{ "ocid": "ocds-x-licitia-aa-08-izc-008izc999-n-95-2023", "id": "AA-08-IZC-008IZC999-N-95-2023", "date": "2023-07-11T18:18:57.000Z", "language": "es", "initiationType": "tender", "tag": [ "tender", "award", "contract" ], "parties": [ { "id": "COLPOS", "name": "COLEGIO DE POSTGRADUADOS", "roles": [ "buyer" ] }, { "id": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "name": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "roles": [ "supplier" ] }, { "id": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "name": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "roles": [ "supplier" ] }, { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV", "roles": [ "supplier" ] } ], "buyer": { "id": "COLPOS", "name": "COLEGIO DE POSTGRADUADOS" }, "tender": { "id": "AA-08-IZC-008IZC999-N-95-2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "description": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LABORATORIO PARA CAMPUS VERACRUZ DEL COLEGIO DE POSTGRADUADOS", "status": "complete", "procurementMethod": "direct", "procurementMethodDetails": "ADJUDICACIÓN DIRECTA", "mainProcurementCategory": "goods", "tenderPeriod": { "startDate": "2023-07-11T18:18:57.000Z" }, "awardPeriod": {}, "items": [ { "id": "0", "description": "1-METHYLBUTYL ACETATE, 100 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2421.76, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0039" }, "unit": { "name": "PIEZA", "value": { "amount": 162.67, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE SODIO R.A, CRISTAL 2.5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0040" }, "unit": { "name": "PIEZA", "value": { "amount": 1185.33, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA =99.5% 4 L", "classification": { "scheme": "CUCOP", "id": "25101-0041" }, "unit": { "name": "PIEZA", "value": { "amount": 1060.67, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA GARRAFA 20 L", "classification": { "scheme": "CUCOP", "id": "25101-0042" }, "unit": { "name": "PIEZA", "value": { "amount": 2970.67, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ACÉTICO AL 98 % PRESENTACIÓN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0043" }, "unit": { "name": "PIEZA", "value": { "amount": 339.33, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ACÉTICO GLACIAL PRESENTACIÓN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0044" }, "unit": { "name": "PIEZA", "value": { "amount": 339.33, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ANHIDRIDO ACÉTICO", "classification": { "scheme": "CUCOP", "id": "25101-0046" }, "unit": { "name": "PIEZA", "value": { "amount": 191.33, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO CLORHIDRICO GRADO ANALITICO 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0046" }, "unit": { "name": "PIEZA", "value": { "amount": 236, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO CLORHIDRICO GRADO REACTIVO DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 781.33, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO FOSFOWOLFRÁMICO", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "unit": { "name": "PIEZA", "value": { "amount": 3781.76, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 306.67, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO SULFURICO GRADO ANALITICO 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0054" }, "unit": { "name": "PIEZA", "value": { "amount": 306.67, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO SULFURICO GRADO REACTIVO 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0055" }, "unit": { "name": "PIEZA", "value": { "amount": 306.67, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO SULFURICO GRADO REACTIVO DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0056" }, "unit": { "name": "PIEZA", "value": { "amount": 1016.67, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO VALÉRICO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0057" }, "unit": { "name": "PIEZA", "value": { "amount": 2206.47, "currency": "MXN" } } }, { "id": "0", "description": "AGAR BACTERIOLOGICO FRASCO DE 250 GRS", "classification": { "scheme": "CUCOP", "id": "25101-0058" }, "unit": { "name": "PIEZA", "value": { "amount": 1905.77, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESTILADA 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 257.69, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESTILADA BOTELLAS DE 1 LITRO CADA UNO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 68, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESTILADA GALÓN DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 99.33, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESTILADA GARRAFÓN DE 19 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 346.4, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL AMÍLICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 354.67, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ETILICO AL 96% CON 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 916.01, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ISOAMILICO GRADO ACS DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3570, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ISOPROPILICO GRADO ACS DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1058.67, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL METILICO GRADO ACS DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 758, "currency": "MXN" } } }, { "id": "0", "description": "ALGINATO DE SODIO EN POLVO GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 686.21, "currency": "MXN" } } }, { "id": "0", "description": "ANHIDRIDO ACÉTICO AL 99% DE PUREZA PRESENTACIÓN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3833.53, "currency": "MXN" } } }, { "id": "0", "description": "BACTOZOLTM. KIT PARA AISLACIÓN DE ADN BACTERIANO.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 5266, "currency": "MXN" } } }, { "id": "0", "description": "BPW AGUA PEPTONADA TAMPONADA 500 GRS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1635.33, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER PH 10 DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER PH 4 DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER PH 7 DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "CARBON ACTIVADO 100G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 96.67, "currency": "MXN" } } }, { "id": "0", "description": "CARBORUMDUM -CARBURO DE SILICONA CALIBRE FINO FRASCO DE 250 GR (SILICON CARBIDE -400 MESH PARTICLE SIZE, =97.5% SINÓNIMOS: CARBON SILICIDE, CARBORUNDUM, METHANIDYLIDYNESILANYLIUM, SILICON MONOCARBIDE 250 G)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1461.76, "currency": "MXN" } } }, { "id": "0", "description": "CGINT GGCCTCCCGCCTCCGGGCGG 25 NM ESTÁNDAR DESALADO 20", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 184.27, "currency": "MXN" } } }, { "id": "0", "description": "CGINT: GGCCTCCCGCCTCCGGGCGG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 191.33, "currency": "MXN" } } }, { "id": "0", "description": "CLOROFORMO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 383.33, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE CALCIO ANHÍDRO ACS DE 500 GRS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 992, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE HIERRO (III) PRESENTACIÓN DE 500 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1255.33, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO MERCÚRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 485.33, "currency": "MXN" } } }, { "id": "0", "description": "DIHIDRÓGENO FOSFATO DE POTASIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2284.12, "currency": "MXN" } } }, { "id": "0", "description": "ESTER DEL ÁCIDO 2-AMINOETILDIFENIL BÓRICO (AEDBE) PRESENTACIÓN 5 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2544.12, "currency": "MXN" } } }, { "id": "0", "description": "ETHYL 4-[BENZYL(METHYL)AMINO]BUTANOATE PH017049-1G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 4292.35, "currency": "MXN" } } }, { "id": "0", "description": "EXTRACTO DE TÉ VERDE ESTANDARIZADO EN CAPSULAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1151.15, "currency": "MXN" } } }, { "id": "0", "description": "FENOLFTALEÍNA 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 41.2, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE CALCIO CA3(PO4)2 (FOSFATO TRICÁLCICO). FRASCO DE 250 G.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 264, "currency": "MXN" } } }, { "id": "0", "description": "GLICEROL PURO GRADO REACTIVO PRESENTACIÓN 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 352.67, "currency": "MXN" } } }, { "id": "0", "description": "HEXANO GA LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 420.67, "currency": "MXN" } } }, { "id": "0", "description": "HEXYL ACETATE, 25 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1241.76, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 364.67, "currency": "MXN" } } }, { "id": "0", "description": "HIDROXIDO DE SODIO GRADO REACTIVO 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 132, "currency": "MXN" } } }, { "id": "0", "description": "ISODINE FRASCO (500 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 203.13, "currency": "MXN" } } }, { "id": "0", "description": "ITS 1: TCCGTAGGTGAACCTGCGG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 184.27, "currency": "MXN" } } }, { "id": "0", "description": "ITS 4: TCCTCCGCTTATTGATATGC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 191.33, "currency": "MXN" } } }, { "id": "0", "description": "ITS1 TCCGTAGGTGAACCTGCGG 25 NM ESTÁNDAR DESALADO 19", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 184.27, "currency": "MXN" } } }, { "id": "0", "description": "ITS4 TCCTCCGCTTATTGATATGC 25 NM ESTÁNDAR DESALADO 20", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 191.33, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE LIMPIEZA DE GEL Y PCR QIAQUICK (100). PARA PURIFICACIÓN DE FRAGMENTOS DE PCR Y EXTRACCIONES EN GEL DE 100 REACCIONES (AL MENOS 80-100 REACCIONES EN GEL O 100 PCR).", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 8411.25, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO BASAL DE MURASHIGE Y SKOOG 50 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2610.9, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO B-KING PARA CULTIVO DE BACTERIAS 500 GRS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3375, "currency": "MXN" } } }, { "id": "0", "description": "METANOL AL 99% DE PUREZA PRESENTACIÓN 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1885, "currency": "MXN" } } }, { "id": "0", "description": "MOLIBDATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 373.33, "currency": "MXN" } } }, { "id": "0", "description": "N-BUTANOL PRESENTACIÓN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1594.71, "currency": "MXN" } } }, { "id": "0", "description": "NINHIDRINA PRESENTACIÓN DE 10 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 391.33, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO BÁSICO DE BISMUTO (III) PRESENTACIÓN DE 100 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 694, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE AMONIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2420, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE BISMUTO PENTAHIDRATADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 694, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE POTASIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 165.67, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE POTASIO (KNO3). FRASCO DE 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 158.87, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE POTASIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2264, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE POTASIO PRESENTACIÓN EN FRASCO DE 1 KG EN POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 174.67, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDO DE HIDROGENO 30% GRADO REACTIVO 4 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1107.33, "currency": "MXN" } } }, { "id": "0", "description": "PÉROXIDO DE HIDRÓGENO AL 30% RA, PRESENTACIÓN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 279.33, "currency": "MXN" } } }, { "id": "0", "description": "PHYTAGEL FRASCO (250G)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3301.76, "currency": "MXN" } } }, { "id": "0", "description": "POLY(VINYLPOLYPYRROLIDONE) 100 GRS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2887.65, "currency": "MXN" } } }, { "id": "0", "description": "PÚRPURA DE BROMOCRESOL FRASCO DE 250 G PARA USO MICROBIOLÓGICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 6057.06, "currency": "MXN" } } }, { "id": "0", "description": "QUICK-RNA MICROPREP ZYMO RESEARCH KIT DE 200 MUESTRAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 24250, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706A-0 CAJA CON 100 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 706, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706B-0 CAJA CON 100 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 706, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706A-0", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 706, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706B-0", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 706, "currency": "MXN" } } }, { "id": "0", "description": "RVS 12.75G RAPPAPORT-VASSILIADIS-SOYA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 65284.66, "currency": "MXN" } } }, { "id": "0", "description": "SACAROSA FRASCO DE 450G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 655.55, "currency": "MXN" } } }, { "id": "0", "description": "SILICON STANDARD PARA AAS TRACECERT 1000 MG/L SI IN NAOH", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1351.18, "currency": "MXN" } } }, { "id": "0", "description": "SODIO HEXAMETAFOSFATO 65-70% DE 5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 7253.53, "currency": "MXN" } } }, { "id": "0", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 579.33, "currency": "MXN" } } }, { "id": "0", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 579.33, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DE BUFFER PH CONTROL PH 10 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 57.67, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DE BUFFER PH CONTROL PH 4. 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 57.67, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DE BUFFER PH CONTROL PH 7 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 57.67, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO CÚPRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 314, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE CALCIO (CASO4). FCO DE 250 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 400.67, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE COBRE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 314, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE MAGNESIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 162, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE MANGANESO ANHIDRO MNSO4 FCO DE 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 162, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE POTASIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 210.67, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE ZINC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 176, "currency": "MXN" } } }, { "id": "0", "description": "TARTRATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 352, "currency": "MXN" } } }, { "id": "0", "description": "TRICLORURO FÉRRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 310, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 452, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 452, "currency": "MXN" } } }, { "id": "0", "description": "WP200I GAMMA IRRAD COLILERT 100ML 200PK(AMPOLLETAS PARA DETECCIÓN DE COLIFORMES Y E. COLI) PARA 100 ML. AYAG981297300. 12352200.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 31679.73, "currency": "MXN" } } }, { "id": "0", "description": "WPSE020I GAMMA IR PSEUDALERT 100ML 20PK. AYAG981807600. 12352200", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 4335.86, "currency": "MXN" } } }, { "id": "0", "description": "YODURO DE POTASIO PRESENTACIÓN DE 100 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 627.33, "currency": "MXN" } } }, { "id": "0", "description": "ZYMOBIOMICS DNA MICROPREP KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2187.5, "currency": "MXN" } } }, { "id": "0", "description": "ZYMOBIOMICS DNA MINIPREP KIT (LYSIS TUBES) 50 PREPS. D4300", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 11125, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO CLORHÍDTICO VALORADO 0.1 N PRESENTACIÓN 2 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 92.86, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODFIO LENTEJAS J.T. BAKER PRESENTACIÓN 5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1582.14, "currency": "MXN" } } }, { "id": "0", "description": "ACETONITRILO PRESENTACIÓN 2 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 550, "currency": "MXN" } } }, { "id": "0", "description": "METANOL PRESENTACIÓN 2 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 585.71, "currency": "MXN" } } }, { "id": "0", "description": "CITRATO DE TRISÓDICO DIHIDRATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 296.43, "currency": "MXN" } } }, { "id": "0", "description": "L-AMINOÁCIDOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 7913.33, "currency": "MXN" } } }, { "id": "0", "description": "ESTÁNDAR DE AMINOÁCIDO PRESENTACIÓN 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2782.67, "currency": "MXN" } } }, { "id": "0", "description": "NORLEUCINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2464, "currency": "MXN" } } }, { "id": "0", "description": "NORVALINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2724, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 4L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1162.86, "currency": "MXN" } } }, { "id": "0", "description": "HEXANO GRADO REACTIVO PRESENTACIÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3017.86, "currency": "MXN" } } }, { "id": "0", "description": "SOL. ESTANDAR DE FOSOFORO 100 ML. 170340-0100", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3101.33, "currency": "MXN" } } }, { "id": "0", "description": "ESTANDAR DE CALCIO 100 ML. 119778-0100", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 969.33, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO GIBERELICO -BIOGIB 10GR.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 315.54, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO FOSFORICO RA. 2.5 LTS. 0260-05", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2376.34, "currency": "MXN" } } }, { "id": "0", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 1000 ML. MEMBRANA 47 MM", "classification": { "scheme": "CUCOP", "id": "25501-0002" }, "unit": { "name": "PIEZA", "value": { "amount": 8076.87, "currency": "MXN" } } }, { "id": "0", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 500 ML. MEMBRANA 47 MM", "classification": { "scheme": "CUCOP", "id": "25501-0002" }, "unit": { "name": "PIEZA", "value": { "amount": 11973.69, "currency": "MXN" } } }, { "id": "0", "description": "BANDEJAS PARA CUANTIFICACIÓN DE BACTERIAS UTILIZANDO LOS KITS RÁPIDOS DE IDEXX CON 97 POCILLOS PAQUETE DE 100 PIEZAS NO. DE PARTE 98-21675-00 (100-PACK STERILE 97-WELL QUANTI TRAY/200(PAQUETE DE 100 CHAROLAS QUANTI-TRAY/200 CADA UNA DE 97 POZOS) AYAG982167500 ( 41122800))", "classification": { "scheme": "CUCOP", "id": "25501-0065" }, "unit": { "name": "PIEZA", "value": { "amount": 7083.03, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 15.9X8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 82.74, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 22.2X8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 95.08, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 38.1X8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 100.78, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 50.8X 8MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 149.33, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 10X3 MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 82.56, "currency": "MXN" } } }, { "id": "0", "description": "BIORREACTORES BIT CON ESPONJA DE 1 LT QUE CONTIENE CADA UNO LO SIGUIENTE: 2 FRASCO DE VIDRIO 1.0 LT. 2 TAPA DE PLASTICO ESTERILIZABLE C/2 PERFORACIONES 2 EMPAQUE PLANO DE SILICON DE 70X7X1MM LUZ. 55 MM 4 CONECTOR PASAMURO ESTERILIZABLE DE PLASTICO 8 MM. 8 EMPAQUE PLANO D/SILICON DE 16X5X2MM LUZ 8 MM 2 FILTRO HIDROFOBICO ESTERILIZABLE 50 MM D/DIAMY 0.2 UM 2 ABRAZADERA DE MUELLE PARA MANGUERA 8.9 - 9.3 MM 4 ABRAZADERA DE ALAMBRE PARA MANGUERA 9.4 -10.4 MM 0.7 MANGUERA ESTERILIZABLE DE SILICÓN PLATINIZADA 6 MM. DIAM. INT. 1 TUBO DE ACERO INOX DE 8 MM D/DIAM. DE 13 CM. C/ARANDELA 1", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 3518.65, "currency": "MXN" } } }, { "id": "0", "description": "BLOQUE PARA BAÑO SECO ANALOGO PARA 20 TUBOS DE 13MM , 2.0 ML ( 9 CM X 7.5 CM X 4 CM ALTO. APROX.)", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 4098.72, "currency": "MXN" } } }, { "id": "0", "description": "BOTELLAS PLÁSTICAS CON MARCA DE LÍNEA A UN VOLUMEN DE 100 ML PAQUETE CON 200 PIEZAS (200-PACK 120ML VESSEL WITH 100ML) AYAG980615900 (41115822)", "classification": { "scheme": "CUCOP", "id": "25501-0132" }, "unit": { "name": "PIEZA", "value": { "amount": 5445.32, "currency": "MXN" } } }, { "id": "0", "description": "BULBO DE HULE 2 ML DE CAPACIDAD 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0130" }, "unit": { "name": "PIEZA", "value": { "amount": 140, "currency": "MXN" } } }, { "id": "0", "description": "BURETA 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0122" }, "unit": { "name": "PIEZA", "value": { "amount": 652.4, "currency": "MXN" } } }, { "id": "0", "description": "BURETA 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0122" }, "unit": { "name": "PIEZA", "value": { "amount": 3924.62, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE PETRI VIDRIO, 6 CM DIAMETRO", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "unit": { "name": "PIEZA", "value": { "amount": 36.4, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PARA 100 PORTAOBJETOS COLOR NEGRA CON CORCHO- MEDIDAS 208X175X34 MM", "classification": { "scheme": "CUCOP", "id": "25501-0101" }, "unit": { "name": "PIEZA", "value": { "amount": 201.68, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PETRI DE PLASTICO ESTERIL 90 X 15 MM DESECHABLES INDIVIDUALES", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "unit": { "name": "PIEZA", "value": { "amount": 33.13, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE PETRI DE POLIESTIRENO DESECHABLES DE 90 X 15 MM, CON 4 DIVISIONES. ESTÉRILES. CAJA DE 540 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "unit": { "name": "PIEZA", "value": { "amount": 1639.2, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE PETRI DE POLIESTIRENODESECHABLES DE 90 X 15 MM. SIN DIVISION. ESTÉRILES. CAJA DE 540 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "unit": { "name": "PIEZA", "value": { "amount": 1639.2, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE PETRI PLÁSTICAS ESTÉRILES 90 X 15 CM.PAQUETE DE 500 PZAS. PARA CRECIMIENTO MICROBIANO", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "unit": { "name": "PIEZA", "value": { "amount": 1526.67, "currency": "MXN" } } }, { "id": "0", "description": "COLILERT/COLILERT-18 COMPARATOR. PREDISPE. AYAG980922700.", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 595.93, "currency": "MXN" } } }, { "id": "0", "description": "CONÓMETRO CON 4 CANALES Y ALARMA.", "classification": { "scheme": "CUCOP", "id": "25501-0107" }, "unit": { "name": "PIEZA", "value": { "amount": 1288.42, "currency": "MXN" } } }, { "id": "0", "description": "CRISOL DE PORCELANA FORMA ALTA CON TAPA 100 ML COORSTEK", "classification": { "scheme": "CUCOP", "id": "25501-0009" }, "unit": { "name": "PIEZA", "value": { "amount": 282.86, "currency": "MXN" } } }, { "id": "0", "description": "CUBETA DE CUARZO UV-VIS 10 MM, 3.5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0011" }, "unit": { "name": "PIEZA", "value": { "amount": 2398.21, "currency": "MXN" } } }, { "id": "0", "description": "CUBETA DE CUARZO UV-VIS 5 MM 1.7 ML", "classification": { "scheme": "CUCOP", "id": "25501-0011" }, "unit": { "name": "PIEZA", "value": { "amount": 3290.59, "currency": "MXN" } } }, { "id": "0", "description": "CUBETAS DE VIDRIO PARA H1832XX SERIE. CAJA CON 4 PZA.", "classification": { "scheme": "CUCOP", "id": "25501-0011" }, "unit": { "name": "PIEZA", "value": { "amount": 596, "currency": "MXN" } } }, { "id": "0", "description": "DATA LOGGER (REGISTRADOR DE DATOS) DE TEMPERATURA/HUMEDAD RELATIVA U23-001", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 4629, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO PH HI1110", "classification": { "scheme": "CUCOP", "id": "25501-0087" }, "unit": { "name": "PIEZA", "value": { "amount": 4244, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO PH HI1131", "classification": { "scheme": "CUCOP", "id": "25501-0087" }, "unit": { "name": "PIEZA", "value": { "amount": 3980, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO DE VIDRIO TALLO CORTO ANGULO 58*", "classification": { "scheme": "CUCOP", "id": "25501-0016" }, "unit": { "name": "PIEZA", "value": { "amount": 238.4, "currency": "MXN" } } }, { "id": "0", "description": "EQUIPO DE ULTRASONIDO PORTATIL. PUEDE SER MINDRAY DP10H CON 1 TRANSDUCTOR LINEAL.", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 70831.9, "currency": "MXN" } } }, { "id": "0", "description": "ESPATULA TIPO HEYMAN UN EXTREMO PLANO Y OTRO ACANALADO LONGITUD 150 MM", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 106.44, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO PARA DILUCIÓN DE LECHE BOCA ANCHA DE VIDRIO DE BOROSILICATO, CON AFORO A 99 ML, INCLUYA TAPA FENÓLICA ROSCADA Y SELLO DE HULE ESTERILIZABLE EN AUTOCLAVE. CAPACIDAD DE 160 ML", "classification": { "scheme": "CUCOP", "id": "25501-0077" }, "unit": { "name": "PIEZA", "value": { "amount": 179.11, "currency": "MXN" } } }, { "id": "0", "description": "FRASCOS SELLADOS HERMÉTICAMENTE CON ARILLO DE GOMA DE 800 ML-1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0077" }, "unit": { "name": "PIEZA", "value": { "amount": 144.01, "currency": "MXN" } } }, { "id": "0", "description": "FUENTE DE PODER PARA CAMARA DE ELECTROFORESIS", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 31724, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA ENFRIADORA PARA 32 TUBOS TRUE NORTH MINI-COOLER, 32 POCILLOS)", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 5148.21, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA ENFRIADORA PARA 96 TUBOS DE 0.2 ML 120729 PCR COOLER, 96 POCILLOS)", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 1999.4, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA CONGELACIÓN . PARA LA PROTECCIÓON DE ENZIMAS, CÉLULAS, REACTIVOS Y SOLUCIONES QUE DEBEN MANTENERSE A BAJA TEMPERATURA (-20 C) MIENTRAS SE UTILIZAN EN LABORATOIRO. CAPACIDAD DE 18 VIALES DE 0.2 A 2.0 ML. DE POLICARBONATO CON TAPA DE ROSCA DE POLIETILENO. MEDIDAS APROXIMADAS DE 117 DE DIÁMETRO X 86 MM DE ALTURA, O BIEN DE 243 MM LARGO X 157 MM DE ANCHO X 146 MM DE ALTO. CIRCULAR O RECTANGULAR.", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 6652.91, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBOS 4 WAY RACK X PIEZA. PARA TUBOS DE 50, 15, 1.5/2.0 Y 0.5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 859.65, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBOS CONICOS TUBOS DE 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 130.67, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBOS ROTABLE. CUENTE CON 4 MÓDULOS GIRATORIOS INTERCONECTADOS CON CAPACIDAD PARA DIFERENTES TUBOS CÓNICOS DE 15- 50 ML Y 1.5 ML. ESTERIZABLE EN AUTOCLAVE. CADA MÓDULO DE DIFEREENTE COLOR: VIOLETA, AMARILLO, AZUL Y VERDE.", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 918.66, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA ROTATORIA CAPACIDAD 10 A 17 MM", "classification": { "scheme": "CUCOP", "id": "25501-0126" }, "unit": { "name": "PIEZA", "value": { "amount": 918.66, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE MICROPIPETAS FINNPIPETTE FINNP70700 CON 4 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0077" }, "unit": { "name": "PIEZA", "value": { "amount": 27766.25, "currency": "MXN" } } }, { "id": "0", "description": "KIT SINGLE PATH SAMONELLA", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 5374.71, "currency": "MXN" } } }, { "id": "0", "description": "MASCARA PARA GASES (GRANDE)", "classification": { "scheme": "CUCOP", "id": "25501-0079" }, "unit": { "name": "PIEZA", "value": { "amount": 474.36, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 171.67, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 1000ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 555.03, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 100ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 282.35, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 2000ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 1354.63, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ESMERILADO SOXHLET 250 ML, 24/40", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 492.25, "currency": "MXN" } } }, { "id": "0", "description": "MEDIDOR DE CALIDAD DE AGUA PH", "classification": { "scheme": "CUCOP", "id": "25501-0087" }, "unit": { "name": "PIEZA", "value": { "amount": 804.6, "currency": "MXN" } } }, { "id": "0", "description": "MEDIDOR DE PH, TEMPERATURA, ACIDEZ Y ALCALINIDAD PARA SUELO.", "classification": { "scheme": "CUCOP", "id": "25501-0087" }, "unit": { "name": "PIEZA", "value": { "amount": 469.08, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS COLOR AMBAR DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 500 A 1000 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 4426.23, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS TRANSPARENTE DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 1,000 PZAS. PARA EXTRACCIÓN DE ADN. BIOLOGÍA MOLECULAR.", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 662.35, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 0.1-2.5 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 1399.2, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 100-1000 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 1399.2, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 20-200 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 1399.2, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 5-10 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 1399.2, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 10-100 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 1399.2, "currency": "MXN" } } }, { "id": "0", "description": "MORTERO DE PORCELANA CON PISTILO DE 125 ML", "classification": { "scheme": "CUCOP", "id": "25501-0027" }, "unit": { "name": "PIEZA", "value": { "amount": 145.71, "currency": "MXN" } } }, { "id": "0", "description": "OWL A3-1 LARGE-GEL ELECTROPHORESISSYSTEMWELL-SUITED FOR PLANT GENOMICS STUDIES", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "unit": { "name": "PIEZA", "value": { "amount": 38465, "currency": "MXN" } } }, { "id": "0", "description": "PALL FILTROS ESTÉRILES ACRODISC™ PARA JERINGAS CON MEMBRANA SUPOR™ CON MEMBRANAS DE POLIESTERSULFONA (PES). PALL. CAT. 4611 (0,1 µM 25 MM). CAJA DE 50 PZAS.", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "unit": { "name": "PIEZA", "value": { "amount": 8774.36, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO NO. 42 WHATMAN,DIÁMETRO 110MM, PAQUETE CON 100", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "unit": { "name": "PIEZA", "value": { "amount": 1349.55, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO WHATMAN NO. 1, DIAMETRO 110 MM CAJA CON 100", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "unit": { "name": "PIEZA", "value": { "amount": 436.55, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PARAFILM 100 MM X 75 M \"M\"SEALING", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "unit": { "name": "PIEZA", "value": { "amount": 1284.41, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS 2 DEDOS CON NUEZ GIRATORIA, 12-45 MM", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 149, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS PARA PAPEL DE ACERO INOXIDABLE CON PUNTA CURVA.", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 307.12, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS PARA VASO CUBIERTA DE VINILO", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 98, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS SENCILLA PARA BURETARECUBIERTA DE VINILO", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 149, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS TIPO RELOJERO LARGAS", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 274.71, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO DE 1100 MILILITROS PARA DETERMINAR TEXTURA DEL SUELO", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 1795.35, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS GRADUADAS DE VIDRIO DE 500 MILILITROS (ML)", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 586.29, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AMARILLAS DE 20 A 200 µL,PAQUETE CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "unit": { "name": "PIEZA", "value": { "amount": 228.67, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA AMARILLAS (20 A 200 UL) EN RACK ESTÉRILES DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS LA CAJA.", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "unit": { "name": "PIEZA", "value": { "amount": 1026.67, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA AZULES (1000 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS TOTALES.", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "unit": { "name": "PIEZA", "value": { "amount": 1820, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA BLACAS (0.5-10 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS EN TOTAL.", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "unit": { "name": "PIEZA", "value": { "amount": 980, "currency": "MXN" } } }, { "id": "0", "description": "SOPORTE UNIVERSAL CON VARILLA DE 60 CM", "classification": { "scheme": "CUCOP", "id": "25501-0043" }, "unit": { "name": "PIEZA", "value": { "amount": 195, "currency": "MXN" } } }, { "id": "0", "description": "TAPA P/ TUBO DE ENSAYE DEL Nº 9820", "classification": { "scheme": "CUCOP", "id": "25501-0057" }, "unit": { "name": "PIEZA", "value": { "amount": 4.06, "currency": "MXN" } } }, { "id": "0", "description": "TERMOHIGRÓMETRO DIGITAL PARA INTERIOR Y EXTERIOR CON REGISTRO DE TEMPERATURA", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 457.82, "currency": "MXN" } } }, { "id": "0", "description": "TERMOHIGRÓMETRO PARA INTERIOR Y EXTERIOR. PARA REGISTRO DE TEMPERATURA Y HUMEDAD. REGISTRE MÁXIMOS Y MÍNIMOS DE DICHAS VARIABLES.", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 457.82, "currency": "MXN" } } }, { "id": "0", "description": "TERMOMETRO DE VIDRIO DE -10 A 260", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 184.75, "currency": "MXN" } } }, { "id": "0", "description": "TERMOMETRO DE VIDRIO DE -20 A 250", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 184.75, "currency": "MXN" } } }, { "id": "0", "description": "TERMOMETRO DE VIDRIO DE -50 A 50", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 212, "currency": "MXN" } } }, { "id": "0", "description": "TERMÓMETRO INFRARRORO TIPO PISTOLA CON LASER", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 627.23, "currency": "MXN" } } }, { "id": "0", "description": "TERMÓMETRO MÁXIMO MÍNIMO PARA INVERNADERO O JARDÍN, TEMPERATURAS MÁXIMAS Y MÍNIMAS, ACCESORIOS DE INVERNADERO PARA INTERIORES Y EXTERIORES", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 1020.42, "currency": "MXN" } } }, { "id": "0", "description": "TROMPA DE VACIO 6140-0010", "classification": { "scheme": "CUCOP", "id": "25501-0057" }, "unit": { "name": "PIEZA", "value": { "amount": 446.15, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYE Nº 9820", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 8.53, "currency": "MXN" } } }, { "id": "0", "description": "TUBO PARA DIGESTION LABCONCO 250ML, COD. 23030 Ó 23040. CAJA CON 25", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 49683.75, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE ENSAYE DE VIDRIO DE BOROSILICATO (10X75 MM) PARA CULTIVO MICROBIOLÓGICO. AUTOCLAVABLES. SIN LABIO. QUÍMICA. CON ÁREA PARA MARCAR EN ESMALTE DE CERÁMICA BLANCA.", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 11.08, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE FONDO PLANO DE 20 X 120 MM. DE FABRICACIÓN NACIONAL. 10 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 7, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 15 ML, GRADUADOS. TIPO FALCON. BOLSA DE 500 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 233.33, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 50 ML DE FONDO PLANO, GRADUADOS. TIPO FALCON. BOLSA DE 50 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 317.33, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS EPPENDORF DE 1.5 ML, PAQUETE CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 690.67, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS EPPENDORF DE 2 ML, PAQUETE CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "unit": { "name": "PIEZA", "value": { "amount": 858.67, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 135.72, "currency": "MXN" } } }, { "id": "0", "description": "VIALES AMBAR DE 5 ML CON TAPA", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "unit": { "name": "PIEZA", "value": { "amount": 936.95, "currency": "MXN" } } }, { "id": "0", "description": "VIALES AMBAR DE 50 ML CON TAPA", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "unit": { "name": "PIEZA", "value": { "amount": 995.15, "currency": "MXN" } } }, { "id": "0", "description": "Y&M-CI(YEAST & MOLD COLOR INDICATOR)", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 7126.18, "currency": "MXN" } } }, { "id": "0", "description": "YSI 1001 PH PROBE KIT", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 5562.82, "currency": "MXN" } } }, { "id": "0", "description": "YSI 1004 AMMONIUM", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 11783.33, "currency": "MXN" } } }, { "id": "0", "description": "YSI 1005 CHLORIDE", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 12074.94, "currency": "MXN" } } }, { "id": "0", "description": "YSI 1006 NITRITE PROBE KIT", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 12074.94, "currency": "MXN" } } }, { "id": "0", "description": "YSI 2002 GALVANIC DO", "classification": { "scheme": "CUCOP", "id": "25501-0025" }, "unit": { "name": "PIEZA", "value": { "amount": 6112.47, "currency": "MXN" } } }, { "id": "0", "description": "FILTRO DE VIDRIO SINTERIZADO", "classification": { "scheme": "CUCOP", "id": "25501-0082" }, "unit": { "name": "PIEZA", "value": { "amount": 3327.77, "currency": "MXN" } } }, { "id": "0", "description": "CRISOLES DE PORCELANA", "classification": { "scheme": "CUCOP", "id": "25501-0009" }, "unit": { "name": "PIEZA", "value": { "amount": 47.14, "currency": "MXN" } } }, { "id": "0", "description": "PLIEGO DE PAPEL FILTRO", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "unit": { "name": "PIEZA", "value": { "amount": 13.71, "currency": "MXN" } } }, { "id": "0", "description": "CHAROLA PARA HORNEAR DE ALUMINIO - 13 X 18 X 1\", MEDIA CHAROLA", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "unit": { "name": "PIEZA", "value": { "amount": 4744.71, "currency": "MXN" } } }, { "id": "0", "description": "PRENSA PARA TORTILLAS, 15.24 CM", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "unit": { "name": "PIEZA", "value": { "amount": 864.96, "currency": "MXN" } } }, { "id": "0", "description": "RODILLO DE MADERA DE 17.6 PULGADAS PARA HORNEAR", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "unit": { "name": "PIEZA", "value": { "amount": 996.47, "currency": "MXN" } } }, { "id": "0", "description": "PALA MISERABLE SILICON", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "unit": { "name": "PIEZA", "value": { "amount": 129.31, "currency": "MXN" } } }, { "id": "0", "description": "BOWL, TAZÓN DE ACERO INOXIDABLE MEDIANO DE 28CM X 11.5CM", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "unit": { "name": "PIEZA", "value": { "amount": 194.59, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO FOSFOMOLIBDICO PRESENTACIÓN DE 500 GR", "classification": { "scheme": "CUCOP", "id": "25101-0048" }, "unit": { "name": "PIEZA", "value": { "amount": 3045.75, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO HEXANÓICO DE 1 KILO", "classification": { "scheme": "CUCOP", "id": "25101-0050" }, "unit": { "name": "PIEZA", "value": { "amount": 5467.5, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO LACTICO AL 88% PRESENTACIÓN 1 KG", "classification": { "scheme": "CUCOP", "id": "25101-0051" }, "unit": { "name": "PIEZA", "value": { "amount": 1303, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NÍTRICO", "classification": { "scheme": "CUCOP", "id": "25101-0052" }, "unit": { "name": "PIEZA", "value": { "amount": 637, "currency": "MXN" } } }, { "id": "0", "description": "AGUA OXIGENADA 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 52.5, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE POTASIO (KCL) FRASCO DE 100 G.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 136, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE POTASIO R.A. 2.5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1721, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE POTASIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 269, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODIO PRESENTACIÓN 500 GR POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 532, "currency": "MXN" } } }, { "id": "0", "description": "KIT CEC-CI (COLIFORM&E. COLI COLOR INDICATOR)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 8281, "currency": "MXN" } } }, { "id": "0", "description": "LINALOOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3767.4, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA ADN. BH 50BP DNA LADDER RTU. (17 BANDS, 50-1,500BPS) CODIGO DM012-R500. 500 MICROLITROS.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 6934.79, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO PDA. FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1445.89, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO TCBS. PARA CRECIMIENTO DE VIBRIOS. FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2928.33, "currency": "MXN" } } }, { "id": "0", "description": "QUELATO DE HIERRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "QUITOSANO EN POLVO DE ALTA DENSIDAD GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO FOLIN-CIOCALTEU FENOL REAGENT, \"N 500 ML,", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3549, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA AMONIO RANGO MEDIO HI93715-01 CAJA CON 100 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1248, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750A-0 CAJA CON 100 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750B-0 CAJA CON 100 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA SULFATO RANGO MEDIO HI93751-01 CAJA CON 100 PBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1104, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVOS PARA NITRITOS , PAQUETE CON 100 REACTIVOS HI93708-01", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 912, "currency": "MXN" } } }, { "id": "0", "description": "ROJO CONGO 25 G G PARA USO MICROBIOLÓGICO.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 995.4, "currency": "MXN" } } }, { "id": "0", "description": "STANDAR CONDUCTIVIDAD ELECTRICA 1413 µS/CM 500ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 360, "currency": "MXN" } } }, { "id": "0", "description": "TIODIGLICOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2448, "currency": "MXN" } } }, { "id": "0", "description": "CATALIZADORES KJELDAHL PARA LA DETECCIÓN DEL NITRÓGENO PRESENTACIÓN 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 7488, "currency": "MXN" } } }, { "id": "0", "description": "BICARBONATO DE SODIO PVO. 500 GRS. 3506-01", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 421, "currency": "MXN" } } }, { "id": "0", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 7X2 MM", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "unit": { "name": "PIEZA", "value": { "amount": 130, "currency": "MXN" } } }, { "id": "0", "description": "CRONÓMETRO DE FACIL USO 1 S A 99 MIN, 59 S.", "classification": { "scheme": "CUCOP", "id": "25501-0107" }, "unit": { "name": "PIEZA", "value": { "amount": 550, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO C.E. HI76310", "classification": { "scheme": "CUCOP", "id": "25501-0087" }, "unit": { "name": "PIEZA", "value": { "amount": 8544, "currency": "MXN" } } }, { "id": "0", "description": "ELECTROLYTE SOLUCION HI7071", "classification": { "scheme": "CUCOP", "id": "25501-0088" }, "unit": { "name": "PIEZA", "value": { "amount": 1512, "currency": "MXN" } } }, { "id": "0", "description": "EQUIPO DE EXTRACCION SOXHLET MATRAZ 250 ML.EBULLICION, CONDENSADOR ALLIHN, JUNTA INFERIOR 24/40, SUPERIOR 45/50, ALTURA APROX. 711 MM", "classification": { "scheme": "CUCOP", "id": "25501-0123" }, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "FRASCOS ÁMBAR DE 50 ML CON TAPA", "classification": { "scheme": "CUCOP", "id": "25501-0077" }, "unit": { "name": "PIEZA", "value": { "amount": 35, "currency": "MXN" } } }, { "id": "0", "description": "HEMATOCÍMETRO O CÁMARA DE NEUBAUER. PARA DETERMINAR LA CONCENTRACIÓN DE CÉLULAS EN UN MEDIO LÍQUIDO. INCLUYA DOS PORTAOBJETOS PARA EL HEMATOCITÓMETRO CON ESPESOR DE 0.4 MM. 0.100 MM", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 2347.65, "currency": "MXN" } } }, { "id": "0", "description": "LUXÓMETRO O EXPOSÍMETRO. MIDA MÍNIMO DE 0 A 50,000 LUXES. CUENTE CON INDICADOR DE BATERÍA BAJA Y TEMPORIZADOR PARA APAGADO AUTOMÁTICO.INCLUYA BATERÍA Y ESTUCHE.", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "unit": { "name": "PIEZA", "value": { "amount": 898.5, "currency": "MXN" } } }, { "id": "0", "description": "MATRACES ERLENMEYER DE 500 MILILITROS TIPO A", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 114, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 220.8, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 25 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 238.8, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 217.2, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 270, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 20 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 238.8, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 30 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 238.8, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 300ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 402, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 40 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "unit": { "name": "PIEZA", "value": { "amount": 270, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA VOL VARIABLE 1000-10000 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "unit": { "name": "PIEZA", "value": { "amount": 3907, "currency": "MXN" } } }, { "id": "0", "description": "MORTERO DE PORCELANA CON PISTILO DE 65 ML", "classification": { "scheme": "CUCOP", "id": "25501-0027" }, "unit": { "name": "PIEZA", "value": { "amount": 125, "currency": "MXN" } } }, { "id": "0", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 50 ML (MEDIDAS 70 MM X 47 MM DE DIÁMETRO INTERNO).", "classification": { "scheme": "CUCOP", "id": "25501-0027" }, "unit": { "name": "PIEZA", "value": { "amount": 125, "currency": "MXN" } } }, { "id": "0", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 65 O 80 ML (MEDIDASAPROX. 80 MM X 53 MM DE DIÁMETRO INTERNO)", "classification": { "scheme": "CUCOP", "id": "25501-0027" }, "unit": { "name": "PIEZA", "value": { "amount": 125, "currency": "MXN" } } }, { "id": "0", "description": "PICNOMETRO CALIBRADO DE 50 ML. PICNÓMETROS SON FABRICADO EN VIDRIO SEGÚN LA NORMA ISO 3507. TANTO EL CUERPO COMO EL TAPÓN LLEVAN EL MISMO NÚMERO DE CÓDIGO DE IDENTIFICACIÓN. CALIBRADO JUNTO CON EL TAPÓN CON UNA PRECISIÓN DE 0,001 ML.", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "unit": { "name": "PIEZA", "value": { "amount": 475, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS DE DISECCION LARGAS DE 30CM", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 105, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS PARA REFRIGERANTE", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 275, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS GRADUADAS DE VIDRIO, 10 ML , TIPO O CLASE \"A\"", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 223.3, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS GRADUADAS DE VIDRIO, 100 ML , TIPO O CLASE \"A\"", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 286, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS GRADUADAS DE VIDRIO, 25 ML , TIPO O CLASE \"A\"", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 228.8, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS GRADUADAS DE VIDRIO, 50 ML , TIPO O CLASE \"A\"", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "unit": { "name": "PIEZA", "value": { "amount": 266.8, "currency": "MXN" } } }, { "id": "0", "description": "TERMÓMETRO DE MERCURIO PARA LABORATORIO, FONDO AMARILLO. DE -20 A 110 C. DIVISIÓN DE UN GRADO. LONGITUD DE 322 MM. INMERSION TOTAL", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 500.3, "currency": "MXN" } } }, { "id": "0", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 518.7, "currency": "MXN" } } }, { "id": "0", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 518.7, "currency": "MXN" } } }, { "id": "0", "description": "TERMOMETRO DE VIDRIO DE -100 A 50", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "unit": { "name": "PIEZA", "value": { "amount": 270, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO 100 ML TIPO A", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 100 ML 1 CAJA CON 50", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 2600, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 2000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 276, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 50 MILILITROS TIPO A", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE PRECIPITADO DE 50 ML PAQUETE CON 50", "classification": { "scheme": "CUCOP", "id": "25501-0053" }, "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "ACCESS RT-PCR SYSTEM KIT DE 500 MUESTRAS", "classification": { "scheme": "CUCOP", "id": "25101-0038" }, "unit": { "name": "PIEZA", "value": { "amount": 70093.6902, "currency": "MXN" } } }, { "id": "0", "description": "AGAR BACTERIOLÓGICO. FRASCO CON 500 G.", "classification": { "scheme": "CUCOP", "id": "25101-0059" }, "unit": { "name": "PIEZA", "value": { "amount": 2184.2881, "currency": "MXN" } } }, { "id": "0", "description": "AGAR CEREBRO CORAZON FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0060" }, "unit": { "name": "PIEZA", "value": { "amount": 1746.5316, "currency": "MXN" } } }, { "id": "0", "description": "AGAR MÉTODOS ESTANDAR FRASCO 450G", "classification": { "scheme": "CUCOP", "id": "25101-0061" }, "unit": { "name": "PIEZA", "value": { "amount": 1354.6182, "currency": "MXN" } } }, { "id": "0", "description": "AGAR NUTRITIVO FRASCO (450GR)", "classification": { "scheme": "CUCOP", "id": "25101-0062" }, "unit": { "name": "PIEZA", "value": { "amount": 1587.4291, "currency": "MXN" } } }, { "id": "0", "description": "AGAR PAPA DEXTROSA PDA FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "unit": { "name": "PIEZA", "value": { "amount": 1117.3128, "currency": "MXN" } } }, { "id": "0", "description": "AGAROSA ULTRA PURA 100 GRAMOS. GRADO BIOLOGÍA MOLECULAR.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1719.1157, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE CARGA PARA ELECTROFORESIS DE 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1063.25, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE PARA TEÑIR ÁCIDOS NUCLEICOS GEL RED® 10 000 X 0.5 ML.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1113.57, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE PARA TEÑIR GELES DE ELECTROFORESIS (SUSTITUTO DE BROMURO DE ETIDIO) DE 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2312.57, "currency": "MXN" } } }, { "id": "0", "description": "D-GLUCOSA ANHIDRA ACS (DEXTROSA) PARA MICROBIOLOGÍA (MEDIO DE CULTIVO). FRASCO DE 250 G.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 397.52, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DNA POLIMERASA GOTAQ® FLEXI DNA. PARA AMPLIFICACIÓN DE ADN POR PCR. 500 UNIDADES.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2349.46, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA TAQ POLIMERASA. 500 UNIDADES. LA BIOLASA (ADN POLIMERASA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2349.46, "currency": "MXN" } } }, { "id": "0", "description": "ESCALERA BAJA PCR 20 PB, PARA ELECTROPHORESIS DE FRAGMNETOS DE PCR CON 40 µG.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 4102.76, "currency": "MXN" } } }, { "id": "0", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1159.56, "currency": "MXN" } } }, { "id": "0", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO PARA MICROBIOLOGÍA. FRASCO DE 500 G.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1159.56, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA GELES DE ADN: BH 100 BP DNA LADDER RTU. DM001-R500. 500 MICROLITROS (11 BANDS, 100-1,500BPS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 2944.74, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO PDA MCD-LAB CAT. 7041", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1014.84, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE CALCIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 259.04, "currency": "MXN" } } }, { "id": "0", "description": "PCR CORE KIT WITH TAQ DNA POLYMERASE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 3944.82, "currency": "MXN" } } }, { "id": "0", "description": "PEPTONA EXTRACTO DE CARNE FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1604.51, "currency": "MXN" } } }, { "id": "0", "description": "SET DE DNTPS PARA PCR POR SEPARADO. 4 X 25 UMOL (4X250UL)/ 4 X 100 UMOL (4X1ML) / 4 X 100 UMOL (4X4X250UL) / 4 X 500 UMOL (4X5X1 ML) / 4 X 1000 UMOL (4×10 ML). EL SET CONSISTE EN CUATRO SOLUCIONES 100 MM SEPARADAS DE: DATP, DCTP, DGTP Y DTTP RESPECTIVAMENTE. ULTRAPURO: >99% TRIFOSFATO POR HPLC.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 5980.79, "currency": "MXN" } } }, { "id": "0", "description": "TRIPTONA (DIGERIDO PANCREÁTICO DE CASEÍNA) 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1391.47, "currency": "MXN" } } }, { "id": "0", "description": "TRIPTONA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "unit": { "name": "PIEZA", "value": { "amount": 1391.47, "currency": "MXN" } } } ], "documents": [ { "id": "1", "title": "2 CAAS JUSTIFICACION  EN TERMINOS DEL ART 71 DEL REGLAMENTO DE LA LEY DE ADQUISICIONES_OK.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:25.514Z" }, { "id": "2", "title": "2 ANEXO TECNICO ADQUISICIÿN DE REACTIVOS QUIMICOS-MATERIALES Y ACCESORIOS DE LABORATORIO CVER.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:33.785Z" }, { "id": "3", "title": "OFICIO DE ADJUDICACIÿN A PROVEEDOR ALPHALAB_OK_S.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:35.869Z" }, { "id": "4", "title": "XVII. COMERCIALIZADORA ALPHALAB S DE RL DE CV.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:38.423Z" }, { "id": "5", "title": "OFICIO DE ADJUDICACIÿN QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:39.774Z" }, { "id": "6", "title": "XVIII. QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD (1).pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:42.249Z" }, { "id": "7", "title": "OFICIO DE ADJUDICACIÿN UNIPARTS SA DE CV.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:44.023Z" }, { "id": "8", "title": "XIX. UNIPARTS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/4c504e39f04f4d3e8583cb77ddd414e2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-07T13:09:49.350Z" } ] }, "awards": [ { "id": "1", "status": "active", "suppliers": [ { "id": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "name": "COMERCIALIZADORA ALPHALAB S DE RL DE CV" } ], "value": { "amount": 817421.62, "currency": "MXN" } }, { "id": "2", "status": "active", "suppliers": [ { "id": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "name": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV" } ], "value": { "amount": 108413.26, "currency": "MXN" } }, { "id": "3", "status": "active", "suppliers": [ { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV" } ], "value": { "amount": 132637.16, "currency": "MXN" } } ], "extensions": { "source": "ComprasMX", "canonical": "https://licitia.com.mx/adjudicacion/aa-08-izc-008izc999-n-95-2023", "license": "https://creativecommons.org/licenses/by/4.0/", "ocidPrefixRegistered": false } }