" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETA DE CUARZO UV-VIS 10 MM, 3.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2398.21", "subtotal": "2398.21", "tax": "383.71", "other_taxes": null, "total": "2781.92" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETA DE CUARZO UV-VIS 5 MM 1.7 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3290.59", "subtotal": "3290.59", "tax": "526.49", "other_taxes": null, "total": "3817.08" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETAS DE VIDRIO PARA H1832XX SERIE. CAJA CON 4 PZA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "596", "subtotal": "596", "tax": "95.36", "other_taxes": null, "total": "691.36" }, { "number": "0", "cucop_code": "25501-0102", "description": "DATA LOGGER (REGISTRADOR DE DATOS) DE TEMPERATURA/HUMEDAD RELATIVA U23-001", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4629", "subtotal": "4629", "tax": "740.64", "other_taxes": null, "total": "5369.64" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO PH HI1110", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4244", "subtotal": "4244", "tax": "679.04", "other_taxes": null, "total": "4923.04" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO PH HI1131", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3980", "subtotal": "3980", "tax": "636.8", "other_taxes": null, "total": "4616.8" }, { "number": "0", "cucop_code": "25501-0016", "description": "EMBUDO DE VIDRIO TALLO CORTO ANGULO 58*", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.4", "subtotal": "238.4", "tax": "38.14", "other_taxes": null, "total": "276.54" }, { "number": "0", "cucop_code": "25501-0102", "description": "EQUIPO DE ULTRASONIDO PORTATIL. PUEDE SER MINDRAY DP10H CON 1 TRANSDUCTOR LINEAL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70831.9", "subtotal": "70831.9", "tax": "11333.1", "other_taxes": null, "total": "82165" }, { "number": "0", "cucop_code": "25501-0102", "description": "ESPATULA TIPO HEYMAN UN EXTREMO PLANO Y OTRO ACANALADO LONGITUD 150 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "106.44", "subtotal": "106.44", "tax": "17.03", "other_taxes": null, "total": "123.47" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCO PARA DILUCIÓN DE LECHE BOCA ANCHA DE VIDRIO DE BOROSILICATO, CON AFORO A 99 ML, INCLUYA TAPA FENÓLICA ROSCADA Y SELLO DE HULE ESTERILIZABLE EN AUTOCLAVE. CAPACIDAD DE 160 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "179.11", "subtotal": "179.11", "tax": "28.66", "other_taxes": null, "total": "207.77" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCOS SELLADOS HERMÉTICAMENTE CON ARILLO DE GOMA DE 800 ML-1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "144.01", "subtotal": "144.01", "tax": "23.04", "other_taxes": null, "total": "167.05" }, { "number": "0", "cucop_code": "25501-0102", "description": "FUENTE DE PODER PARA CAMARA DE ELECTROFORESIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31724", "subtotal": "31724", "tax": "5075.84", "other_taxes": null, "total": "36799.84" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ENFRIADORA PARA 32 TUBOS TRUE NORTH MINI-COOLER, 32 POCILLOS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5148.21", "subtotal": "5148.21", "tax": "823.71", "other_taxes": null, "total": "5971.92" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ENFRIADORA PARA 96 TUBOS DE 0.2 ML 120729 PCR COOLER, 96 POCILLOS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1999.4", "subtotal": "1999.4", "tax": "319.9", "other_taxes": null, "total": "2319.3" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA CONGELACIÓN . PARA LA PROTECCIÓON DE ENZIMAS, CÉLULAS, REACTIVOS Y SOLUCIONES QUE DEBEN MANTENERSE A BAJA TEMPERATURA (-20 C) MIENTRAS SE UTILIZAN EN LABORATOIRO. CAPACIDAD DE 18 VIALES DE 0.2 A 2.0 ML. DE POLICARBONATO CON TAPA DE ROSCA DE POLIETILENO. MEDIDAS APROXIMADAS DE 117 DE DIÁMETRO X 86 MM DE ALTURA, O BIEN DE 243 MM LARGO X 157 MM DE ANCHO X 146 MM DE ALTO. CIRCULAR O RECTANGULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6652.91", "subtotal": "6652.91", "tax": "1064.47", "other_taxes": null, "total": "7717.38" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS 4 WAY RACK X PIEZA. PARA TUBOS DE 50, 15, 1.5/2.0 Y 0.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "859.65", "subtotal": "859.65", "tax": "137.54", "other_taxes": null, "total": "997.19" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS CONICOS TUBOS DE 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "130.67", "subtotal": "130.67", "tax": "20.91", "other_taxes": null, "total": "151.58" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS ROTABLE. CUENTE CON 4 MÓDULOS GIRATORIOS INTERCONECTADOS CON CAPACIDAD PARA DIFERENTES TUBOS CÓNICOS DE 15- 50 ML Y 1.5 ML. ESTERIZABLE EN AUTOCLAVE. CADA MÓDULO DE DIFEREENTE COLOR: VIOLETA, AMARILLO, AZUL Y VERDE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "918.66", "subtotal": "918.66", "tax": "146.99", "other_taxes": null, "total": "1065.65" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ROTATORIA CAPACIDAD 10 A 17 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "918.66", "subtotal": "918.66", "tax": "146.99", "other_taxes": null, "total": "1065.65" }, { "number": "0", "cucop_code": "25501-0077", "description": "JUEGO DE MICROPIPETAS FINNPIPETTE FINNP70700 CON 4 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "27766.25", "subtotal": "27766.25", "tax": "4442.6", "other_taxes": null, "total": "32208.85" }, { "number": "0", "cucop_code": "25501-0102", "description": "KIT SINGLE PATH SAMONELLA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5374.71", "subtotal": "5374.71", "tax": "859.95", "other_taxes": null, "total": "6234.66" }, { "number": "0", "cucop_code": "25501-0079", "description": "MASCARA PARA GASES (GRANDE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "474.36", "subtotal": "474.36", "tax": "75.9", "other_taxes": null, "total": "550.26" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "171.67", "subtotal": "171.67", "tax": "27.47", "other_taxes": null, "total": "199.14" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 1000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "555.03", "subtotal": "555.03", "tax": "88.8", "other_taxes": null, "total": "643.83" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 100ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282.35", "subtotal": "282.35", "tax": "45.18", "other_taxes": null, "total": "327.53" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 2000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1354.63", "subtotal": "1354.63", "tax": "216.74", "other_taxes": null, "total": "1571.37" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ESMERILADO SOXHLET 250 ML, 24/40", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "492.25", "subtotal": "492.25", "tax": "78.76", "other_taxes": null, "total": "571.01" }, { "number": "0", "cucop_code": "25501-0087", "description": "MEDIDOR DE CALIDAD DE AGUA PH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "804.6", "subtotal": "804.6", "tax": "128.74", "other_taxes": null, "total": "933.34" }, { "number": "0", "cucop_code": "25501-0087", "description": "MEDIDOR DE PH, TEMPERATURA, ACIDEZ Y ALCALINIDAD PARA SUELO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "469.08", "subtotal": "469.08", "tax": "75.05", "other_taxes": null, "total": "544.13" }, { "number": "0", "cucop_code": "25501-0047", "description": "MICROTUBOS COLOR AMBAR DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 500 A 1000 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4426.23", "subtotal": "4426.23", "tax": "708.2", "other_taxes": null, "total": "5134.43" }, { "number": "0", "cucop_code": "25501-0047", "description": "MICROTUBOS TRANSPARENTE DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 1,000 PZAS. PARA EXTRACCIÓN DE ADN. BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "662.35", "subtotal": "662.35", "tax": "105.98", "other_taxes": null, "total": "768.33" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 0.1-2.5 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 100-1000 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 20-200 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 5-10 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 10-100 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO DE PORCELANA CON PISTILO DE 125 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "145.71", "subtotal": "145.71", "tax": "23.31", "other_taxes": null, "total": "169.02" }, { "number": "0", "cucop_code": "25501-0094", "description": "OWL A3-1 LARGE-GEL ELECTROPHORESISSYSTEMWELL-SUITED FOR PLANT GENOMICS STUDIES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "38465", "subtotal": "38465", "tax": "6154.4", "other_taxes": null, "total": "44619.4" }, { "number": "0", "cucop_code": "25501-0098", "description": "PALL FILTROS ESTÉRILES ACRODISC™ PARA JERINGAS CON MEMBRANA SUPOR™ CON MEMBRANAS DE POLIESTERSULFONA (PES). PALL. CAT. 4611 (0,1 µM 25 MM). CAJA DE 50 PZAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8774.36", "subtotal": "8774.36", "tax": "1403.9", "other_taxes": null, "total": "10178.26" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO NO. 42 WHATMAN,DIÁMETRO 110MM, PAQUETE CON 100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1349.55", "subtotal": "1349.55", "tax": "215.93", "other_taxes": null, "total": "1565.48" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO WHATMAN NO. 1, DIAMETRO 110 MM CAJA CON 100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "436.55", "subtotal": "436.55", "tax": "69.85", "other_taxes": null, "total": "506.4" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL PARAFILM 100 MM X 75 M \"M\"SEALING", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1284.41", "subtotal": "1284.41", "tax": "205.51", "other_taxes": null, "total": "1489.92" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS 2 DEDOS CON NUEZ GIRATORIA, 12-45 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149", "subtotal": "149", "tax": "23.84", "other_taxes": null, "total": "172.84" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA PAPEL DE ACERO INOXIDABLE CON PUNTA CURVA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "307.12", "subtotal": "307.12", "tax": "49.14", "other_taxes": null, "total": "356.26" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA VASO CUBIERTA DE VINILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "98", "subtotal": "98", "tax": "15.68", "other_taxes": null, "total": "113.68" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS SENCILLA PARA BURETARECUBIERTA DE VINILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149", "subtotal": "149", "tax": "23.84", "other_taxes": null, "total": "172.84" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS TIPO RELOJERO LARGAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "274.71", "subtotal": "274.71", "tax": "43.95", "other_taxes": null, "total": "318.66" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETA DE VIDRIO DE 1100 MILILITROS PARA DETERMINAR TEXTURA DEL SUELO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1795.35", "subtotal": "1795.35", "tax": "287.26", "other_taxes": null, "total": "2082.61" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO DE 500 MILILITROS (ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "586.29", "subtotal": "586.29", "tax": "93.81", "other_taxes": null, "total": "680.1" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS AMARILLAS DE 20 A 200 µL,PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "228.67", "subtotal": "228.67", "tax": "36.59", "other_taxes": null, "total": "265.26" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA AMARILLAS (20 A 200 UL) EN RACK ESTÉRILES DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS LA CAJA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1026.67", "subtotal": "1026.67", "tax": "164.27", "other_taxes": null, "total": "1190.94" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA AZULES (1000 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS TOTALES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1820", "subtotal": "1820", "tax": "291.2", "other_taxes": null, "total": "2111.2" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA BLACAS (0.5-10 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS EN TOTAL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "980", "subtotal": "980", "tax": "156.8", "other_taxes": null, "total": "1136.8" }, { "number": "0", "cucop_code": "25501-0043", "description": "SOPORTE UNIVERSAL CON VARILLA DE 60 CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "195", "subtotal": "195", "tax": "31.2", "other_taxes": null, "total": "226.2" }, { "number": "0", "cucop_code": "25501-0057", "description": "TAPA P/ TUBO DE ENSAYE DEL Nº 9820", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4.06", "subtotal": "4.06", "tax": "0.65", "other_taxes": null, "total": "4.71" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOHIGRÓMETRO DIGITAL PARA INTERIOR Y EXTERIOR CON REGISTRO DE TEMPERATURA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "457.82", "subtotal": "457.82", "tax": "73.25", "other_taxes": null, "total": "531.07" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOHIGRÓMETRO PARA INTERIOR Y EXTERIOR. PARA REGISTRO DE TEMPERATURA Y HUMEDAD. REGISTRE MÁXIMOS Y MÍNIMOS DE DICHAS VARIABLES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "457.82", "subtotal": "457.82", "tax": "73.25", "other_taxes": null, "total": "531.07" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -10 A 260", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.75", "subtotal": "184.75", "tax": "29.56", "other_taxes": null, "total": "214.31" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -20 A 250", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.75", "subtotal": "184.75", "tax": "29.56", "other_taxes": null, "total": "214.31" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -50 A 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "212", "subtotal": "212", "tax": "33.92", "other_taxes": null, "total": "245.92" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO INFRARRORO TIPO PISTOLA CON LASER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "627.23", "subtotal": "627.23", "tax": "100.36", "other_taxes": null, "total": "727.59" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO MÁXIMO MÍNIMO PARA INVERNADERO O JARDÍN, TEMPERATURAS MÁXIMAS Y MÍNIMAS, ACCESORIOS DE INVERNADERO PARA INTERIORES Y EXTERIORES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1020.42", "subtotal": "1020.42", "tax": "163.27", "other_taxes": null, "total": "1183.69" }, { "number": "0", "cucop_code": "25501-0057", "description": "TROMPA DE VACIO 6140-0010", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "446.15", "subtotal": "446.15", "tax": "71.38", "other_taxes": null, "total": "517.53" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO DE ENSAYE Nº 9820", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8.53", "subtotal": "8.53", "tax": "1.36", "other_taxes": null, "total": "9.89" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO PARA DIGESTION LABCONCO 250ML, COD. 23030 Ó 23040. CAJA CON 25", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "49683.75", "subtotal": "49683.75", "tax": "7949.4", "other_taxes": null, "total": "57633.15" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE ENSAYE DE VIDRIO DE BOROSILICATO (10X75 MM) PARA CULTIVO MICROBIOLÓGICO. AUTOCLAVABLES. SIN LABIO. QUÍMICA. CON ÁREA PARA MARCAR EN ESMALTE DE CERÁMICA BLANCA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11.08", "subtotal": "11.08", "tax": "1.77", "other_taxes": null, "total": "12.85" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE FONDO PLANO DE 20 X 120 MM. DE FABRICACIÓN NACIONAL. 10 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7", "subtotal": "7", "tax": "1.12", "other_taxes": null, "total": "8.12" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 15 ML, GRADUADOS. TIPO FALCON. BOLSA DE 500 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "233.33", "subtotal": "233.33", "tax": "37.33", "other_taxes": null, "total": "270.66" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 50 ML DE FONDO PLANO, GRADUADOS. TIPO FALCON. BOLSA DE 50 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "317.33", "subtotal": "317.33", "tax": "50.77", "other_taxes": null, "total": "368.1" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS EPPENDORF DE 1.5 ML, PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "690.67", "subtotal": "690.67", "tax": "110.51", "other_taxes": null, "total": "801.18" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS EPPENDORF DE 2 ML, PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "858.67", "subtotal": "858.67", "tax": "137.39", "other_taxes": null, "total": "996.06" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "135.72", "subtotal": "135.72", "tax": "21.72", "other_taxes": null, "total": "157.44" }, { "number": "0", "cucop_code": "25501-0133", "description": "VIALES AMBAR DE 5 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "936.95", "subtotal": "936.95", "tax": "149.91", "other_taxes": null, "total": "1086.86" }, { "number": "0", "cucop_code": "25501-0133", "description": "VIALES AMBAR DE 50 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "995.15", "subtotal": "995.15", "tax": "159.22", "other_taxes": null, "total": "1154.37" }, { "number": "0", "cucop_code": "25501-0025", "description": "Y&M-CI(YEAST & MOLD COLOR INDICATOR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7126.18", "subtotal": "7126.18", "tax": "1140.19", "other_taxes": null, "total": "8266.37" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1001 PH PROBE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5562.82", "subtotal": "5562.82", "tax": "890.05", "other_taxes": null, "total": "6452.87" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1004 AMMONIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11783.33", "subtotal": "11783.33", "tax": "1885.33", "other_taxes": null, "total": "13668.66" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1005 CHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12074.94", "subtotal": "12074.94", "tax": "1931.99", "other_taxes": null, "total": "14006.93" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1006 NITRITE PROBE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12074.94", "subtotal": "12074.94", "tax": "1931.99", "other_taxes": null, "total": "14006.93" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 2002 GALVANIC DO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6112.47", "subtotal": "6112.47", "tax": "978", "other_taxes": null, "total": "7090.47" }, { "number": "0", "cucop_code": "25501-0082", "description": "FILTRO DE VIDRIO SINTERIZADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3327.77", "subtotal": "3327.77", "tax": "532.44", "other_taxes": null, "total": "3860.21" }, { "number": "0", "cucop_code": "25501-0009", "description": "CRISOLES DE PORCELANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "47.14", "subtotal": "47.14", "tax": "7.54", "other_taxes": null, "total": "54.68" }, { "number": "0", "cucop_code": "25501-0098", "description": "PLIEGO DE PAPEL FILTRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13.71", "subtotal": "13.71", "tax": "2.19", "other_taxes": null, "total": "15.9" }, { "number": "0", "cucop_code": "25501-0035", "description": "CHAROLA PARA HORNEAR DE ALUMINIO - 13 X 18 X 1\", MEDIA CHAROLA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4744.71", "subtotal": "4744.71", "tax": "759.15", "other_taxes": null, "total": "5503.86" }, { "number": "0", "cucop_code": "25501-0035", "description": "PRENSA PARA TORTILLAS, 15.24 CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "864.96", "subtotal": "864.96", "tax": "138.39", "other_taxes": null, "total": "1003.35" }, { "number": "0", "cucop_code": "25501-0035", "description": "RODILLO DE MADERA DE 17.6 PULGADAS PARA HORNEAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "996.47", "subtotal": "996.47", "tax": "159.44", "other_taxes": null, "total": "1155.91" }, { "number": "0", "cucop_code": "25501-0035", "description": "PALA MISERABLE SILICON", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "129.31", "subtotal": "129.31", "tax": "20.69", "other_taxes": null, "total": "150" }, { "number": "0", "cucop_code": "25501-0035", "description": "BOWL, TAZÓN DE ACERO INOXIDABLE MEDIANO DE 28CM X 11.5CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "194.59", "subtotal": "194.59", "tax": "31.13", "other_taxes": null, "total": "225.72" } ] }, { "id": "C-2023-00071321", "internal_reference": "CP-VER-PD-AD-018/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "normalized_name": "QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD", "rfc_type": null, "slug": "qth-insumos-y-servicios-para-la-industria-y-salud" }, "contract_period": { "published_at": "2023-07-11T18:20:11.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "93459.71", "tax": "14953.55", "total": "108413.26", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0048", "description": "ÁCIDO FOSFOMOLIBDICO PRESENTACIÓN DE 500 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3045.75", "subtotal": "3045.75", "tax": "487.32", "other_taxes": null, "total": "3533.07" }, { "number": "0", "cucop_code": "25101-0050", "description": "ÁCIDO HEXANÓICO DE 1 KILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5467.5", "subtotal": "5467.5", "tax": "874.8", "other_taxes": null, "total": "6342.3" }, { "number": "0", "cucop_code": "25101-0051", "description": "ÁCIDO LACTICO AL 88% PRESENTACIÓN 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1303", "subtotal": "1303", "tax": "208.48", "other_taxes": null, "total": "1511.48" }, { "number": "0", "cucop_code": "25101-0052", "description": "ÁCIDO NÍTRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "637", "subtotal": "637", "tax": "101.92", "other_taxes": null, "total": "738.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA OXIGENADA 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "52.5", "subtotal": "52.5", "tax": "8.4", "other_taxes": null, "total": "60.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE POTASIO (KCL) FRASCO DE 100 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "136", "subtotal": "136", "tax": "21.76", "other_taxes": null, "total": "157.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE POTASIO R.A. 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1721", "subtotal": "1721", "tax": "275.36", "other_taxes": null, "total": "1996.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE POTASIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "269", "subtotal": "269", "tax": "43.04", "other_taxes": null, "total": "312.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO PRESENTACIÓN 500 GR POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "532", "subtotal": "532", "tax": "85.12", "other_taxes": null, "total": "617.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT CEC-CI (COLIFORM&E. COLI COLOR INDICATOR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8281", "subtotal": "8281", "tax": "1324.96", "other_taxes": null, "total": "9605.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "LINALOOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3767.4", "subtotal": "3767.4", "tax": "602.78", "other_taxes": null, "total": "4370.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA ADN. BH 50BP DNA LADDER RTU. (17 BANDS, 50-1,500BPS) CODIGO DM012-R500. 500 MICROLITROS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6934.79", "subtotal": "6934.79", "tax": "1109.57", "other_taxes": null, "total": "8044.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO PDA. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1445.89", "subtotal": "1445.89", "tax": "231.34", "other_taxes": null, "total": "1677.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO TCBS. PARA CRECIMIENTO DE VIBRIOS. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2928.33", "subtotal": "2928.33", "tax": "468.53", "other_taxes": null, "total": "3396.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUELATO DE HIERRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "350", "subtotal": "350", "tax": "56", "other_taxes": null, "total": "406" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUITOSANO EN POLVO DE ALTA DENSIDAD GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO FOLIN-CIOCALTEU FENOL REAGENT, \"N 500 ML,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3549", "subtotal": "3549", "tax": "567.84", "other_taxes": null, "total": "4116.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA AMONIO RANGO MEDIO HI93715-01 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1248", "subtotal": "1248", "tax": "199.68", "other_taxes": null, "total": "1447.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750A-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750B-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA SULFATO RANGO MEDIO HI93751-01 CAJA CON 100 PBAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1104", "subtotal": "1104", "tax": "176.64", "other_taxes": null, "total": "1280.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA NITRITOS , PAQUETE CON 100 REACTIVOS HI93708-01", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "912", "subtotal": "912", "tax": "145.92", "other_taxes": null, "total": "1057.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ROJO CONGO 25 G G PARA USO MICROBIOLÓGICO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "995.4", "subtotal": "995.4", "tax": "159.26", "other_taxes": null, "total": "1154.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "STANDAR CONDUCTIVIDAD ELECTRICA 1413 µS/CM 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "360", "subtotal": "360", "tax": "57.6", "other_taxes": null, "total": "417.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIODIGLICOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2448", "subtotal": "2448", "tax": "391.68", "other_taxes": null, "total": "2839.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "CATALIZADORES KJELDAHL PARA LA DETECCIÓN DEL NITRÓGENO PRESENTACIÓN 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7488", "subtotal": "7488", "tax": "1198.08", "other_taxes": null, "total": "8686.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICARBONATO DE SODIO PVO. 500 GRS. 3506-01", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "421", "subtotal": "421", "tax": "67.36", "other_taxes": null, "total": "488.36" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 7X2 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "130", "subtotal": "130", "tax": "20.8", "other_taxes": null, "total": "150.8" }, { "number": "0", "cucop_code": "25501-0107", "description": "CRONÓMETRO DE FACIL USO 1 S A 99 MIN, 59 S.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "550", "subtotal": "550", "tax": "88", "other_taxes": null, "total": "638" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO C.E. HI76310", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8544", "subtotal": "8544", "tax": "1367.04", "other_taxes": null, "total": "9911.04" }, { "number": "0", "cucop_code": "25501-0088", "description": "ELECTROLYTE SOLUCION HI7071", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1512", "subtotal": "1512", "tax": "241.92", "other_taxes": null, "total": "1753.92" }, { "number": "0", "cucop_code": "25501-0123", "description": "EQUIPO DE EXTRACCION SOXHLET MATRAZ 250 ML.EBULLICION, CONDENSADOR ALLIHN, JUNTA INFERIOR 24/40, SUPERIOR 45/50, ALTURA APROX. 711 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4500", "subtotal": "4500", "tax": "720", "other_taxes": null, "total": "5220" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCOS ÁMBAR DE 50 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "35", "subtotal": "35", "tax": "5.6", "other_taxes": null, "total": "40.6" }, { "number": "0", "cucop_code": "25501-0102", "description": "HEMATOCÍMETRO O CÁMARA DE NEUBAUER. PARA DETERMINAR LA CONCENTRACIÓN DE CÉLULAS EN UN MEDIO LÍQUIDO. INCLUYA DOS PORTAOBJETOS PARA EL HEMATOCITÓMETRO CON ESPESOR DE 0.4 MM. 0.100 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2347.65", "subtotal": "2347.65", "tax": "375.62", "other_taxes": null, "total": "2723.27" }, { "number": "0", "cucop_code": "25501-0102", "description": "LUXÓMETRO O EXPOSÍMETRO. MIDA MÍNIMO DE 0 A 50,000 LUXES. CUENTE CON INDICADOR DE BATERÍA BAJA Y TEMPORIZADOR PARA APAGADO AUTOMÁTICO.INCLUYA BATERÍA Y ESTUCHE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "898.5", "subtotal": "898.5", "tax": "143.76", "other_taxes": null, "total": "1042.26" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRACES ERLENMEYER DE 500 MILILITROS TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "114", "subtotal": "114", "tax": "18.24", "other_taxes": null, "total": "132.24" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220.8", "subtotal": "220.8", "tax": "35.33", "other_taxes": null, "total": "256.13" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "217.2", "subtotal": "217.2", "tax": "34.75", "other_taxes": null, "total": "251.95" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 20 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 30 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 300ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "402", "subtotal": "402", "tax": "64.32", "other_taxes": null, "total": "466.32" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 40 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 1000-10000 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3907", "subtotal": "3907", "tax": "625.12", "other_taxes": null, "total": "4532.12" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO DE PORCELANA CON PISTILO DE 65 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 50 ML (MEDIDAS 70 MM X 47 MM DE DIÁMETRO INTERNO).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 65 O 80 ML (MEDIDASAPROX. 80 MM X 53 MM DE DIÁMETRO INTERNO)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145" }, { "number": "0", "cucop_code": "25501-0094", "description": "PICNOMETRO CALIBRADO DE 50 ML. PICNÓMETROS SON FABRICADO EN VIDRIO SEGÚN LA NORMA ISO 3507. TANTO EL CUERPO COMO EL TAPÓN LLEVAN EL MISMO NÚMERO DE CÓDIGO DE IDENTIFICACIÓN. CALIBRADO JUNTO CON EL TAPÓN CON UNA PRECISIÓN DE 0,001 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "475", "subtotal": "475", "tax": "76", "other_taxes": null, "total": "551" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS DE DISECCION LARGAS DE 30CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "105", "subtotal": "105", "tax": "16.8", "other_taxes": null, "total": "121.8" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA REFRIGERANTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "275", "subtotal": "275", "tax": "44", "other_taxes": null, "total": "319" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 10 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "223.3", "subtotal": "223.3", "tax": "35.73", "other_taxes": null, "total": "259.03" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 100 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "286", "subtotal": "286", "tax": "45.76", "other_taxes": null, "total": "331.76" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 25 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "228.8", "subtotal": "228.8", "tax": "36.61", "other_taxes": null, "total": "265.41" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 50 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "266.8", "subtotal": "266.8", "tax": "42.69", "other_taxes": null, "total": "309.49" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO DE MERCURIO PARA LABORATORIO, FONDO AMARILLO. DE -20 A 110 C. DIVISIÓN DE UN GRADO. LONGITUD DE 322 MM. INMERSION TOTAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500.3", "subtotal": "500.3", "tax": "80.05", "other_taxes": null, "total": "580.35" }, { "number": "0", "cucop_code": "25501-0096", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "518.7", "subtotal": "518.7", "tax": "82.99", "other_taxes": null, "total": "601.69" }, { "number": "0", "cucop_code": "25501-0096", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "518.7", "subtotal": "518.7", "tax": "82.99", "other_taxes": null, "total": "601.69" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -100 A 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO 100 ML TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "45", "tax": "7.2", "other_taxes": null, "total": "52.2" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 100 ML 1 CAJA CON 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2600", "subtotal": "2600", "tax": "416", "other_taxes": null, "total": "3016" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 2000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "276", "subtotal": "276", "tax": "44.16", "other_taxes": null, "total": "320.16" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 50 MILILITROS TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 50 ML PAQUETE CON 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8" } ] }, { "id": "C-2023-00071327", "internal_reference": "CP-VER-PD-AD-019/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2023-07-11T18:22:06.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "114342.38", "tax": "18294.78", "total": "132637.16", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0038", "description": "ACCESS RT-PCR SYSTEM KIT DE 500 MUESTRAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70093.6902", "subtotal": "70093.69", "tax": "11214.99", "other_taxes": null, "total": "81308.68" }, { "number": "0", "cucop_code": "25101-0059", "description": "AGAR BACTERIOLÓGICO. FRASCO CON 500 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2184.2881", "subtotal": "2184.29", "tax": "349.49", "other_taxes": null, "total": "2533.77" }, { "number": "0", "cucop_code": "25101-0060", "description": "AGAR CEREBRO CORAZON FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1746.5316", "subtotal": "1746.53", "tax": "279.45", "other_taxes": null, "total": "2025.98" }, { "number": "0", "cucop_code": "25101-0061", "description": "AGAR MÉTODOS ESTANDAR FRASCO 450G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1354.6182", "subtotal": "1354.62", "tax": "216.74", "other_taxes": null, "total": "1571.36" }, { "number": "0", "cucop_code": "25101-0062", "description": "AGAR NUTRITIVO FRASCO (450GR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1587.4291", "subtotal": "1587.43", "tax": "253.99", "other_taxes": null, "total": "1841.42" }, { "number": "0", "cucop_code": "25101-0063", "description": "AGAR PAPA DEXTROSA PDA FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1117.3128", "subtotal": "1117.31", "tax": "178.77", "other_taxes": null, "total": "1296.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAROSA ULTRA PURA 100 GRAMOS. GRADO BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1719.1157", "subtotal": "1719.12", "tax": "275.06", "other_taxes": null, "total": "1994.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE CARGA PARA ELECTROFORESIS DE 1 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1063.25", "subtotal": "1063.25", "tax": "170.12", "other_taxes": null, "total": "1233.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLORANTE PARA TEÑIR ÁCIDOS NUCLEICOS GEL RED® 10 000 X 0.5 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1113.57", "subtotal": "1113.57", "tax": "178.17", "other_taxes": null, "total": "1291.74" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLORANTE PARA TEÑIR GELES DE ELECTROFORESIS (SUSTITUTO DE BROMURO DE ETIDIO) DE 500 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2312.57", "subtotal": "2312.57", "tax": "370.01", "other_taxes": null, "total": "2682.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-GLUCOSA ANHIDRA ACS (DEXTROSA) PARA MICROBIOLOGÍA (MEDIO DE CULTIVO). FRASCO DE 250 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "397.52", "subtotal": "397.52", "tax": "63.6", "other_taxes": null, "total": "461.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DNA POLIMERASA GOTAQ® FLEXI DNA. PARA AMPLIFICACIÓN DE ADN POR PCR. 500 UNIDADES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2349.46", "subtotal": "2349.46", "tax": "375.91", "other_taxes": null, "total": "2725.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA TAQ POLIMERASA. 500 UNIDADES. LA BIOLASA (ADN POLIMERASA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2349.46", "subtotal": "2349.46", "tax": "375.91", "other_taxes": null, "total": "2725.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESCALERA BAJA PCR 20 PB, PARA ELECTROPHORESIS DE FRAGMNETOS DE PCR CON 40 µG.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4102.76", "subtotal": "4102.76", "tax": "656.44", "other_taxes": null, "total": "4759.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1159.56", "subtotal": "1159.56", "tax": "185.53", "other_taxes": null, "total": "1345.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO PARA MICROBIOLOGÍA. FRASCO DE 500 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1159.56", "subtotal": "1159.56", "tax": "185.53", "other_taxes": null, "total": "1345.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA GELES DE ADN: BH 100 BP DNA LADDER RTU. DM001-R500. 500 MICROLITROS (11 BANDS, 100-1,500BPS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2944.74", "subtotal": "2944.74", "tax": "471.16", "other_taxes": null, "total": "3415.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO PDA MCD-LAB CAT. 7041", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1014.84", "subtotal": "1014.84", "tax": "162.37", "other_taxes": null, "total": "1177.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE CALCIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "259.04", "subtotal": "259.04", "tax": "41.45", "other_taxes": null, "total": "300.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "PCR CORE KIT WITH TAQ DNA POLYMERASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3944.82", "subtotal": "3944.82", "tax": "631.17", "other_taxes": null, "total": "4575.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEPTONA EXTRACTO DE CARNE FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1604.51", "subtotal": "1604.51", "tax": "256.72", "other_taxes": null, "total": "1861.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "SET DE DNTPS PARA PCR POR SEPARADO. 4 X 25 UMOL (4X250UL)/ 4 X 100 UMOL (4X1ML) / 4 X 100 UMOL (4X4X250UL) / 4 X 500 UMOL (4X5X1 ML) / 4 X 1000 UMOL (4×10 ML). EL SET CONSISTE EN CUATRO SOLUCIONES 100 MM SEPARADAS DE: DATP, DCTP, DGTP Y DTTP RESPECTIVAMENTE. ULTRAPURO: >99% TRIFOSFATO POR HPLC.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5980.79", "subtotal": "5980.79", "tax": "956.93", "other_taxes": null, "total": "6937.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPTONA (DIGERIDO PANCREÁTICO DE CASEÍNA) 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1391.47", "subtotal": "1391.47", "tax": "222.64", "other_taxes": null, "total": "1614.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPTONA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1391.47", "subtotal": "1391.47", "tax": "222.64", "other_taxes": null, "total": "1614.11" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "2 CAAS JUSTIFICACION  EN TERMINOS DEL ART 71 DEL REGLAMENTO DE LA LEY DE ADQUISICIONES_OK.pdf", "availability": "available", "size_bytes": "17099176", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:25.514Z", "updated_at": "2025-12-07T13:09:25.515Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "2 ANEXO TECNICO ADQUISICIÿN DE REACTIVOS QUIMICOS-MATERIALES Y ACCESORIOS DE LABORATORIO CVER.pdf", "availability": "available", "size_bytes": "11508293", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:33.785Z", "updated_at": "2025-12-07T13:09:33.786Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN A PROVEEDOR ALPHALAB_OK_S.pdf", "availability": "available", "size_bytes": "969659", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:35.869Z", "updated_at": "2025-12-07T13:09:35.870Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XVII. COMERCIALIZADORA ALPHALAB S DE RL DE CV.pdf", "availability": "available", "size_bytes": "3217513", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:38.423Z", "updated_at": "2025-12-07T13:09:38.424Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD.pdf", "availability": "available", "size_bytes": "936852", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:39.774Z", "updated_at": "2025-12-07T13:09:39.776Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XVIII. QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD (1).pdf", "availability": "available", "size_bytes": "3156645", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:42.249Z", "updated_at": "2025-12-07T13:09:42.250Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN UNIPARTS SA DE CV.pdf", "availability": "available", "size_bytes": "937145", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:44.023Z", "updated_at": "2025-12-07T13:09:44.024Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XIX. UNIPARTS.pdf", "availability": "available", "size_bytes": "2915175", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:49.350Z", "updated_at": "2025-12-07T13:09:49.351Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "aa-08-izc-008izc999-n-141-2023", "nombre_procedimiento": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LABORAT", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.05682194232940674 }, { "numero_procedimiento": "aa-08-izc-008izc999-n-41-2024", "nombre_procedimiento": "ADQUSICIÓN DE REACTIVOS Y MATERIALES PARA LAS ACTIVIDADES DE APOYO ACADÉMICO", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.07883149855324456 }, { "numero_procedimiento": "aa-08-izc-008izc999-n-182-2024", "nombre_procedimiento": "ADQUISICION DE PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES DE LABORATORIO 2024", "dependencia": "COLEGIO DE POSTGRADUADOS", "siglas": "COLPOS", "score": 0.0793687653917794 }, { "numero_procedimiento": "aa-08-izc-008izc999-n-28-2025", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES, ACCESORIOS, SUMINISTROS Y REACTIVOS DE LABORATORIO", "dependencia": "COLEGIO DE POSTGRADUADOS", "siglas": "COLPOS", "score": 0.0831776211751909 }, { "numero_procedimiento": "aa-08-izc-008izc999-n-107-2025", "nombre_procedimiento": "ADQ. DE REAC Y MAT DE LAB PARA LA AAA CAMPUS TABASCO 2025", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.09421038627624512 }, { "numero_procedimiento": "aa-08-izc-008izc999-n-59-2024", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES Y REACTIVOS PARA LABORATORIO CAMPUS PUEBLA", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.0959803788656105 } ] }