{ "html_url": "https://licitia.com.mx/adjudicacion/aa-12-ncz-012ncz001-n-37-2025", "canonical": "https://licitia.com.mx/adjudicacion/aa-12-ncz-012ncz001-n-37-2025", "id": "0f9ac839804e474999a61f4858b7ed83", "procedure_number": "AA-12-NCZ-012NCZ001-N-37-2025", "file_number": "E-2025-00021263", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "description": { "short": "Equipos especializados, sustancias y materiales químicos, físico químico o bioquímico, para proyectos de investigación científica y desarrollo tecnológico.", "detailed": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "INP", "acronym": "INP", "branch": "12 - SALUD", "buying_unit": "DIRECCIÓN DE ADMINISTRACIÓN", "requesting_unit": "unidad requiriente data", "requesting_group": "DIRECCIÓN DE ADMINISTRACIÓN", "entity": "INSTITUTO NACIONAL DE PEDIATRIA", "slug": "inp", "unit_slug": "direccion-de-administracion-012ncz001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2025, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "38", "exception_basis": "Art. 41 fr. XVII", "internal_control_number": "COMITE 2DA EXTRAORDINARIA 001 2025", "supply_source_number": null }, "schedule": { "published_at": "2025-03-13T22:06:43.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2025-03-11T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "ABALAT, S.A DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196567", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA DE ADN VYSIS LSI BCL6 (ABR)* DUAL COLOR BREAK APART SE HIBRIDA CON LA BANDA 3Q27. LA SONDA BCL6 SPECTRUMORANGE DE 5' TIENE UN TAMAÑO DE ~349 KB Y FLANQUEA EL ABR DE BCL6. LA SONDA BCL6 SPECTRUMGREEN DE 3' TIENE UN TAMAÑO APROXIMADO DE 816 KB Y FLANQUEA LA REGIÓN MBR DE BCL6.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA VYSIS LSI D7S486 SPECTRUMORANGE/CEP 7 SPECTRUMGREEN SE HIBRIDAN CON LA BANDA 7Q31 (SPECTRUMORANGE LSI D7S486)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA VYSIS PARA CENTROMERO DE CROMOSOMA X MARCADA CON FLUOROCROMO VERDE. ( VYSIS CEP X (DXZ1) SPECTRUMGREEN PROBE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VYSIS CEP 8 (D8Z2) SPECTRUMGREEN PROBE (ASR)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VYSIS LSI 1P36 MICRODELETION REGION PROBE (ASR)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VYSIS LSI 21 SPECTRUMORANGE PROBE (ASR)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO DE GENOTIPADO SNP TAQMAN™, HUMANO. ASSAY ID: C___7911963_10. SNP ID:RS17650792.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FAST SYBR® GREEN MASTER MIX", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE AISLAMIENTO DE ARN PICOPURE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA UNIVERSAL TAQMAN™ II, SIN UNG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROAMP™ OPTICAL ADHESIVE FILM (96-WELL, STANDARD PLATE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS2393732, GEN ARID5B. ID: C__16006024_20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS2393782, GEN ARID5B. ID: C__16006107_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS4948488, GEN ARID5B. ID: C__26140121_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN® GENE EXPRESSION ASSAYS ID: RN01461255_M1. GENE: SOX8", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN® GENE EXPRESSION ASSAYS ID: RN01518055_M1. GENE: DICER1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN® GENE EXPRESSION ASSAYS. ID: RN00580551_M1. GENE: RARA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN® GENE EXPRESSION ASSAYS.ID: RN01399560_M1. GENE: RXRB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ ADVANCED, HUMAN MIRNA. ASSAY NAME: HSA-MIR-650. ASSAY ID: 479129_MIR)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ ENSAYOS DE EXPRESIÓN GÉNICA. TARGET SPECIES: MOUSE. GENE: GAPDH. ASSAY ID: MM99999915_G1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ ENSAYOS DE EXPRESIÓN GÉNICA. TARGET SPECIES: RAT. GENE: GAPDH. ASSAY ID: RN01775763_G1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ EXOGENOUS INTERNAL POSITIVE CONTROL REAGENTS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM01333430_M1. GENE: VIM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM02019550_S1. GENE:NANOG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM03053810_S1. GENE: SOX2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID:RN00581867_M1. GENE:DIO2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00441185_M1. GENE: RXRA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00562044_M1. GENE: THRB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00584891_M1. GENE: SLCO1C1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00596041_M1. GENE: SLC16A2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID:RN00568002_S1. GENE: DIO3", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM). ASSAY ID: RN01464140_M1. GENE: THRA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS373455425. GENE: XDH. ASSAY ID: C_365253619_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS487121. GENE: MIR924HG. ASSAY ID: C___2313112_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID:RS2236168. GENE: XDH. ASSAY ID: C__26435993_20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS1800566. GENE: NQO1. ASSAY ID: C___2091255_30", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS2835286. GENE: CBR3-AS1. ASSAY ID: C__16075424_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS3014216. GENE: AKR1A1. ASSAY ID: C__11869471_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS4987121. GENE: CBR3 ASSAY ID: C__43955396_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ GENOTYPING MASTER MIX", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA ASSAY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA ASSAY. ASSAY ID: 000560. ASSAY NAME: HSA-MIR-372", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA ASSAY. ASSAY ID: 002592. ASSAY NAME:MMU-MIR-291A-3P", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA ASSAYS. ASSAY ID: 001093. ASSAY NAME: RNU6B", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA CONTROL ASSAY. ASSAY ID: 001973. ASSAY NAME: U6 SNRNA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ MICRORNA REVERSE TRANSCRIPTION KIT", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ UNIVERSAL MASTER MIX II, SIN UNG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN™ UNIVERSAL PCR MASTER MIX, 2-PACK (2 X 5 ML), 400 RXN", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD™ CYTOMETRIC BEAD ARRAY (CBA) MOUSE TH1/TH2/TH17. KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD™ PERCP MOUSE ANTI-HUMAN CD3 (20 µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD GASPAK EZ CAMPYPAK CONTAINER. SISTEMA Y SUMINISTROS DE GENERACIÓN DE GAS GASPAK™ EZ", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI.HUMAN DE RATÓN CD38 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-CXCR5 HUMANO (CD185) DE RATA CON FLUORURO DE BD PHARMINGEN™ ALEXA FLUOR® 647", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-IGD HUMANA DE RATÓN FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FITC ANTI-CD127 HUMANO DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE APOPTOSIS, DAÑO AL ADN Y PROLIFERACIÓN CELULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-CD24 HUMANO DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE MOUSE ANTI-CD27 HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE MOUSE ANTI-HUMAN CD8", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PURIFIED RAT ANTIMOUSE CD16/CD32", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN BLOQUEADORA (BLOTTING-GRADE BLOCKER)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLAGENASA, TIPO IV, POLVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CTS™ GLUTAMAX™-I SUPPLEMENT (100X)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12, POLVO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM, ALTO CONTENIDO EN GLUCOSA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM, POLVO, GLUCOSA BAJA, PIRUVATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA TRYPLE EXPRESS (1X), SIN ROJO FENOL", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN EGF (EPIDERMAL GROWTH FACTOR) RECOMBINANT PROTEIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN EGF RECOMBINANT PROTEIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN IL-1 BETA RECOMBINANT PROTEIN, PEPROTECH®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN IL-6 RECOMBINANT PROTEIN, PEPROTECH®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN TNF-ALPHA RECOMBINANT PROTEIN, PEPROTECH®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTAMINA (200 MM)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTAMINA (200 MM)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM/F-12, GLUTAMAX™ SUPPLEMENT", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO MCDB131 SIN GLUTAMINA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO RPMI (L-GLUTAMINA Y ROJO FENOL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PBS (SOLUCIÓN SALINA TAMPONADA CON FOSFATO), PH 7.4", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PENICILINA-ESTREPTOMICINA (10.000 U/ML)", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEPTONA BACTO™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE BICARBONATO SÓDICO AL 7,5 %", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN SALINA EQUILIBRADA DE HANK´S (HBSS, SIN CALCIO, SIN MAGNESIO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA-EDTA (0,25%), ROJO DE FENOL", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MINISEQ™ MID OUTPUT KIT (300 CYCLES)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZOL™ REAGENT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR® 488. DONKEY ANTI-GOAT IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR® PLUS 488. F(AB')2-GOAT ANTI-RABBIT IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL CYP2C11 CONEJO ANTI-FELINO, HUMANO, RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO RECEPTOR A ANDROGENOS POLICLONAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ALTAMENTE ADSORBIDO CRUZADO IGG (H+L) ANTI-RATÓN DE CABRA, ALEXA FLUOR™ 594 (2 MG/ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BODIPY™ (ÁCIDO UNDECANOICO) 581/591 C11 (SENSOR DE PEROXIDACIÓN DE LÍPIDOS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYP2J2 CONEJO ANTIHUMANO, RATÓN, RATA, POLICLONAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DONKEY ANTI-RABBIT IGG (H+L) ANTICUERPO SECUNDARIO DE ALTA ADSORCIÓN CRUZADA, ALEXA FLUOR™ 488 (2 MG/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DONKEY ANTI-RABBIT IGG (H+L) HIGHLY CROSS-ADSORBED SECONDARY ANTIBODY, ALEXA FLUOR™ 555", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-MOUSE IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-MOUSE IGG (H+L) HIGHLY CROSS-ADSORBED SECONDARY ANTIBODY, ALEXA FLUOR™ 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IKB ALPHA MONOCLONAL ANTIBODY (T.937.7)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IKK ALPHA RECOMBINANT RABBIT MONOCLONAL ANTIBODY (SN06-99)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IKK GAMMA MONOCLONAL ANTIBODY (H.256.9)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT 1 KB PLUS DNA LADDER (1 KB PLUS DNA LADDERT (1 µG/µL) IN 10 MM TRIS-HCL (PH 7.5), 50 MM NACL, AND 1 MM EDTA)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA LEPTINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LATS2 POLYCLONAL ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE MONTAJE FLUOROMOUNT-G™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOUSE INSULIN ELISA KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MULTISCRIBE™ REVERSE TRANSCRIPTASE ( 50 UNITS / µL)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NUPAGE® MES SDS RUNNING BUFFER (20X)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NUPAGE™ DEL 3 AL 8 %, TRIS-ACETATO, 1.0–1.5 MM, MINIGELES DE PROTEÍNA, CON 12 POZOS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NUPAGE™ DEL 4 AL 12 %, BIS-TRIS, 1.0–1.5 MM, MINIGELES DE PROTEÍNA, CON 15 POZOS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NUPAGE™ TRIS-ACETATE SDS RUNNING BUFFER (20X)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHASEMAKER™ TUBOS (CONTIENEN UN POLÍMERO LÍQUIDO GRUESO QUE SEPARA Y AÍSLA COMPLETAMENTE LA FASE ACUOSA SUPERIOR DE LA MEZCLA DE REACTIVOS TRIZOL® DE LA FASE ORGÁNICA INFERIOR, SIMPLIFICANDO EN GRAN MEDIDA LA ELIMINACIÓN DE LA FASE SUPERIOR QUE CONTIENE EL ARN)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE™ 3000", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAP (SLAM ASSOCIATED PROTEIN) MONOCLONAL ANTIBODY (XLP-1D12) PE, EBIOSCIENCE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA DE RT-PCR SUPERSCRIPT™ III DE UN PASO CON ADN POLIMERASA PLATINUM™ TAQ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE ESTABILIZACIÓN RNALATER™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAMPÓN DE LAVADO EBIOSCIENCE™ 20X TBS PARA IHC/ICC", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAMPÓN DE TRANSFERENCIA NUPAGE™ (20X)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA SIN NUCLEASAS (NO TRATADA CON DEPC)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROBEXPRESS™ BACTERIAL MRNA ENRICHMENT KIT", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIOFILCHEM™ MTS™ LEVOFLOXACIN [LEV] 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIOFILCHEM™ MTS™ METRONIDAZOLE [MTZ] 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA AMIKACIN [AK] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA AZTREONAM [ATM] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA CEFEPIME [FEP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA CEFTAZIDIME [CAZ] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA MEROPENEM [MRP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA CEFTAZIDIME - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA COLISTIN [CS] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA PIPERACILLIN [PIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA PIPERACILLIN-TAZOBACTAM [TZP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA TICARCILLIN-CLAVULANIC ACID [TTC] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/2-256/2 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA TOBRAMYCIN [TOB] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GENTRA PUREGENE BLOOD KIT (120 ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ADN QIAAMP POWERFECAL PRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QIAAMP DNA MICROBIOME KIT (50)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TINTE DE CARGA DE ADN GELPILOT, COLORANTE DE CARGA DE ADN GELPILOT, 5X (6 X 500 µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GENTRA® PUREGENE® BUCCAL CELL KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA EXTRACCIÓN DE DNA A PARTIR DE GEL. COLUMNAS CON MEMBRANAS DE SILICA PARA PURIFICACIÓN DE FRAGMENTOS DE DNA A PARTIR DE GEL. FRAGMENTOS 70PB-10 KB. RENDIMIENTO >95%. VOLUMEN DE ELUÍDO 30-50 UL. CON INDICADOR DE PH.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT QIAGEN ONESTEP RT-PCR (100)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT QIAPREP 2.0 SPIN MINIPREP (100 COLUMNAS DE CENTRIFUGADO)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MIRNEASY MICRO KIT (50)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PUREGENE® SOLUCIÓN DE PRECIPITACIÓN DE PROTEÍNAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QIACUITY EG PCR KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QIACUITY PROBE PCR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RNASE A (17,500 U). VIAL CON 2.5 ML (100 MG/ML; 7000 UNIDADES/ML, SOLUCIÓN)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHORBOL 12-MYRISTATE 13-ACETATE (PKC PATHWAY ACTIVATOR; ACTIVATES PROTEIN KINASE C)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNASE I (RNASE-FREE)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MIRVANA® MIRNA INHIBITOR. ASSAY ID: MH10165. ASSAY NAME: HSA-MIR-372-3P", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MIRVANA® MIRNA MIMIC. ASSAY NAME: HSA-MIR-372-3P. ASSAY ID: MC10165. ESPECIE: HUMAN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEPC-TREATED WATER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNTP MIX (10 MM EA)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INSULIN RAT ELISA KIT PARA 96 PRUEBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TOTAL REACTIVE OXYGEN SPECIES (ROS) ASSAY KIT 520 NM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAMHI (10 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN FASTDIGEST XBAI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER™ PLUS, DE 10 A 250 KDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTREPTAVIDINA AGAROSA PIERCE™ DE ALTA CAPACIDAD", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FASTDIGEST NDEI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCÓGENO, GRADO DE BIOLOGÍA MOLECULAR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PMSF ( INHIBIDOR DE PROTEASA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "162", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PONCEAU S STAINING SOLUTION", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFO-NHS-LC-BIOTINA EZ-LINK™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL™ WEST FEMTO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAMPÓN DE LAVADO DE INMUNOTRANSFERENCIA (WESTERN BLOT) RESTORE™ PLUS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA DNA 50 BP", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "2", "name": "ACCESORIOS PARA LABORATORIO, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196541", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO, CERTIFICADO DE EE.UU", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAROSA ULTRAPURE™", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGLUTININA DE GERMEN DE TRIGO (WGA), CONJUGADO ALEXA FLUOR™ 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETOFENONA PARA SÍNTESIS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE NESSLER PARA SALES DE AMONIO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HITRAP® Q HIGH PERFORMANCE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AQUATEX® MEDIO DE MONTAJE ACUOSO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASEIN HYDROLYSATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHANOL FOR MOLECULAR BIOLOGY FCO 250 ML", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MALTOSE MONOHYDRATE FOR MICROBIOLOGY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA G AGAROSA, FLUJO RÁPIDO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, POD (IN SITU CELL DEATH DETECTION)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NADH (?-NICOTINAMIDA ADENINA DINUCLEÓTIDO, FORMA REDUCIDA, SAL DISÓDICA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÉTER TERC-BUTILMETÍLICO (TERT-BUTYL METHYL ETHER LICHROSOLV®)", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-(+)- TREHALOSA DIHIDRATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, FLUORESCEÍNA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3- O -METILQUERCETINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO TRICLOROACÉTICO, GRADO REACTIVO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMPICILINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CALCOFLUOR WHITE STAIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE CALCIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE RUBIDIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-(+)-GALACTOSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DISOLUCIÓN ANTIBIÓTICA ANTIMICÓTICA (100X) ESTABILIZADA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DL-GLYCERALDEHYDE 3-PHOSPHATE DIETHYL ACETAL BARIUM SALT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FORMALDEHÍDO EN SOLUCIÓN MÍN. 37% EXENTO DE ÁCIDO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLURARALDEHIDO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INTERLEUKIN-17A HUMAN, IL-17A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INTERLEUKIN-17F HUMAN, IL-17F", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INULIN FROM CHICORY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOPROPANOL GRADO BIOLOGÍA MOLECULAR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NICOTINAMIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEINASE K FROM TRITIRACHIUM ALBUM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE FENOL DE FOLIN Y CIOCALTEU", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RPMI-1640 MEDIO (CON L-GLUTAMINA Y BICARBONATO DE SODIO, LÍQUIDO, ESTERILIZADO POR FILTRACIÓN, APTO PARA CULTIVO CELULAR)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE SAFRANINA DE GRAM'S, PARA MICROSCOPÍA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DECOLORANTE DE GRAM (MEZCLA DE ACETONA Y ETANOL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN FORMALDEHÍDO PARA BIOLOGÍA MOLECULAR 36.5%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE NÍQUEL (II) HEXAHIDRATADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIMETROPRIM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 VISCOUS LIQUID", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SALES BILIARES OXOID™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASA DE RÁBANO PIERCE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "3", "name": "BIOADVANCED SYSTEMS, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196537", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMPLITAQ GOLD DNA POLYMERASE, WITH BUFFER II AND MGCL2, 3000 UNITS (12 TUBES X 50 UL, 250 UNITS PER TUBE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMPLITAQ GOLD™ 360 MASTER MIX", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CUSTOM TAQMAN™ SNP GENOTYPING ASSAY, HUMAN S (300 REACTIONS)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GENECHIP™ HUMAN GENOME U133 PLUS 2.0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA RT-PCR (TAQMAN REVERSE TRANSCRIPTION), MULTISCRIBE REVERSE TRANSCRIPTASE, RNASE INHIBITOR, DNTP MIXTURE, OLIGO D(T)16, RANDOM HEXAMERS, 10X RT BUFFER, MGCL2 SOLUTION.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SEQUENCE DETECTION PRIMER", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMNIOMAX™- II COMPLETE MEDIUM", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBIÓTICO-ANTIMICÓTICO (100X)", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BIOSATE™ PEPTONE, 454 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO), POLVO, ALTO CONTENIDO EN GLUCOSA, EN POLVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM, ALTO CONTENIDO EN GLUCOSA, PIRUVATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIBRIDOMA-SFM", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PBS PH 7.4", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIRUVATO DE SODIO (100 MM)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE AMINOÁCIDOS NO ESENCIALES MEM (100X)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN EN HBSS KARYOMAX™ COLCEMID™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1 M DE TRIS-HCI ULTRAPURE™, PH 8,0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "100 BP DNA LADDER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA LIBRE DE NUCLEASAS (NO TRATADA CON DEPC)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBÚMINA: ULTRAPURE™ BSA (50 MG/ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INDICADOR ROJO DE SUPERÓXIDO MITOCONDRIAL MITOSOX™, PARA IMÁGENES DE CÉLULAS VIVAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INVITROGEN™ TRUEGUIDE™ SGRNA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUBIT™ 1X DSDNA HS ASSAY KIT. ENSAYO: ADNDS 1X, ALTA SENSIBILIDAD- 0,1-120 NG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUBIT™ 1X DSDNA HS Y BR ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPERSCRIPT™ III FIRST-STRAND SYNTHESIS SUPERMIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNTP MIX CONTIENE: 10 MM DE CADA UNO DE DATP, DTTP, DCTP Y DGTP.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ECORI (10 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN DPNI (10 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN NDEI (10 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FASTDIGEST BAMHI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIGADURA RÁPIDA DE ADN KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIGASA DE ADN T4 (5 U/µL)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MAXIMA SYBER GREEN/ROX Q PCR MASTER MIX 200 X 25 UL RXN", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA DE DNTP (10 MM CADA UNO)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NDEI (10 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGO (DT)18 PRIMER", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHUSION HIGH-FIDELITY DNA POLYMERASE (2 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRANSCRIPTASA INVERSA REVERTAID (200 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XHOI (10 U/µL), ENZIMA DE RESTRICCIÓN", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INHIBIDORES DE LA ARNASA RIBOLOCK (40 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MAXIMA PROBE/ROX QPCR MASTER MIX (200 X 25 µL RXNS)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "4", "name": "BIOSYSTEMS CORP®", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196542", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PCR EXPANSION KIT (PCR PRIMERS (PRM) AND PCR ADAPTERS (PCA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ADAPTADOR MINION™ MK1B PARA CARTUCHO MINION™ Y GRIDION™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIGATION SEQUENCING KIT V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CDNA - PCR BACODING KIT V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIRECT RNA SEQUENCING KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "5", "name": "COMERCIALIZADORA E IMPORTACIÓN DE PRODUCTOS QUÍMICOS, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196568", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA MEDICIÓN DE LONGITUD DE TELOMEROS POR CITOMETRÍA DE FLUJO PNA KIT/FITC", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIHUMAN CD45 BV605 BD HORIZON™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD13 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD14 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD19 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD29 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD31 PE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD34 FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD73-PE, AD-2", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL CD90 PE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ECOMOUNT, ES UN MEDIO DE MONTAJE PERMANENTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "7-AAD VIABILITY STAINING SOLUTION (50 µG/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR® 488 DONKEY ANTI-RABBIT IGG (MINIMAL X-REACTIVITY) ANTIBODY", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR® 647 DONKEY ANTI-RABBIT IGG (MINIMAL X-REACTIVITY) ANTIBODY", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-BACH2 DE PE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FITC ANTI-IGG DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN GM-CSF BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IL-22 BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN TNF-ALPHA BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC ANTI-HUMAN CD63 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC/CYANINE7 ANTI-HUMAN CD4 ANTIBODY", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FITC ANNEXIN V APOPTOSIS DETECTION KIT WITH PI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FITC ANTI-HUMAN CD203C (E-NPP3) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FITC ANTI-HUMAN TNF-ALPHA ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-HUMAN CD86 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-HUMAN CXCL10 (IP-10) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-HUMAN IFN-GAMMA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERCP ANTI-HUMAN CD4 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERCP/CYANINE5.5 ANTI-HUMAN CD3 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERCP/CYANINE5.5 ANTI-NOS2 (INOS) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT HUMAN IFN-? (CARRIER-FREE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT HUMAN IL-2 (E. COLI EXPRESSED, CARRIER-FREE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT HUMAN IL-21 (CARRIER-FREE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FETAL BOVINE SERUM (MÉXICO, USDA APPROVED)", "requested_quantity": "13", "minimum_quantity": "13", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRANSFERRINA, BOVINA (FORMA HOLO), LIOFILIZADA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "24XCYTE HUMAN MULTICOLOR FISH", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA DE DNA PARA LAS REGIONES 1P36.3 Y 1Q25.2 MARCADAS CON FLUOROCROMOS NARANJA Y VERDE RESPECTIVAMENTE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CD117. MICROBEADS, MOUSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACHE ASSAY KIT :: GENERAL ACETYLCHOLINESTERASE ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APIGENIN, BIOCHEMICAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CAPTOPRIL DISULFIDE, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIALLYL DISULFIDE, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EBSELEN SMALL MOLECULE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MYRICETIN, BIOCHEMICAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROSMARINIC ACID, BIOCHEMICAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM OXAMATE BIOCHEMICAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SYNEPHRINE, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TERT-BUTHYL PITAVASTATIN BIOCHEMICAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN NF-KAPPAB P65 ACTIVITY ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN NRF2 ACTIVITY ASSAY KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DAPI (4´,6-DIAMIDINO-2-PHENYLINDOLE DIHYDROCHLORIDE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUOLINK® REACTIVOS DE DETECCIÓN IN SITU ROJA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-HUMAN IGG ANTIBODY, HRP CONJUGATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROPYLEN GLYCOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LENTI-X™ CONCENTRATOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "6", "name": "CONTROL TÉCNICO Y REPRESENTACIONES, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196539", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-BRDU ANTIBODY [BU1/75 (ICR1)]", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-BDNF [EPR1292]: BAJO CONTENIDO DE ENDOTOXINAS, LIBRE DE AZIDA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL DE CONEJO DCAMKL1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO RECOMBINANTE ANTI-RECEPTOR DE GLUTAMATO 1 (SUBTIPO AMPA) [EPR19522]", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-INSULIN ANTIBODY", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TRIYODOTIRONINA LIBRE (ELISA DE T3 LIBRE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE HORMONA ESTIMULANTE DE LA TIROIDES (TSH ELISA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TIROXINA LIBRE (ELISA DE T4 LIBRE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TIROXINA TOTAL (ELISA DE T4 TOTAL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA MEDICIÓN DE TSH EN SUERO DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAT INSULIN ELISA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL™ SENSI-DISC™ MEROPENEM 10 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL™ SENSI-DISC™ CLINDAMYCIN, 2 µG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL™ SENSI-DISC™ ERTAPENEM,10 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL™ SENSI-DISC™ IMIPENEM,10 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR MEDIO SIM-BD BIOXON®", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR MUELLER HINTON BD BIOXON®", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD CULTURESWAB™ PLUS AMIES GEL WITHOUT CHARCOALSINGLE SWAB ( GEL AMIES SIN CARBÓN HISOPO SIMPLE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANNEXIN V RECOMB FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD PHARMINGEN™ FITC ANNEXIN V APOPTOSIS DETECTION KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FITC GOAR ANTI-RABBIT IGG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR SOYA TRIPTICASEINA BD BIOXON®", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL™ SENSI-DISC™ - VANCOMYCIN, 30 µG (VA-30)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BD BBL ™ SENSI-DISC ™ AMPICILINA AM- 10 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE ZINC HEPTAHIDRATADO RA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 25%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TETROXIDO DE OSMIO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GIBCO™ MEDIO BASAL DE EXPANSIÓN DE FIBROBLASTOS HUMANOS (ANTERIORMENTE MEDIO 106)", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTATHIONE COLORIMETRIC DETECTION KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-PROPANOL, PARA ANALISIS EMSURE®, ACS,ISO,REAG. PH EUR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEO-CLEAR™, SUSTITUTO DE XILENO, PARA MICROSCOPIA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA PARA CROMATOGRAFÍA DE GASES ECD Y FID SUPRASOLV®", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL ABSOLUTO PARA ANÁLISIS EMPARTA® ACS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIAPHORASE FROM CLOSTRIDIUM KLUYVERI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FANCD2 - LIBRE DE BSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO BDNF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PURIFICACIÓN QIAQUICK PCR, PARA LA PURIFICACIÓN DE 250 REACCIONES PCR: 250 QIAQUICK SPIN COLUMNS, BUFFERS, COLLECTION TUBES (2 ML)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE DNA MINI KIT QIAAMP®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BIOTINILADO CONTRA IL-10 HUMANA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BIOTINILADO IL-6 HUMANO/DE PRIMATES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE FACTOR DE NECROSIS TUMARAL DUOSET DE TNF-ALFA HUMANO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE INTERLEUCINA DUOSET DE IL-10 HUMANA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE INTERLEUCINA DUOSET DE IL-6 HUMANA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT HUMAN IL-22 PROTEIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT HUMAN IL-23 PROTEIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1-OCTANOL ANHIDRO, =99%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO CLORHÍDRICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACTINOMYCIN D", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ACTINA PRODUCIDO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL ANTI-IGG1-BIOTINA HUMANA PRODUCIDO EN RATÓN.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-MOUSE IGG2B (?-CHAIN SPECIFIC)-PEROXIDASE ANTIBODY PRODUCED IN RABBIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-MOUSE IGG3 (?-CHAIN SPECIFIC)-PEROXIDASE ANTIBODY PRODUCED IN RABBIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BRADFORD REACTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-PANTOTHENIC ACID HEMICALCIUM SALT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUOLINK® IN SITU RED STARTER KIT MOUSE/RABBIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KAEMPFEROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERSULFATO DE AMONIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "S-(5?-ADENOSYL)-L-METHIONINE CHLORIDE DIHYDROCHLORIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS COMPETENTES E. COLI DH5ALPHA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO HRP MOUSE ANTI MOUSE IGG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-RABBIT IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HORSE ANTI-GOAT IGG ANTIBODY (H+L), BIOTINYLATED _X000B_", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HORSE ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE MONTAJE ANTIDECOLORACIÓN VECTASHIELD® CON DAPI", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VECTASHIELD® ANTIFADE MOUNTING MEDIUM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VECTASTAIN® ELITE® ABC-HRP KIT (PEROXIDASE, UNIVERSAL) DUPLICIDAD", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "7", "name": "CRISSOF DE MÉXICO, S DE RL DE C.V", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196569", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "100X BIOLYTE® 3/10 AMPHOLYTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "30% ACRYLAMIDE/BIS SOLUTION", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "30% ACRYLAMIDE/BIS SOLUTION, 29:1", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACRILAMIDA PURO AL 99,9 %", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DITHIOTHREITOL (DTT)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IMMUNO-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M (1 ROLL, 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS (MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES TEÑIDAS DE AZUL (10–250 KD), INCLUIDAS TRES BANDAS DE REFERENCIA (25, 50, 75 KD), 50 APLICACIONES)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PRECISION PLUS PROTEIN™ KALEIDOSCOPE™ PRESTAINED PROTEIN STANDARDS (500 µL, MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES (10–250 KD))", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROFINITY™ IMAC RESIN, NI-CHARGED 25 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SSOADVANCED™ UNIVERSAL SYBR® GREEN SUPERMIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "8", "name": "DIAGNÓSTICO INNOVACIÓN Y ASESORÍA, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196563", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT NO DERIVATIZADO PARA CUANTIFICACIÓN DE AMINOÁCIDOS, ACILCARNITINAS Y SUCCINILACETONA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "9", "name": "DISTRIBUCIÓN Y MANTENIMIENTO DEL NOROESTE, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196572", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACEITE DE INMERSIÓN PARA MICROSCOPIA (INMERSION OIL FOR MICROSCOPY)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO ORTO-FOSFÓRICO 85% (EMSURE® ACS, ISO, REAG.)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CALDO MRS (MAN, ROGOSA AND SHARPE) GRANUCULT®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHANOL ABSOLUTE FOR ANALYSIS EMSURE AC", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHANOL ABSOLUTO PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRAN® MA 02 SUPELCO®, LÍQUIDO, NEUTRO, CONCENTRADO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO IMMOBILON® QUIMOILUMINISCENTE DE HRP PARA TRANSFERENCIAS \"WESTERN\"", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAMPÓN DE LISIS RIPA, 10X, PARA INMUNOPRECIPITACIÓN Y TRANSFERENCIA WESTERN.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO HIPERGRADO PARA LC-MS LICHROSOLV®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRAN® MA 05 SUPELCO, LÍQUIDO ALCALINO, CONCENTRADO, SIN FOSFATOS", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓGENO PERÓXIDO 30%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VORICONAZOLE. ESTÁNDAR SECUNDARIO FARMACÉUTICO: MATERIAL DE REFERENCIA CERTIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR MRS DE PRIMERA CALIDAD GRANUCULT® (DE MAN, ROGOSA Y SHARPE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MUELLER HINTON BROTH 2, NUTRISELECT ® PLUS, AJUSTADO CON CATIONES, ADECUADO PARA MICROBIOLOGÍA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MUELLER-HINTON AGAR 2", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO HRP QUIMIOLUMINISCENTE OCCIDENTAL IMMOBILON \"WESTERN BLOT (TRANSFERENCIA WESTERN)\"", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COMPLETE™, MINI, EDTA-FREE PROTEASE INHIBITOR COCKTAIL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DTT 1,4-DITHIOTHREITOL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NADP DISODIUM SALT 98%. FRASCO CON 1G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-PROPANOL (ISOPROPANOL GRADO BIOLOGÍA MOLECULAR )", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-VINYLPYRIDINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "4-AMINOBENZOIC ACID", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO, =99,9 %, HPLC PLUS, ADECUADO PARA ESPECTROSCOPIA IR, HPLC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO, GRADO HPLC, 99.9% DE PUREZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO FÓLICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO L-ASCÓRBICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETÍLICO PURO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETÍLICO PURO (ETANOL), PARA 200 PRUEBAS BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ARGININA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO PARA CULTIVO CELULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOTINA =99.0% (T)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BRILLIANT BLUE G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CIPROFLOXACIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CITOCALASINA B DE DRECHSLERA DEMATIOIDEA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOTETRACICLINA CLORHIDRATO (CTC) (=91,0 % BASE SECA (HPLC))", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLÁGENO DE PLACENTA HUMANA, BORNSTEIN Y TRAUB TIPO IV, EN POLVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CRISTAL VIOLETA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIACETATO DE FLUORESCEINA POLVO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIMETHYL SULFOXIDE (DMSO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM - DULBECCO?S MODIFIED EAGLE?S MEDIUM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL ABSOLUTO GRADO BIOL. MOL", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL GRADO BIOLOGIA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHYL ALCOHOL, PURE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUOXETINA HIDROCLORADA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICEROL", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLYCEROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLYCEROL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HYDROCORTISONE-WATER SOLUBLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IGEPAL® CA-630", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IMIDAZOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IONOMICINA DE STREPTOMYCES CONGLOBATUS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IRON(II) SULFATE HEPTAHYDRATE ( REAGENTPLUS®, =99%)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LB BROTH, MILLER, MEDIO DE CULTIVO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-CYSTEINE HYDROCHLORIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LECTIN FORMO PHASEOLUS VULGARIS (RED KIDNEY BEAN)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-SERINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LUGOL SOLUTION", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LUMINOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MENADIONE CRYSTALLINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METASULFATO DE FENAZINA PMS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-LAUROILSARCOSINA SODIUM SALT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ORNITINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHLEOMYCIN READY MADE SOLUTION (0,2 µM FILTRADO, 20 MG/ML EN HEPES 20 MM)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIPERACILLIN SODIUM SALT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLI-L-LISINA SOLUCION", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLY-L-LYSINE SOLUTION AL 0.1 % (W/V) EN AGUA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAL DE SULFATO DE COLISTINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM DICHLOROACEATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE POLIETILENGLICOL HYBRI-MAX™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE ROJO FENOL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE VIOLETA CRISTAL DE GRAM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE YODURO DE PROPIDIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TEMOZOLOMIDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THIAZOLYL BLUE TETRAZOLIUM BROMIDE (MTT)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THIUREA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIAMINA HYDROCHLORIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIZOXANIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRYPSIN-EDTA SOLUTION", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VITAMINA B12", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETYL-COENZYME A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL PROLIFERATION KIT II (XTT)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL PROLIFERATION REAGENT WST-1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COMPLETE™, MINI PROTEASE INHIBITOR COCKTAIL. TABLETS PROVIDED IN EASYPACKS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMIKACIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEROPENEM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONCENTRADO DE TAMPÓN SSC 20×", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "10", "name": "DISTRIBUIDORA QUÍMICA Y HOSPITALARÍA ARAVEL, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196536", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SANGRE DE CARNERO ESTÉRIL DESFIBRINADA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "11", "name": "HIROSTECNOLOGÍAS, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196565", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PUREIT EXOZAP PCR CLEANUP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQ DNA POLYMERASE (500 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA LADDER  50BP , 50-1500BP, 1X500UL VIAL", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA LADDER 100 BP, 100-3000BP (54µG/500µL)", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MIDORI GREEN ADVANCE (TINCIÓN DE ADN/ARN)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "12", "name": "LAUKA MEXICANA", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196564", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "A-673 (EWING'S SARCOMA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIMETIL SULFÓXIDO (DIMETHYL SULFOXIDE; DMSO)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM: F-12 MEDIUM", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EAGLE'S MINIMUM ESSENTIAL MEDIUM (EMEM), BSL: 1 REFRIGERADO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FHC (COLON HUMANO NORMAL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HMEC-1, CÉLULA HUMANAS ENDOTELIAL MICROVASCULAR DÉRMICA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO BASAL DE CÉLULAS EPITELIALES DE LAS VÍAS RESPIRATORIAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NIH/3T3 FIBROBLASTOS DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE PENICILINA-ESTREPTOMICINA (10 000 UI/ML DE PENICILINA, 10 000 (µG/ML) DE ESTREPTOMICINA)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO BOVINO DE TERNERA FORTIFICADO CON HIERRO (ATCC® 30-2030™)", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VAGINAL EPITHELIAL CELL GROWTH KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACEITE DE INMERSIÓN TIPO A CARGILLE I.R. 1.5150. (LÍQUIDO VISCOSO Y TRANSPARENTE CON ALTO ÍNDICE REFRACTIVO PARA OBSERVACIONES MICROSCÓPICAS EN UN OBJETIVO 100X)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILENO RA ACS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE SODIO, CRISTAL, BAKER ANALYZED™ A.C.S. REACTIVO,", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DE SODIO, DIBÁSICO, ANHIDRO, REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDROXIDO DE SODIO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL <=99.9% (POR GC, CORREGIDO POR CONTENIDO DE AGUA), BAKER ANALYZED ™ HPLC PARA CROMATOGRAFÍA LÍQUIDA, PARA HPLC / UHPLC", "requested_quantity": "19", "minimum_quantity": "19", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE ALUMINIO Y POTASIO, 12 HIDRATOS, CRISTAL, GRADO REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILENOS, GRADO REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "13", "name": "MARÍA SOCORRO DATHOLLÍ DE CIRIZA SOSA", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196566", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LYMPHOPREP™", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO CLÁSICO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IMMUNODNA RETRIVER 20X WITH CITRATE", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE TINCIÓN FLUORO-JADE® C RTDTM®", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL XIAP CONJUGADO CON FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA MEDICIÓN DE T3 EN SUERO DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA MEDICIÓN DE T4 EN SUERO DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "20-HETE (20-HYDROXY ARACHIDONIC ACID)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE PROLIFERACIÓN CELULAR MTT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WST-1 CELL PROLIFERATION ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FACTOR DE CRECIMIENTO DE FIBROBLASTOS HUMANO BÁSICO 154", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUAVA® ANNEXIN RED KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUAVA® EASYCHECK™ KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUAVA® INSTRUMENT CLEANING FLUID (ICF)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE DETECCIÓN DE TRANSFERENCIA WESTERN AMERSHAM™ ECL™ PRIME", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DETERMINACIÓN ESTRADIOL 96 POZOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DETERMINACIÓN TESTOSTERONA 96 POZOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOSEAL 60 (MEDIO DE MONTAJE)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 10%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLY-L-LYSINE SOLUTION 0.1% DE SOLUCIÓN ACUOSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-BETA TUBULIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-IKK BETA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-IL1 BETA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-IL6", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-LAMIN B1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-TNF ALPHA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PPAR ALPHA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PPAR GAMMA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HISTONE H3K4ME3 (TRI-METHYL LYS4) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IKB BETA ANTIBODY [7B4]", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KEAP1 ANTIBODY [1F10B6]", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NFKB P65 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NRF2 ANTIBODY [N2C2], INTERNAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PSD95 ANTIBODY [7E3-1B8]", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MONUSULFATO DE KANAMICINA, GRADO USP, FORMULA: C18H36N4O11 · H2SO4, MW: 582.58 G/MOL, ACTIVIDAD: ~800 µG/MG.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIMOUSE IGG ESPECÍFICO PARA FCGAMMA SUBLASE 2C PEROXIDASE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASA AFFINIPURE CABRA ANTI-RATÓN IGG (H+L). (MIN X HU, BOV, HRS SR PROT)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASE AFFINITPURE GOAT ANTI-MOUSE IGG, FCGAMMA SUBCLASS 1 SPECIFIC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO DE BURRO NORMAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CALDO MUELLER HINTON AJUSTADO CON CATIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIOFILCHEM™ MTS™ AMOXICILLIN [AML] 0.016-256 µG/ML. MIC TEST STRIP 30 TIRAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIOFILCHEM™ MTS™ CLARITHROMYCIN [CLR] 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA IMIPENEM - RELEBACTAM [I/R] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002/4-32/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA CIPROFLOXACIN [CIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIRA DE PRUEBA IMIPENEM [IMI] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CEFIDEROCOL FDC 30 µG. DISCO DE ANTIBIÓTICO EN CARTUCHO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IL-21 MAB (MT21.3M), BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IL-23 (P19) MAB (MT155), BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL, ANHIDRO, REACTIVO ACS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFOMO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFORMO GRADO BIOLOGIA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "(-)-EPIGALLOCATECHIN GALLATE, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "6-SHOGAOL, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMG-510, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAICALEIN, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DOXORUBICIN, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GINGEROL, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOSSYPOL, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HK ASSAY KIT :: HEXOKINASE (HK) ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MELATONIN, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PFK15, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SILIBININ (SILYBIN), INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFORAPHANE, INHIBITOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "Z-RR-AMC, PEPTIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT UNIVERSAL PARA PATÓGENOS EZNA®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE RECOLECCIÓN DE ADN EN SALIVA (TUBO PARA MUESTRA DE SALIVA Y ESPONJAS ABSORBENTES)", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAT IL-6 ELISA KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELDA DE FLUJO DE RNA MINION Y GRIDION", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NATIVE BARCODING KIT 24 V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELDAS DE FLUJO R10.4.1 PARA DISPOSITIVOS MINION™ Y GRIDION™", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONTROL EXPANSION KITS DE SECUENCIACIÓN DE ADN LAMBDA (LMD)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLOW CELL WASH KIT (KIT DE LAVADO DE CELDAS DE FLUJO MINION™ Y PROMETHION™.)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SECUENCIACIÓN RÁPIDA DE ADN - V14 V14 (SQK-RBK114.24)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAPID ADAPTER AUXILIARY V14", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SEQUENCING AUXILIARY VIALS (VIALES AUXILIARES DE SECUENCIACIÓN V14)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TISSUE-TEK® O.C.T.™ COMPOUND", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RUXOLITINIB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 11A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 15B", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 18C", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 19A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 22F", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACARIDO CAPSULAR DE NEUMOCOCO SEROTIPO 4", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 6A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 8", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLISACARIDO CAPSULAR DE NEUMOCOCO SEROTIPO 9V", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT EPON", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLIFENACIN SUCCINATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO HRP MOUSE ANTI GOAT IGG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "14", "name": "MAYIMEX S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196540", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBÚMINA DE SUERO BOVINO (BSA) LIOFILIZADA PH ~7", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO DE CABALLO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO DE TERNERA, ÉSTERIL, LIBRE DE MICOPLASMA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "15", "name": "QUIMICA VALANER S.A DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196570", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BETA ACTINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FOSFO-JAK1 (TYR1034/1035)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FOSFO-JAK2 (TYR1007/1008)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FOSFO-P44/42 MAPK (ERK1/2) (THR202/TYR204)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FOSFO-STAT3 (TYR705)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FOSFO-STAT5 (TYR694)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO JAK1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-MOUSE IGG HRP- LINKED ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-RABBIT IGG (H+L), F(AB')2 FRAGMENT (ALEXA FLUOR® 488 CONJUGATE)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-RABBIT IGG, HRP-LINKED ANTIBODY", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "E-CADHERIN (24E10) RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FANCA (D1L2Z) RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INSULIN (L6B10) MOUSE MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "JAK2 (D2E12) XP® RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHOSPHO-TFEB (SER122) (E9M5M) RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEASE/PHOSPHATASE INHIBITOR COCKTAIL (100X)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "STAT5 (D2O6Y) RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS BUFFERED SALINE (TBS-10X)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT NEONATAL T4 FEIA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA CUANTIFICACIÓN NEONATAL HTSH FEIA PLUS, EN MICROPLACA DE LA HORMONA ESTIMULANTE DE LA TIROIDES TIROTROFINA (TSH) EN SANGRE TOTAL DE NEONATOS COLECTADA EN PAPEL FILTRO CON CALIBRADORES Y CONTROLES INTERNOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCION ALWI (CONCENTRACIÓN: 10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN AVA I CONCENTRACIÓN (10,000 UNITS/ML )", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HAEII CONCENTRACIÓN (20,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN MBOI (500 UNIDADES)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN MSPA1I KIT (10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCION NLAIII. CONCENTRACIÓN:10.000 UNIDADES/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN SCRFI (1000 UNIDADES)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMAS DE RESTRICCIÓN SAU96I (CONCENTRACIÓN 5,000 U/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MONARCH® SPIN GDNA EXTRACTION KIT", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CHITIN RESI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN AFLII (20,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN BSMAI (5,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN BSTUI (10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN DDEI (10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HAEIII (10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HHAI (20,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN MFEI-HF® (20,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN NLAIV. CONCENTTRACIÓN: 2,000 UNITS/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN TAQI-V2 (20,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE GDNA MONARCH® SPIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MÓDULO COMPLEMENTARIO NEBNEXT® PARA SECUENCIACIÓN POR LIGADURA DE OXFORD NANOPORE TECHNOLOGIES®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "16", "name": "SILVERA CIENCIA E INGENIERÍA, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196538", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE GLUTATIÓN PEROXIDASA ENZYCHROM™", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CATALASE FLUOROMETRIC DETECTION KIT", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTATHIONE PEROXIDASE ACTIVITY KIT", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ELISA DE CORTICOSTERONA DE ALTA SENSIBILIDAD", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ELISA DE DAÑO RÁPIDO DEL ADN PARA CÁNCER, APOPTOSIS Y ESTRÉS OXIDATIVO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEIN CARBONYL ELISA KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOD ACTIVITY KIT (5 X 96 WELLS)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INICIADORES PARA PCR (SECUENCIA DE 30 BASES:ATCAAG TACAGTTAGTCTTTATTAGATCAA), LIBRE DE SAL", "requested_quantity": "103", "minimum_quantity": "103", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBUMINA SÉRICA BÓVINA FRACCIÓN V", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CRYOPRES™ DIMETHYL SULFOXIDE (>99.9% USP DMSO FOR CRYOPRESERVATION)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOCHROME C ( CORAZÓN DE CABALLO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIMETIL SULFÓXIDO (DIMETHYL SULFOXIDE; DMSO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ß-AMYLOID, FRAGMENT 1-42", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "(-)-GALATO DE EPIGALOCATEQUINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACHE ANTICUERPO (A-11) ALEXA FLUOR® 680", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANT CRF (2B11)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PCNA ANTIBODY (F-2)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ß-ACTIN ANTICUERPO (C4) ES UN MONOCLONAL DE RATÓN IGG1 (200 µG/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BRDU ANTICUERPO (IIB5)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CDK2 ANTICUERPO (55)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CEFTAZIDIME", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "C-FOS ANTICUERPO (D-1)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CISPLATIN (CAS 15663-27-1)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLAUDIN-11 ANTICUERPO (D-8)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CRYOPYRIN/NALP3/NLRP3 ANTICUERPO (6F12)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DARIFENACIN HYDROBROMIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DOUBLECORTIN/DCX ANTICUERPO (E-5)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTROGEN RECEPTOR ALPHA ANTICUERPO (2Q418)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HISTONE DEACETYLASE 6 (HDAC6) ANTICUERPO (D-11)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HXK II ANTICUERPO (B-8)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MACHR M3 ANTICUERPO (H-4) ALEXA FLUOR® 594", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MTT FORMAZAN (CAS 57360-69-7)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NORMAL MOUSE IGG ALEXA FLUOR® 488", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NURR1 ANTIBODY (F-5)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PKM ANTICUERPO (C-11)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "P-NF?B P50 ANTICUERPO (A-8) ALEXA FLUOR® 546", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAL TRISÓDICA DEL ÁCIDO DL-ISOCÍTRICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRA1/A2 ANTICUERPO (2103)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRß1 ANTICUERPO (J52)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZO-1 ANTICUERPO (R40.76)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "17", "name": "STANDARDTEST S. A. DE C. V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196535", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-BETA ACTINA [SP124]", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-FOSFOSERINA [B106.1]", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HISTONA H3: MARCADOR NUCLEAR Y GRADO CHIP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-REELIN [G10]. MONOCLONAL DE RATÓN [G10] A REELIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-STRA8", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL DE CONEJO RFP CONJUGADO CON BIOTINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO RECOMBINANTE ANTI-TRANSPORTADOR DE GLUCOSA GLUT2", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-DOUBLECORTIN ANTOBODY", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-GLUCAGON ANTIBODY [K79BB10]", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BRDU (5-BROMO-2'-DEOXYURIDINE), THYMIDINE ANALOG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASPASE-3, CASPASE-8 AND CASPASE-9 MULTIPLEX ACTIVITY ASSAY KIT (FLUOROMETRIC)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL CYCLE ASSAY KIT (FLUOROMETRIC - GREEN) (AB112116)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONJUGADO ANTI IGG DE RATÓN EN CABRA (ALEXA FLUOR 488)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUOROSHIELD MOUNTING MEDIUM WITH DAPI", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSE ASSAY KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-RABBIT IGG H&L (HRP)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOCITRATE DEHYDROGENASE ASSAY KIT (COLORIMETRIC)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TINCIÓN NUCLEAR/NUCLEAR: FLUORESCENCIA VERDE/ROJA - CYTOPAINTER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RABBIT ANTI-MOUSE IGG H&L (HRP)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RABBIT IGG, MONOCLONAL [EPR25A] - ISOTYPE CONTROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KAPA SYBR® FAST ONE-STEP. QRT-PCR KITS - 100 X 20 µL REACTIONS (UNIVERSAL)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PWO SUPERYIELD DNA POLYMERASE 5 U/UL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL TRIPÁN SOLUCIÓN DE 0.4%, LÍQUIDO, FILTRADO ESTÉRIL, ADECUADO PARA CULTIVO CELULAR", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COENZYME B12", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-2-HYDROXYGLUTARATE DEHYDROGENASE (D2HGDH) FROM ACIDAMINOCOCCUS FERMENTANS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DCPIP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUOLINK® IN SITU PLA® SONDA ANTI-CONEJO MINUS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUOLINK® IN SITU PLA® SONDA ANTI-RATÓN PLUS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LURIA AGAR BASE, MILLER", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MUELLER HINTON BROTH, APTA PARA MICROBIOLOGÍA. NUTRISELECT® PLUS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RABBIT ANTI-ARID4B ANTIBODY, AFFINITY PURIFIED", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RESORUFIN ETHYL ETER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAL DE ACETATO DE LEUPROLIDA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "18", "name": "UNIPARTS, S.A. DE C.V.", "description": "PRODUCTOS QUIMICOS", "requirement_group_id": "196571", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HYCLONE™ DULBECCO'S MODIFIED EAGLE MEDIUM (DMEM) WITH HIGH GLUCOSE: POWDER", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HYCLONE™ RPMI 1640, WITH L-GLUTAMINE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTAMINA, SOLUCIÓN 200 MM (29,2 MG/ML DE GLUTAMINA EN NACL AL 0,85 %)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BILIS DE BUEY. ELABORADA BAJO PROCESO DE BAJAS TEMPERATURAS Y DESHIDRATACIÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEADEND™ FLUOROMETRIC TUNEL SYSTEM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOTAQ® DNA POLYMERASE. TAQ POLIMERASA SUMINISTRADA A UNA CONCENTRACIÓN DE 5U/µL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOTAQ® GREEN MASTER MIX. MEZCLA MASTERMIX PARA LA ACTIVIDAD DE DNA POLIMERASA GO TAQ ( DNA POLIMERASA, DNTPS, MGCL2 Y BUFFERS DE REACCIÓN ÓPTIMOS)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEINASA K (LIOFILIZADA)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "X-GAL (5-BROMO-4-CLORO-3-INDOLIL-?- D - GALACTOPIRANÓSIDO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] } ], "awards": [ { "id": "C-2025-00022965", "internal_reference": "AD-441/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "ABALAT SA DE CV", "normalized_name": "ABALAT", "rfc_type": null, "slug": "abalat" }, "contract_period": { "published_at": "2025-03-13T22:10:35.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1777124", "tax": "284339.84", "total": "2061463.84", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "SONDA DE ADN VYSIS LSI BCL6 (ABR)* DUAL COLOR BREAK APART SE HIBRIDA CON LA BANDA 3Q27. LA SONDA BCL6 SPECTRUMORANGE DE 5' TIENE UN TAMAÑO DE ~349 KB Y FLANQUEA EL ABR DE BCL6. LA SONDA BCL6 SPECTRUMGREEN DE 3' TIENE UN TAMAÑO APROXIMADO DE 816 KB Y FLANQUEA LA REGIÓN MBR DE BCL6.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "23500", "subtotal": "47000", "tax": "7520", "other_taxes": null, "total": "54520" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA VYSIS LSI D7S486 SPECTRUMORANGE/CEP 7 SPECTRUMGREEN SE HIBRIDAN CON LA BANDA 7Q31 (SPECTRUMORANGE LSI D7S486)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "25346", "subtotal": "50692", "tax": "8110.72", "other_taxes": null, "total": "58802.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA VYSIS PARA CENTROMERO DE CROMOSOMA X MARCADA CON FLUOROCROMO VERDE. ( VYSIS CEP X (DXZ1) SPECTRUMGREEN PROBE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "18322", "subtotal": "18322", "tax": "2931.52", "other_taxes": null, "total": "21253.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "VYSIS CEP 8 (D8Z2) SPECTRUMGREEN PROBE (ASR)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12952", "subtotal": "12952", "tax": "2072.32", "other_taxes": null, "total": "15024.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "VYSIS LSI 1P36 MICRODELETION REGION PROBE (ASR)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20119", "subtotal": "20119", "tax": "3219.04", "other_taxes": null, "total": "23338.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "VYSIS LSI 21 SPECTRUMORANGE PROBE (ASR)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "22182", "subtotal": "22182", "tax": "3549.12", "other_taxes": null, "total": "25731.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO DE GENOTIPADO SNP TAQMAN™, HUMANO. ASSAY ID: C___7911963_10. SNP ID:RS17650792.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "FAST SYBR® GREEN MASTER MIX", "unit": "PIEZA", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "2672", "subtotal": "24048", "tax": "3847.68", "other_taxes": null, "total": "27895.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE AISLAMIENTO DE ARN PICOPURE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10724", "subtotal": "10724", "tax": "1715.84", "other_taxes": null, "total": "12439.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA UNIVERSAL TAQMAN™ II, SIN UNG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "52133", "subtotal": "52133", "tax": "8341.28", "other_taxes": null, "total": "60474.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MICROAMP™ OPTICAL ADHESIVE FILM (96-WELL, STANDARD PLATE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1930", "subtotal": "1930", "tax": "308.8", "other_taxes": null, "total": "2238.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS2393732, GEN ARID5B. ID: C__16006024_20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13284", "subtotal": "13284", "tax": "2125.44", "other_taxes": null, "total": "15409.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS2393782, GEN ARID5B. ID: C__16006107_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13284", "subtotal": "13284", "tax": "2125.44", "other_taxes": null, "total": "15409.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN PRE-DESIGNED SNP GENOTYPING ASSAYS HUMAN. SNP RS4948488, GEN ARID5B. ID: C__26140121_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13284", "subtotal": "13284", "tax": "2125.44", "other_taxes": null, "total": "15409.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN® GENE EXPRESSION ASSAYS ID: RN01461255_M1. GENE: SOX8", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN® GENE EXPRESSION ASSAYS ID: RN01518055_M1. GENE: DICER1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN® GENE EXPRESSION ASSAYS. ID: RN00580551_M1. GENE: RARA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN® GENE EXPRESSION ASSAYS.ID: RN01399560_M1. GENE: RXRB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ ADVANCED, HUMAN MIRNA. ASSAY NAME: HSA-MIR-650. ASSAY ID: 479129_MIR)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6531", "subtotal": "13062", "tax": "2089.92", "other_taxes": null, "total": "15151.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ ENSAYOS DE EXPRESIÓN GÉNICA. TARGET SPECIES: MOUSE. GENE: GAPDH. ASSAY ID: MM99999915_G1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11540", "subtotal": "11540", "tax": "1846.4", "other_taxes": null, "total": "13386.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ ENSAYOS DE EXPRESIÓN GÉNICA. TARGET SPECIES: RAT. GENE: GAPDH. ASSAY ID: RN01775763_G1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11540", "subtotal": "11540", "tax": "1846.4", "other_taxes": null, "total": "13386.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ EXOGENOUS INTERNAL POSITIVE CONTROL REAGENTS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "7997", "subtotal": "39985", "tax": "6397.6", "other_taxes": null, "total": "46382.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM01333430_M1. GENE: VIM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1846", "subtotal": "1846", "tax": "295.36", "other_taxes": null, "total": "2141.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM02019550_S1. GENE:NANOG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1846", "subtotal": "1846", "tax": "295.36", "other_taxes": null, "total": "2141.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSION ASSAYS (FAM). ASSAY ID: MM03053810_S1. GENE: SOX2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1846", "subtotal": "1846", "tax": "295.36", "other_taxes": null, "total": "2141.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID:RN00581867_M1. GENE:DIO2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00441185_M1. GENE: RXRA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00562044_M1. GENE: THRB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00584891_M1. GENE: SLCO1C1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID: RN00596041_M1. GENE: SLC16A2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM), ASSAY ID:RN00568002_S1. GENE: DIO3", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENE EXPRESSIONASSAY (FAM). ASSAY ID: RN01464140_M1. GENE: THRA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4527", "subtotal": "4527", "tax": "724.32", "other_taxes": null, "total": "5251.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS373455425. GENE: XDH. ASSAY ID: C_365253619_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS487121. GENE: MIR924HG. ASSAY ID: C___2313112_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID:RS2236168. GENE: XDH. ASSAY ID: C__26435993_20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS1800566. GENE: NQO1. ASSAY ID: C___2091255_30", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9221", "subtotal": "9221", "tax": "1475.36", "other_taxes": null, "total": "10696.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS2835286. GENE: CBR3-AS1. ASSAY ID: C__16075424_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS3014216. GENE: AKR1A1. ASSAY ID: C__11869471_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING ASSAY SNP ID: RS4987121. GENE: CBR3 ASSAY ID: C__43955396_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7106", "subtotal": "7106", "tax": "1136.96", "other_taxes": null, "total": "8242.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ GENOTYPING MASTER MIX", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2412", "subtotal": "12060", "tax": "1929.6", "other_taxes": null, "total": "13989.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA ASSAY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20074", "subtotal": "20074", "tax": "3211.84", "other_taxes": null, "total": "23285.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA ASSAY. ASSAY ID: 000560. ASSAY NAME: HSA-MIR-372", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5436", "subtotal": "5436", "tax": "869.76", "other_taxes": null, "total": "6305.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA ASSAY. ASSAY ID: 002592. ASSAY NAME:MMU-MIR-291A-3P", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5436", "subtotal": "5436", "tax": "869.76", "other_taxes": null, "total": "6305.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA ASSAYS. ASSAY ID: 001093. ASSAY NAME: RNU6B", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5436", "subtotal": "5436", "tax": "869.76", "other_taxes": null, "total": "6305.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA CONTROL ASSAY. ASSAY ID: 001973. ASSAY NAME: U6 SNRNA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20074", "subtotal": "20074", "tax": "3211.84", "other_taxes": null, "total": "23285.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ MICRORNA REVERSE TRANSCRIPTION KIT", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "9351", "subtotal": "28053", "tax": "4488.48", "other_taxes": null, "total": "32541.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ UNIVERSAL MASTER MIX II, SIN UNG", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11243", "subtotal": "22486", "tax": "3597.76", "other_taxes": null, "total": "26083.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11689", "subtotal": "11689", "tax": "1870.24", "other_taxes": null, "total": "13559.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN™ UNIVERSAL PCR MASTER MIX, 2-PACK (2 X 5 ML), 400 RXN", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "25640", "subtotal": "76920", "tax": "12307.2", "other_taxes": null, "total": "89227.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD™ CYTOMETRIC BEAD ARRAY (CBA) MOUSE TH1/TH2/TH17. KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "27285", "subtotal": "54570", "tax": "8731.2", "other_taxes": null, "total": "63301.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD™ PERCP MOUSE ANTI-HUMAN CD3 (20 µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14857", "subtotal": "14857", "tax": "2377.12", "other_taxes": null, "total": "17234.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD GASPAK EZ CAMPYPAK CONTAINER. SISTEMA Y SUMINISTROS DE GENERACIÓN DE GAS GASPAK™ EZ", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2350", "subtotal": "7050", "tax": "1128", "other_taxes": null, "total": "8178" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI.HUMAN DE RATÓN CD38 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5099", "subtotal": "5099", "tax": "815.84", "other_taxes": null, "total": "5914.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-CXCR5 HUMANO (CD185) DE RATA CON FLUORURO DE BD PHARMINGEN™ ALEXA FLUOR® 647", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7047", "subtotal": "7047", "tax": "1127.52", "other_taxes": null, "total": "8174.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-IGD HUMANA DE RATÓN FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5715", "subtotal": "5715", "tax": "914.4", "other_taxes": null, "total": "6629.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "FITC ANTI-CD127 HUMANO DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5715", "subtotal": "5715", "tax": "914.4", "other_taxes": null, "total": "6629.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE APOPTOSIS, DAÑO AL ADN Y PROLIFERACIÓN CELULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17936", "subtotal": "17936", "tax": "2869.76", "other_taxes": null, "total": "20805.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-CD24 HUMANO DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6937", "subtotal": "6937", "tax": "1109.92", "other_taxes": null, "total": "8046.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE MOUSE ANTI-CD27 HUMANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5508", "subtotal": "5508", "tax": "881.28", "other_taxes": null, "total": "6389.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE MOUSE ANTI-HUMAN CD8", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4079", "subtotal": "4079", "tax": "652.64", "other_taxes": null, "total": "4731.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "PURIFIED RAT ANTIMOUSE CD16/CD32", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3578", "subtotal": "3578", "tax": "572.48", "other_taxes": null, "total": "4150.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN BLOQUEADORA (BLOTTING-GRADE BLOCKER)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1149", "subtotal": "1149", "tax": "183.84", "other_taxes": null, "total": "1332.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLAGENASA, TIPO IV, POLVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6642", "subtotal": "6642", "tax": "1062.72", "other_taxes": null, "total": "7704.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "CTS™ GLUTAMAX™-I SUPPLEMENT (100X)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1336", "subtotal": "4008", "tax": "641.28", "other_taxes": null, "total": "4649.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12, POLVO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1707", "subtotal": "6828", "tax": "1092.48", "other_taxes": null, "total": "7920.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM, ALTO CONTENIDO EN GLUCOSA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "644", "subtotal": "2576", "tax": "412.16", "other_taxes": null, "total": "2988.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM, POLVO, GLUCOSA BAJA, PIRUVATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1077", "subtotal": "1077", "tax": "172.32", "other_taxes": null, "total": "1249.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA TRYPLE EXPRESS (1X), SIN ROJO FENOL", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "726", "subtotal": "7260", "tax": "1161.6", "other_taxes": null, "total": "8421.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN EGF (EPIDERMAL GROWTH FACTOR) RECOMBINANT PROTEIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2709", "subtotal": "2709", "tax": "433.44", "other_taxes": null, "total": "3142.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN EGF RECOMBINANT PROTEIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1044", "subtotal": "1044", "tax": "167.04", "other_taxes": null, "total": "1211.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN IL-1 BETA RECOMBINANT PROTEIN, PEPROTECH®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9907", "subtotal": "9907", "tax": "1585.12", "other_taxes": null, "total": "11492.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN IL-6 RECOMBINANT PROTEIN, PEPROTECH®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12653", "subtotal": "12653", "tax": "2024.48", "other_taxes": null, "total": "14677.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN TNF-ALPHA RECOMBINANT PROTEIN, PEPROTECH®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6327", "subtotal": "6327", "tax": "1012.32", "other_taxes": null, "total": "7339.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTAMINA (200 MM)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "710", "subtotal": "710", "tax": "113.6", "other_taxes": null, "total": "823.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTAMINA (200 MM)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "779", "subtotal": "779", "tax": "124.64", "other_taxes": null, "total": "903.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM/F-12, GLUTAMAX™ SUPPLEMENT", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "1234", "subtotal": "14808", "tax": "2369.28", "other_taxes": null, "total": "17177.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO MCDB131 SIN GLUTAMINA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1448", "subtotal": "4344", "tax": "695.04", "other_taxes": null, "total": "5039.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO RPMI (L-GLUTAMINA Y ROJO FENOL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5566", "subtotal": "11132", "tax": "1781.12", "other_taxes": null, "total": "12913.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "PBS (SOLUCIÓN SALINA TAMPONADA CON FOSFATO), PH 7.4", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "4973", "subtotal": "24865", "tax": "3978.4", "other_taxes": null, "total": "28843.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "PENICILINA-ESTREPTOMICINA (10.000 U/ML)", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "569", "subtotal": "3983", "tax": "637.28", "other_taxes": null, "total": "4620.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEPTONA BACTO™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11058", "subtotal": "11058", "tax": "1769.28", "other_taxes": null, "total": "12827.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE BICARBONATO SÓDICO AL 7,5 %", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "314", "subtotal": "314", "tax": "50.24", "other_taxes": null, "total": "364.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN SALINA EQUILIBRADA DE HANK´S (HBSS, SIN CALCIO, SIN MAGNESIO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "292", "subtotal": "292", "tax": "46.72", "other_taxes": null, "total": "338.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPSINA-EDTA (0,25%), ROJO DE FENOL", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "1104", "subtotal": "8832", "tax": "1413.12", "other_taxes": null, "total": "10245.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "MINISEQ™ MID OUTPUT KIT (300 CYCLES)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16979", "subtotal": "16979", "tax": "2716.64", "other_taxes": null, "total": "19695.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZOL™ REAGENT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8460", "subtotal": "16920", "tax": "2707.2", "other_taxes": null, "total": "19627.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR® 488. DONKEY ANTI-GOAT IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5789", "subtotal": "5789", "tax": "926.24", "other_taxes": null, "total": "6715.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR® PLUS 488. F(AB')2-GOAT ANTI-RABBIT IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5733", "subtotal": "5733", "tax": "917.28", "other_taxes": null, "total": "6650.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL CYP2C11 CONEJO ANTI-FELINO, HUMANO, RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8646", "subtotal": "8646", "tax": "1383.36", "other_taxes": null, "total": "10029.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO RECEPTOR A ANDROGENOS POLICLONAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9184", "subtotal": "9184", "tax": "1469.44", "other_taxes": null, "total": "10653.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ALTAMENTE ADSORBIDO CRUZADO IGG (H+L) ANTI-RATÓN DE CABRA, ALEXA FLUOR™ 594 (2 MG/ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5770", "subtotal": "11540", "tax": "1846.4", "other_taxes": null, "total": "13386.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "BODIPY™ (ÁCIDO UNDECANOICO) 581/591 C11 (SENSOR DE PEROXIDACIÓN DE LÍPIDOS)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3915", "subtotal": "3915", "tax": "626.4", "other_taxes": null, "total": "4541.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYP2J2 CONEJO ANTIHUMANO, RATÓN, RATA, POLICLONAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8423", "subtotal": "8423", "tax": "1347.68", "other_taxes": null, "total": "9770.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "DONKEY ANTI-RABBIT IGG (H+L) ANTICUERPO SECUNDARIO DE ALTA ADSORCIÓN CRUZADA, ALEXA FLUOR™ 488 (2 MG/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5770", "subtotal": "5770", "tax": "923.2", "other_taxes": null, "total": "6693.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "DONKEY ANTI-RABBIT IGG (H+L) HIGHLY CROSS-ADSORBED SECONDARY ANTIBODY, ALEXA FLUOR™ 555", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5900", "subtotal": "5900", "tax": "944", "other_taxes": null, "total": "6844" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-MOUSE IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3730", "subtotal": "3730", "tax": "596.8", "other_taxes": null, "total": "4326.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-MOUSE IGG (H+L) HIGHLY CROSS-ADSORBED SECONDARY ANTIBODY, ALEXA FLUOR™ 488", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5770", "subtotal": "5770", "tax": "923.2", "other_taxes": null, "total": "6693.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "IKB ALPHA MONOCLONAL ANTIBODY (T.937.7)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9722", "subtotal": "9722", "tax": "1555.52", "other_taxes": null, "total": "11277.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "IKK ALPHA RECOMBINANT RABBIT MONOCLONAL ANTIBODY (SN06-99)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8720", "subtotal": "8720", "tax": "1395.2", "other_taxes": null, "total": "10115.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "IKK GAMMA MONOCLONAL ANTIBODY (H.256.9)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9722", "subtotal": "9722", "tax": "1555.52", "other_taxes": null, "total": "11277.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT 1 KB PLUS DNA LADDER (1 KB PLUS DNA LADDERT (1 µG/µL) IN 10 MM TRIS-HCL (PH 7.5), 50 MM NACL, AND 1 MM EDTA)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3822", "subtotal": "11466", "tax": "1834.56", "other_taxes": null, "total": "13300.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA LEPTINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11355", "subtotal": "11355", "tax": "1816.8", "other_taxes": null, "total": "13171.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "LATS2 POLYCLONAL ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8609", "subtotal": "8609", "tax": "1377.44", "other_taxes": null, "total": "9986.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE MONTAJE FLUOROMOUNT-G™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1647", "subtotal": "1647", "tax": "263.52", "other_taxes": null, "total": "1910.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOUSE INSULIN ELISA KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11206", "subtotal": "11206", "tax": "1792.96", "other_taxes": null, "total": "12998.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MULTISCRIBE™ REVERSE TRANSCRIPTASE ( 50 UNITS / µL)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3173", "subtotal": "9519", "tax": "1523.04", "other_taxes": null, "total": "11042.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "NUPAGE® MES SDS RUNNING BUFFER (20X)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2070", "subtotal": "10350", "tax": "1656", "other_taxes": null, "total": "12006" }, { "number": "0", "cucop_code": "25101-0037", "description": "NUPAGE™ DEL 3 AL 8 %, TRIS-ACETATO, 1.0–1.5 MM, MINIGELES DE PROTEÍNA, CON 12 POZOS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3233", "subtotal": "16165", "tax": "2586.4", "other_taxes": null, "total": "18751.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "NUPAGE™ DEL 4 AL 12 %, BIS-TRIS, 1.0–1.5 MM, MINIGELES DE PROTEÍNA, CON 15 POZOS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3233", "subtotal": "16165", "tax": "2586.4", "other_taxes": null, "total": "18751.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "NUPAGE™ TRIS-ACETATE SDS RUNNING BUFFER (20X)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2090", "subtotal": "6270", "tax": "1003.2", "other_taxes": null, "total": "7273.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHASEMAKER™ TUBOS (CONTIENEN UN POLÍMERO LÍQUIDO GRUESO QUE SEPARA Y AÍSLA COMPLETAMENTE LA FASE ACUOSA SUPERIOR DE LA MEZCLA DE REACTIVOS TRIZOL® DE LA FASE ORGÁNICA INFERIOR, SIMPLIFICANDO EN GRAN MEDIDA LA ELIMINACIÓN DE LA FASE SUPERIOR QUE CONTIENE EL ARN)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2301", "subtotal": "2301", "tax": "368.16", "other_taxes": null, "total": "2669.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE™ 3000", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1624", "subtotal": "1624", "tax": "259.84", "other_taxes": null, "total": "1883.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAP (SLAM ASSOCIATED PROTEIN) MONOCLONAL ANTIBODY (XLP-1D12) PE, EBIOSCIENCE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8460", "subtotal": "8460", "tax": "1353.6", "other_taxes": null, "total": "9813.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA DE RT-PCR SUPERSCRIPT™ III DE UN PASO CON ADN POLIMERASA PLATINUM™ TAQ", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "18330", "subtotal": "18330", "tax": "2932.8", "other_taxes": null, "total": "21262.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE ESTABILIZACIÓN RNALATER™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11021", "subtotal": "11021", "tax": "1763.36", "other_taxes": null, "total": "12784.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAMPÓN DE LAVADO EBIOSCIENCE™ 20X TBS PARA IHC/ICC", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2078", "subtotal": "4156", "tax": "664.96", "other_taxes": null, "total": "4820.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAMPÓN DE TRANSFERENCIA NUPAGE™ (20X)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4063", "subtotal": "4063", "tax": "650.08", "other_taxes": null, "total": "4713.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA SIN NUCLEASAS (NO TRATADA CON DEPC)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4824", "subtotal": "14472", "tax": "2315.52", "other_taxes": null, "total": "16787.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "MICROBEXPRESS™ BACTERIAL MRNA ENRICHMENT KIT", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "13024", "subtotal": "39072", "tax": "6251.52", "other_taxes": null, "total": "45323.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIOFILCHEM™ MTS™ LEVOFLOXACIN [LEV] 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIOFILCHEM™ MTS™ METRONIDAZOLE [MTZ] 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA AMIKACIN [AK] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA AZTREONAM [ATM] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA CEFEPIME [FEP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA CEFTAZIDIME [CAZ] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA MEROPENEM [MRP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA CEFTAZIDIME - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA COLISTIN [CS] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA PIPERACILLIN [PIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA PIPERACILLIN-TAZOBACTAM [TZP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA TICARCILLIN-CLAVULANIC ACID [TTC] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/2-256/2 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA TOBRAMYCIN [TOB] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3051", "subtotal": "6102", "tax": "976.32", "other_taxes": null, "total": "7078.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "GENTRA PUREGENE BLOOD KIT (120 ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8662", "subtotal": "17324", "tax": "2771.84", "other_taxes": null, "total": "20095.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ADN QIAAMP POWERFECAL PRO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9342", "subtotal": "18684", "tax": "2989.44", "other_taxes": null, "total": "21673.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "QIAAMP DNA MICROBIOME KIT (50)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13868", "subtotal": "13868", "tax": "2218.88", "other_taxes": null, "total": "16086.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "TINTE DE CARGA DE ADN GELPILOT, COLORANTE DE CARGA DE ADN GELPILOT, 5X (6 X 500 µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1428", "subtotal": "1428", "tax": "228.48", "other_taxes": null, "total": "1656.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "GENTRA® PUREGENE® BUCCAL CELL KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6003", "subtotal": "6003", "tax": "960.48", "other_taxes": null, "total": "6963.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA EXTRACCIÓN DE DNA A PARTIR DE GEL. COLUMNAS CON MEMBRANAS DE SILICA PARA PURIFICACIÓN DE FRAGMENTOS DE DNA A PARTIR DE GEL. FRAGMENTOS 70PB-10 KB. RENDIMIENTO >95%. VOLUMEN DE ELUÍDO 30-50 UL. CON INDICADOR DE PH.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14634", "subtotal": "14634", "tax": "2341.44", "other_taxes": null, "total": "16975.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT QIAGEN ONESTEP RT-PCR (100)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15105", "subtotal": "15105", "tax": "2416.8", "other_taxes": null, "total": "17521.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT QIAPREP 2.0 SPIN MINIPREP (100 COLUMNAS DE CENTRIFUGADO)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2277", "subtotal": "6831", "tax": "1092.96", "other_taxes": null, "total": "7923.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MIRNEASY MICRO KIT (50)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10996", "subtotal": "10996", "tax": "1759.36", "other_taxes": null, "total": "12755.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "PUREGENE® SOLUCIÓN DE PRECIPITACIÓN DE PROTEÍNAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "12189", "subtotal": "60945", "tax": "9751.2", "other_taxes": null, "total": "70696.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "QIACUITY EG PCR KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16045", "subtotal": "16045", "tax": "2567.2", "other_taxes": null, "total": "18612.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "QIACUITY PROBE PCR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24203", "subtotal": "24203", "tax": "3872.48", "other_taxes": null, "total": "28075.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "RNASE A (17,500 U). VIAL CON 2.5 ML (100 MG/ML; 7000 UNIDADES/ML, SOLUCIÓN)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7172", "subtotal": "14344", "tax": "2295.04", "other_taxes": null, "total": "16639.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHORBOL 12-MYRISTATE 13-ACETATE (PKC PATHWAY ACTIVATOR; ACTIVATES PROTEIN KINASE C)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8105", "subtotal": "8105", "tax": "1296.8", "other_taxes": null, "total": "9401.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNASE I (RNASE-FREE)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5436", "subtotal": "16308", "tax": "2609.28", "other_taxes": null, "total": "18917.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MIRVANA® MIRNA INHIBITOR. ASSAY ID: MH10165. ASSAY NAME: HSA-MIR-372-3P", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20853", "subtotal": "20853", "tax": "3336.48", "other_taxes": null, "total": "24189.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "MIRVANA® MIRNA MIMIC. ASSAY NAME: HSA-MIR-372-3P. ASSAY ID: MC10165. ESPECIE: HUMAN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20891", "subtotal": "20891", "tax": "3342.56", "other_taxes": null, "total": "24233.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEPC-TREATED WATER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2858", "subtotal": "2858", "tax": "457.28", "other_taxes": null, "total": "3315.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNTP MIX (10 MM EA)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2653", "subtotal": "5306", "tax": "848.96", "other_taxes": null, "total": "6154.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "INSULIN RAT ELISA KIT PARA 96 PRUEBAS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11726", "subtotal": "11726", "tax": "1876.16", "other_taxes": null, "total": "13602.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "TOTAL REACTIVE OXYGEN SPECIES (ROS) ASSAY KIT 520 NM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6883", "subtotal": "6883", "tax": "1101.28", "other_taxes": null, "total": "7984.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "BAMHI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1531", "subtotal": "1531", "tax": "244.96", "other_taxes": null, "total": "1775.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN FASTDIGEST XBAI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1030", "subtotal": "1030", "tax": "164.8", "other_taxes": null, "total": "1194.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER™ PLUS, DE 10 A 250 KDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3507", "subtotal": "3507", "tax": "561.12", "other_taxes": null, "total": "4068.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTREPTAVIDINA AGAROSA PIERCE™ DE ALTA CAPACIDAD", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11614", "subtotal": "11614", "tax": "1858.24", "other_taxes": null, "total": "13472.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "FASTDIGEST NDEI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3117", "subtotal": "3117", "tax": "498.72", "other_taxes": null, "total": "3615.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCÓGENO, GRADO DE BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1666", "subtotal": "3332", "tax": "533.12", "other_taxes": null, "total": "3865.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "PMSF ( INHIBIDOR DE PROTEASA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2041", "subtotal": "2041", "tax": "326.56", "other_taxes": null, "total": "2367.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PONCEAU S STAINING SOLUTION", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1392", "subtotal": "1392", "tax": "222.72", "other_taxes": null, "total": "1614.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFO-NHS-LC-BIOTINA EZ-LINK™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6772", "subtotal": "6772", "tax": "1083.52", "other_taxes": null, "total": "7855.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL™ WEST FEMTO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13247", "subtotal": "13247", "tax": "2119.52", "other_taxes": null, "total": "15366.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAMPÓN DE LAVADO DE INMUNOTRANSFERENCIA (WESTERN BLOT) RESTORE™ PLUS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3692", "subtotal": "3692", "tax": "590.72", "other_taxes": null, "total": "4282.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA DNA 50 BP", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2468", "subtotal": "4936", "tax": "789.76", "other_taxes": null, "total": "5725.76" } ] }, { "id": "C-2025-00023496", "internal_reference": "AD-442/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "normalized_name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "rfc_type": null }, "contract_period": { "published_at": "2025-03-14T16:38:25.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1237280", "tax": "197964.8", "total": "1435244.8", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "LYMPHOPREP™", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7200", "subtotal": "14400", "tax": "2304", "other_taxes": null, "total": "16704" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO CLÁSICO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "7900", "subtotal": "39500", "tax": "6320", "other_taxes": null, "total": "45820" }, { "number": "0", "cucop_code": "25101-0037", "description": "IMMUNODNA RETRIVER 20X WITH CITRATE", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "6900", "subtotal": "27600", "tax": "4416", "other_taxes": null, "total": "32016" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE TINCIÓN FLUORO-JADE® C RTDTM®", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "17300", "subtotal": "34600", "tax": "5536", "other_taxes": null, "total": "40136" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL XIAP CONJUGADO CON FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13400", "subtotal": "13400", "tax": "2144", "other_taxes": null, "total": "15544" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA MEDICIÓN DE T3 EN SUERO DE RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15600", "subtotal": "15600", "tax": "2496", "other_taxes": null, "total": "18096" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA MEDICIÓN DE T4 EN SUERO DE RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15600", "subtotal": "15600", "tax": "2496", "other_taxes": null, "total": "18096" }, { "number": "0", "cucop_code": "25101-0037", "description": "20-HETE (20-HYDROXY ARACHIDONIC ACID)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16900", "subtotal": "16900", "tax": "2704", "other_taxes": null, "total": "19604" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ENSAYO DE PROLIFERACIÓN CELULAR MTT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2950", "subtotal": "2950", "tax": "472", "other_taxes": null, "total": "3422" }, { "number": "0", "cucop_code": "25101-0037", "description": "WST-1 CELL PROLIFERATION ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3250", "subtotal": "3250", "tax": "520", "other_taxes": null, "total": "3770" }, { "number": "0", "cucop_code": "25101-0037", "description": "FACTOR DE CRECIMIENTO DE FIBROBLASTOS HUMANO BÁSICO 154", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2250", "subtotal": "2250", "tax": "360", "other_taxes": null, "total": "2610" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUAVA® ANNEXIN RED KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14390", "subtotal": "28780", "tax": "4604.8", "other_taxes": null, "total": "33384.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUAVA® EASYCHECK™ KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11890", "subtotal": "23780", "tax": "3804.8", "other_taxes": null, "total": "27584.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUAVA® INSTRUMENT CLEANING FLUID (ICF)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1600", "subtotal": "3200", "tax": "512", "other_taxes": null, "total": "3712" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE DETECCIÓN DE TRANSFERENCIA WESTERN AMERSHAM™ ECL™ PRIME", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7990", "subtotal": "7990", "tax": "1278.4", "other_taxes": null, "total": "9268.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DETERMINACIÓN ESTRADIOL 96 POZOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7000", "subtotal": "14000", "tax": "2240", "other_taxes": null, "total": "16240" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DETERMINACIÓN TESTOSTERONA 96 POZOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7000", "subtotal": "14000", "tax": "2240", "other_taxes": null, "total": "16240" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOSEAL 60 (MEDIO DE MONTAJE)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "850", "subtotal": "1700", "tax": "272", "other_taxes": null, "total": "1972" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 10%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLY-L-LYSINE SOLUTION 0.1% DE SOLUCIÓN ACUOSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6700", "subtotal": "6700", "tax": "1072", "other_taxes": null, "total": "7772" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-BETA TUBULIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-IKK BETA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10490", "subtotal": "20980", "tax": "3356.8", "other_taxes": null, "total": "24336.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-IL1 BETA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10750", "subtotal": "10750", "tax": "1720", "other_taxes": null, "total": "12470" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-IL6", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-LAMIN B1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-TNF ALPHA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PPAR ALPHA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PPAR GAMMA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "HISTONE H3K4ME3 (TRI-METHYL LYS4) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4250", "subtotal": "4250", "tax": "680", "other_taxes": null, "total": "4930" }, { "number": "0", "cucop_code": "25101-0037", "description": "IKB BETA ANTIBODY [7B4]", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KEAP1 ANTIBODY [1F10B6]", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "NFKB P65 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "NRF2 ANTIBODY [N2C2], INTERNAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10490", "subtotal": "10490", "tax": "1678.4", "other_taxes": null, "total": "12168.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "PSD95 ANTIBODY [7E3-1B8]", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8500", "subtotal": "8500", "tax": "1360", "other_taxes": null, "total": "9860" }, { "number": "0", "cucop_code": "25101-0037", "description": "MONUSULFATO DE KANAMICINA, GRADO USP, FORMULA: C18H36N4O11 · H2SO4, MW: 582.58 G/MOL, ACTIVIDAD: ~800 µG/MG.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3190", "subtotal": "3190", "tax": "510.4", "other_taxes": null, "total": "3700.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIMOUSE IGG ESPECÍFICO PARA FCGAMMA SUBLASE 2C PEROXIDASE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7500", "subtotal": "7500", "tax": "1200", "other_taxes": null, "total": "8700" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASA AFFINIPURE CABRA ANTI-RATÓN IGG (H+L). (MIN X HU, BOV, HRS SR PROT)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4300", "subtotal": "4300", "tax": "688", "other_taxes": null, "total": "4988" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASE AFFINITPURE GOAT ANTI-MOUSE IGG, FCGAMMA SUBCLASS 1 SPECIFIC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7500", "subtotal": "7500", "tax": "1200", "other_taxes": null, "total": "8700" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO DE BURRO NORMAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1800", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25101-0037", "description": "CALDO MUELLER HINTON AJUSTADO CON CATIONES", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4220", "subtotal": "8440", "tax": "1350.4", "other_taxes": null, "total": "9790.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIOFILCHEM™ MTS™ AMOXICILLIN [AML] 0.016-256 µG/ML. MIC TEST STRIP 30 TIRAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3190", "subtotal": "6380", "tax": "1020.8", "other_taxes": null, "total": "7400.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIOFILCHEM™ MTS™ CLARITHROMYCIN [CLR] 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3190", "subtotal": "6380", "tax": "1020.8", "other_taxes": null, "total": "7400.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA IMIPENEM - RELEBACTAM [I/R] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002/4-32/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3190", "subtotal": "6380", "tax": "1020.8", "other_taxes": null, "total": "7400.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA CIPROFLOXACIN [CIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3190", "subtotal": "6380", "tax": "1020.8", "other_taxes": null, "total": "7400.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIRA DE PRUEBA IMIPENEM [IMI] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3190", "subtotal": "6380", "tax": "1020.8", "other_taxes": null, "total": "7400.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "CEFIDEROCOL FDC 30 µG. DISCO DE ANTIBIÓTICO EN CARTUCHO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3190", "subtotal": "3190", "tax": "510.4", "other_taxes": null, "total": "3700.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IL-21 MAB (MT21.3M), BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9800", "subtotal": "9800", "tax": "1568", "other_taxes": null, "total": "11368" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IL-23 (P19) MAB (MT155), BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9800", "subtotal": "9800", "tax": "1568", "other_taxes": null, "total": "11368" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL, ANHIDRO, REACTIVO ACS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3700", "subtotal": "7400", "tax": "1184", "other_taxes": null, "total": "8584" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROFOMO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3250", "subtotal": "3250", "tax": "520", "other_taxes": null, "total": "3770" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROFORMO GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2700", "subtotal": "2700", "tax": "432", "other_taxes": null, "total": "3132" }, { "number": "0", "cucop_code": "25101-0037", "description": "(-)-EPIGALLOCATECHIN GALLATE, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4400", "subtotal": "4400", "tax": "704", "other_taxes": null, "total": "5104" }, { "number": "0", "cucop_code": "25101-0037", "description": "6-SHOGAOL, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7500", "subtotal": "7500", "tax": "1200", "other_taxes": null, "total": "8700" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMG-510, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5600", "subtotal": "5600", "tax": "896", "other_taxes": null, "total": "6496" }, { "number": "0", "cucop_code": "25101-0037", "description": "BAICALEIN, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4600", "subtotal": "4600", "tax": "736", "other_taxes": null, "total": "5336" }, { "number": "0", "cucop_code": "25101-0037", "description": "DOXORUBICIN, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4000", "subtotal": "4000", "tax": "640", "other_taxes": null, "total": "4640" }, { "number": "0", "cucop_code": "25101-0037", "description": "GINGEROL, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5400", "subtotal": "5400", "tax": "864", "other_taxes": null, "total": "6264" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOSSYPOL, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5300", "subtotal": "5300", "tax": "848", "other_taxes": null, "total": "6148" }, { "number": "0", "cucop_code": "25101-0037", "description": "HK ASSAY KIT :: HEXOKINASE (HK) ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12700", "subtotal": "12700", "tax": "2032", "other_taxes": null, "total": "14732" }, { "number": "0", "cucop_code": "25101-0037", "description": "MELATONIN, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4400", "subtotal": "4400", "tax": "704", "other_taxes": null, "total": "5104" }, { "number": "0", "cucop_code": "25101-0037", "description": "PFK15, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8100", "subtotal": "8100", "tax": "1296", "other_taxes": null, "total": "9396" }, { "number": "0", "cucop_code": "25101-0037", "description": "SILIBININ (SILYBIN), INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4400", "subtotal": "4400", "tax": "704", "other_taxes": null, "total": "5104" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFORAPHANE, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8500", "subtotal": "8500", "tax": "1360", "other_taxes": null, "total": "9860" }, { "number": "0", "cucop_code": "25101-0037", "description": "Z-RR-AMC, PEPTIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26500", "subtotal": "26500", "tax": "4240", "other_taxes": null, "total": "30740" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT UNIVERSAL PARA PATÓGENOS EZNA®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7100", "subtotal": "7100", "tax": "1136", "other_taxes": null, "total": "8236" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE RECOLECCIÓN DE ADN EN SALIVA (TUBO PARA MUESTRA DE SALIVA Y ESPONJAS ABSORBENTES)", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "950", "subtotal": "14250", "tax": "2280", "other_taxes": null, "total": "16530" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAT IL-6 ELISA KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "20990", "subtotal": "41980", "tax": "6716.8", "other_taxes": null, "total": "48696.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELDA DE FLUJO DE RNA MINION Y GRIDION", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "21300", "subtotal": "63900", "tax": "10224", "other_taxes": null, "total": "74124" }, { "number": "0", "cucop_code": "25101-0037", "description": "NATIVE BARCODING KIT 24 V14", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21200", "subtotal": "21200", "tax": "3392", "other_taxes": null, "total": "24592" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELDAS DE FLUJO R10.4.1 PARA DISPOSITIVOS MINION™ Y GRIDION™", "unit": "PIEZA", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "21300", "subtotal": "191700", "tax": "30672", "other_taxes": null, "total": "222372" }, { "number": "0", "cucop_code": "25101-0037", "description": "CONTROL EXPANSION KITS DE SECUENCIACIÓN DE ADN LAMBDA (LMD)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1850", "subtotal": "5550", "tax": "888", "other_taxes": null, "total": "6438" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLOW CELL WASH KIT (KIT DE LAVADO DE CELDAS DE FLUJO MINION™ Y PROMETHION™.)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3000", "subtotal": "9000", "tax": "1440", "other_taxes": null, "total": "10440" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE SECUENCIACIÓN RÁPIDA DE ADN - V14 V14 (SQK-RBK114.24)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "21200", "subtotal": "42400", "tax": "6784", "other_taxes": null, "total": "49184" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAPID ADAPTER AUXILIARY V14", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8750", "subtotal": "17500", "tax": "2800", "other_taxes": null, "total": "20300" }, { "number": "0", "cucop_code": "25101-0037", "description": "SEQUENCING AUXILIARY VIALS (VIALES AUXILIARES DE SECUENCIACIÓN V14)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3000", "subtotal": "6000", "tax": "960", "other_taxes": null, "total": "6960" }, { "number": "0", "cucop_code": "25101-0037", "description": "TISSUE-TEK® O.C.T.™ COMPOUND", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "900", "subtotal": "5400", "tax": "864", "other_taxes": null, "total": "6264" }, { "number": "0", "cucop_code": "25101-0037", "description": "RUXOLITINIB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10100", "subtotal": "10100", "tax": "1616", "other_taxes": null, "total": "11716" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 11A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 15B", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 18C", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 19A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 22F", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACARIDO CAPSULAR DE NEUMOCOCO SEROTIPO 4", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11200", "subtotal": "22400", "tax": "3584", "other_taxes": null, "total": "25984" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 6A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACÁRIDO CAPSULAR DE NEUMOCOCO SEROTIPO 8", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11200", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLISACARIDO CAPSULAR DE NEUMOCOCO SEROTIPO 9V", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11200", "subtotal": "22400", "tax": "3584", "other_taxes": null, "total": "25984" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT EPON", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "9600", "subtotal": "28800", "tax": "4608", "other_taxes": null, "total": "33408" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLIFENACIN SUCCINATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2150", "subtotal": "2150", "tax": "344", "other_taxes": null, "total": "2494" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO HRP MOUSE ANTI GOAT IGG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8100", "subtotal": "8100", "tax": "1296", "other_taxes": null, "total": "9396" } ] }, { "id": "C-2025-00022757", "internal_reference": "AD-443/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2025-03-13T22:06:43.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "67206.2", "tax": "10752.96", "total": "77959.16", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "HYCLONE™ DULBECCO'S MODIFIED EAGLE MEDIUM (DMEM) WITH HIGH GLUCOSE: POWDER", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "662.76", "subtotal": "1325.52", "tax": "212.08", "other_taxes": null, "total": "1537.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "HYCLONE™ RPMI 1640, WITH L-GLUTAMINE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "662.76", "subtotal": "1325.52", "tax": "212.08", "other_taxes": null, "total": "1537.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTAMINA, SOLUCIÓN 200 MM (29,2 MG/ML DE GLUTAMINA EN NACL AL 0,85 %)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "256.52", "subtotal": "256.52", "tax": "41.04", "other_taxes": null, "total": "297.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "BILIS DE BUEY. ELABORADA BAJO PROCESO DE BAJAS TEMPERATURAS Y DESHIDRATACIÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1824.48", "subtotal": "1824.48", "tax": "291.91", "other_taxes": null, "total": "2116.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEADEND™ FLUOROMETRIC TUNEL SYSTEM", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "18024", "subtotal": "36048", "tax": "5767.68", "other_taxes": null, "total": "41815.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOTAQ® DNA POLYMERASE. TAQ POLIMERASA SUMINISTRADA A UNA CONCENTRACIÓN DE 5U/µL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1041.92", "subtotal": "3125.76", "tax": "500.12", "other_taxes": null, "total": "3625.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOTAQ® GREEN MASTER MIX. MEZCLA MASTERMIX PARA LA ACTIVIDAD DE DNA POLIMERASA GO TAQ ( DNA POLIMERASA, DNTPS, MGCL2 Y BUFFERS DE REACCIÓN ÓPTIMOS)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1361.92", "subtotal": "8171.52", "tax": "1307.44", "other_taxes": null, "total": "9478.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEINASA K (LIOFILIZADA)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3148.8", "subtotal": "12595.2", "tax": "2015.23", "other_taxes": null, "total": "14610.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "X-GAL (5-BROMO-4-CLORO-3-INDOLIL-?- D - GALACTOPIRANÓSIDO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2533.68", "subtotal": "2533.68", "tax": "405.38", "other_taxes": null, "total": "2939.06" } ] }, { "id": "C-2025-00023481", "internal_reference": "AD-444/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "STANDARDTEST SA DE CV", "normalized_name": "STANDARDTEST", "rfc_type": null, "slug": "standardtest" }, "contract_period": { "published_at": "2025-03-14T16:33:13.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "697065.9", "tax": "111530.39", "total": "808596.29", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-BETA ACTINA [SP124]", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11510.4", "subtotal": "23020.8", "tax": "3683.32", "other_taxes": null, "total": "26704.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-FOSFOSERINA [B106.1]", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11366.52", "subtotal": "11366.52", "tax": "1818.64", "other_taxes": null, "total": "13185.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HISTONA H3: MARCADOR NUCLEAR Y GRADO CHIP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11366.52", "subtotal": "11366.52", "tax": "1818.64", "other_taxes": null, "total": "13185.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-REELIN [G10]. MONOCLONAL DE RATÓN [G10] A REELIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12229.8", "subtotal": "12229.8", "tax": "1956.76", "other_taxes": null, "total": "14186.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-STRA8", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16402.32", "subtotal": "16402.32", "tax": "2624.37", "other_taxes": null, "total": "19026.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL DE CONEJO RFP CONJUGADO CON BIOTINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13093.08", "subtotal": "13093.08", "tax": "2094.89", "other_taxes": null, "total": "15187.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO RECOMBINANTE ANTI-TRANSPORTADOR DE GLUCOSA GLUT2", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "16402.32", "subtotal": "82011.6", "tax": "13121.85", "other_taxes": null, "total": "95133.45" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-DOUBLECORTIN ANTOBODY", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "14963.52", "subtotal": "44890.56", "tax": "7182.48", "other_taxes": null, "total": "52073.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-GLUCAGON ANTIBODY [K79BB10]", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "16546.2", "subtotal": "66184.8", "tax": "10589.56", "other_taxes": null, "total": "76774.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "BRDU (5-BROMO-2'-DEOXYURIDINE), THYMIDINE ANALOG", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "15539.04", "subtotal": "31078.08", "tax": "4972.49", "other_taxes": null, "total": "36050.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "CASPASE-3, CASPASE-8 AND CASPASE-9 MULTIPLEX ACTIVITY ASSAY KIT (FLUOROMETRIC)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21438.12", "subtotal": "21438.12", "tax": "3430.09", "other_taxes": null, "total": "24868.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELL CYCLE ASSAY KIT (FLUOROMETRIC - GREEN) (AB112116)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11222.64", "subtotal": "11222.64", "tax": "1795.62", "other_taxes": null, "total": "13018.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "CONJUGADO ANTI IGG DE RATÓN EN CABRA (ALEXA FLUOR 488)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3165.36", "subtotal": "6330.72", "tax": "1012.91", "other_taxes": null, "total": "7343.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUOROSHIELD MOUNTING MEDIUM WITH DAPI", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2877.6", "subtotal": "11510.4", "tax": "1841.66", "other_taxes": null, "total": "13352.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCOSE ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15251.28", "subtotal": "15251.28", "tax": "2440.2", "other_taxes": null, "total": "17691.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-RABBIT IGG H&L (HRP)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6042.96", "subtotal": "12085.92", "tax": "1933.74", "other_taxes": null, "total": "14019.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOCITRATE DEHYDROGENASE ASSAY KIT (COLORIMETRIC)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15107.4", "subtotal": "15107.4", "tax": "2417.18", "other_taxes": null, "total": "17524.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE TINCIÓN NUCLEAR/NUCLEAR: FLUORESCENCIA VERDE/ROJA - CYTOPAINTER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10934.88", "subtotal": "10934.88", "tax": "1749.58", "other_taxes": null, "total": "12684.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "RABBIT ANTI-MOUSE IGG H&L (HRP)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6042.96", "subtotal": "18128.88", "tax": "2900.62", "other_taxes": null, "total": "21029.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "RABBIT IGG, MONOCLONAL [EPR25A] - ISOTYPE CONTROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9064.44", "subtotal": "9064.44", "tax": "1450.31", "other_taxes": null, "total": "10514.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "KAPA SYBR® FAST ONE-STEP. QRT-PCR KITS - 100 X 20 µL REACTIONS (UNIVERSAL)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3982.86", "subtotal": "11948.58", "tax": "1911.77", "other_taxes": null, "total": "13860.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "PWO SUPERYIELD DNA POLYMERASE 5 U/UL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16193.04", "subtotal": "16193.04", "tax": "2590.88", "other_taxes": null, "total": "18783.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL TRIPÁN SOLUCIÓN DE 0.4%, LÍQUIDO, FILTRADO ESTÉRIL, ADECUADO PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "960.29", "subtotal": "2880.87", "tax": "460.93", "other_taxes": null, "total": "3341.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICARBONATO DE SODIO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1369.04", "subtotal": "2738.08", "tax": "438.09", "other_taxes": null, "total": "3176.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "COENZYME B12", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "24692.86", "subtotal": "49385.72", "tax": "7901.71", "other_taxes": null, "total": "57287.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-2-HYDROXYGLUTARATE DEHYDROGENASE (D2HGDH) FROM ACIDAMINOCOCCUS FERMENTANS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11113.64", "subtotal": "11113.64", "tax": "1778.18", "other_taxes": null, "total": "12891.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "DCPIP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7075.19", "subtotal": "7075.19", "tax": "1132.03", "other_taxes": null, "total": "8207.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUOLINK® IN SITU PLA® SONDA ANTI-CONEJO MINUS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13217.34", "subtotal": "26434.68", "tax": "4229.54", "other_taxes": null, "total": "30664.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUOLINK® IN SITU PLA® SONDA ANTI-RATÓN PLUS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13217.34", "subtotal": "26434.68", "tax": "4229.54", "other_taxes": null, "total": "30664.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "LURIA AGAR BASE, MILLER", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5560.09", "subtotal": "11120.18", "tax": "1779.22", "other_taxes": null, "total": "12899.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "MUELLER HINTON BROTH, APTA PARA MICROBIOLOGÍA. NUTRISELECT® PLUS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1074.74", "subtotal": "3224.22", "tax": "515.87", "other_taxes": null, "total": "3740.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "RABBIT ANTI-ARID4B ANTIBODY, AFFINITY PURIFIED", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11125.63", "subtotal": "11125.63", "tax": "1780.1", "other_taxes": null, "total": "12905.73" }, { "number": "0", "cucop_code": "25101-0037", "description": "RESORUFIN ETHYL ETER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "49513.25", "subtotal": "49513.25", "tax": "7922.12", "other_taxes": null, "total": "57435.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAL DE ACETATO DE LEUPROLIDA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12579.69", "subtotal": "25159.38", "tax": "4025.5", "other_taxes": null, "total": "29184.88" } ] }, { "id": "C-2025-00026570", "internal_reference": "AD-445/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "QUIMICA VALANER SA DE CV", "normalized_name": "QUIMICA VALANER", "rfc_type": null, "slug": "quimica-valaner" }, "contract_period": { "published_at": "2025-03-24T16:19:30.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "432480.75", "tax": "69196.72", "total": "501677.47", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BETA ACTINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9783.34", "subtotal": "9783.34", "tax": "1565.33", "other_taxes": null, "total": "11348.67" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FOSFO-JAK1 (TYR1034/1035)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11414.33", "subtotal": "11414.33", "tax": "1826.29", "other_taxes": null, "total": "13240.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FOSFO-JAK2 (TYR1007/1008)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11413.9", "subtotal": "11413.9", "tax": "1826.22", "other_taxes": null, "total": "13240.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FOSFO-P44/42 MAPK (ERK1/2) (THR202/TYR204)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11413.9", "subtotal": "11413.9", "tax": "1826.22", "other_taxes": null, "total": "13240.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FOSFO-STAT3 (TYR705)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11413.9", "subtotal": "11413.9", "tax": "1826.22", "other_taxes": null, "total": "13240.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FOSFO-STAT5 (TYR694)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11413.9", "subtotal": "11413.9", "tax": "1826.22", "other_taxes": null, "total": "13240.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO JAK1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9783.34", "subtotal": "9783.34", "tax": "1565.33", "other_taxes": null, "total": "11348.67" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-MOUSE IGG HRP- LINKED ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6266.45", "subtotal": "6266.45", "tax": "1002.63", "other_taxes": null, "total": "7269.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-RABBIT IGG (H+L), F(AB')2 FRAGMENT (ALEXA FLUOR® 488 CONJUGATE)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7161.66", "subtotal": "14323.32", "tax": "2291.73", "other_taxes": null, "total": "16615.05" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-RABBIT IGG, HRP-LINKED ANTIBODY", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6266.45", "subtotal": "18799.35", "tax": "3007.89", "other_taxes": null, "total": "21807.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "E-CADHERIN (24E10) RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10838.41", "subtotal": "10838.41", "tax": "1734.14", "other_taxes": null, "total": "12572.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "FANCA (D1L2Z) RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12756.71", "subtotal": "12756.71", "tax": "2041.07", "other_taxes": null, "total": "14797.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "INSULIN (L6B10) MOUSE MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10742.49", "subtotal": "10742.49", "tax": "1718.79", "other_taxes": null, "total": "12461.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "JAK2 (D2E12) XP® RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11861.5", "subtotal": "11861.5", "tax": "1897.84", "other_taxes": null, "total": "13759.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHOSPHO-TFEB (SER122) (E9M5M) RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12820.65", "subtotal": "12820.65", "tax": "2051.3", "other_taxes": null, "total": "14871.95" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEASE/PHOSPHATASE INHIBITOR COCKTAIL (100X)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10422.77", "subtotal": "10422.77", "tax": "1667.64", "other_taxes": null, "total": "12090.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "STAT5 (D2O6Y) RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10838.41", "subtotal": "10838.41", "tax": "1734.14", "other_taxes": null, "total": "12572.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS BUFFERED SALINE (TBS-10X)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2365.91", "subtotal": "2365.91", "tax": "378.54", "other_taxes": null, "total": "2744.45" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT NEONATAL T4 FEIA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "35568", "subtotal": "35568", "tax": "5690.88", "other_taxes": null, "total": "41258.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA CUANTIFICACIÓN NEONATAL HTSH FEIA PLUS, EN MICROPLACA DE LA HORMONA ESTIMULANTE DE LA TIROIDES TIROTROFINA (TSH) EN SANGRE TOTAL DE NEONATOS COLECTADA EN PAPEL FILTRO CON CALIBRADORES Y CONTROLES INTERNOS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "38900", "subtotal": "38900", "tax": "6224", "other_taxes": null, "total": "45124" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCION ALWI (CONCENTRACIÓN: 10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2535.92", "subtotal": "2535.92", "tax": "405.74", "other_taxes": null, "total": "2941.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN AVA I CONCENTRACIÓN (10,000 UNITS/ML )", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2438.38", "subtotal": "2438.38", "tax": "390.14", "other_taxes": null, "total": "2828.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HAEII CONCENTRACIÓN (20,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2340.85", "subtotal": "2340.85", "tax": "374.53", "other_taxes": null, "total": "2715.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN MBOI (500 UNIDADES)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2698.48", "subtotal": "2698.48", "tax": "431.75", "other_taxes": null, "total": "3130.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN MSPA1I KIT (10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10826.42", "subtotal": "10826.42", "tax": "1732.22", "other_taxes": null, "total": "12558.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCION NLAIII. CONCENTRACIÓN:10.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10501.3", "subtotal": "10501.3", "tax": "1680.2", "other_taxes": null, "total": "12181.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN SCRFI (1000 UNIDADES)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2535.92", "subtotal": "2535.92", "tax": "405.74", "other_taxes": null, "total": "2941.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMAS DE RESTRICCIÓN SAU96I (CONCENTRACIÓN 5,000 U/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2373.36", "subtotal": "2373.36", "tax": "379.73", "other_taxes": null, "total": "2753.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "MONARCH® SPIN GDNA EXTRACTION KIT", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "14597.78", "subtotal": "58391.12", "tax": "9342.57", "other_taxes": null, "total": "67733.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "CHITIN RESI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4616.67", "subtotal": "4616.67", "tax": "738.66", "other_taxes": null, "total": "5355.33" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN AFLII (20,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2438.38", "subtotal": "2438.38", "tax": "390.14", "other_taxes": null, "total": "2828.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN BSMAI (5,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2535.92", "subtotal": "2535.92", "tax": "405.74", "other_taxes": null, "total": "2941.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN BSTUI (10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2340.85", "subtotal": "2340.85", "tax": "374.53", "other_taxes": null, "total": "2715.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN DDEI (10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2535.92", "subtotal": "2535.92", "tax": "405.74", "other_taxes": null, "total": "2941.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HAEIII (10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2373.36", "subtotal": "2373.36", "tax": "379.73", "other_taxes": null, "total": "2753.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HHAI (20,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2275.82", "subtotal": "2275.82", "tax": "364.13", "other_taxes": null, "total": "2639.95" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN MFEI-HF® (20,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2698.48", "subtotal": "2698.48", "tax": "431.75", "other_taxes": null, "total": "3130.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN NLAIV. CONCENTTRACIÓN: 2,000 UNITS/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2535.92", "subtotal": "2535.92", "tax": "405.74", "other_taxes": null, "total": "2941.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN TAQI-V2 (20,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2340.85", "subtotal": "2340.85", "tax": "374.53", "other_taxes": null, "total": "2715.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE GDNA MONARCH® SPIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5949.65", "subtotal": "5949.65", "tax": "951.94", "other_taxes": null, "total": "6901.59" }, { "number": "0", "cucop_code": "25101-0037", "description": "MÓDULO COMPLEMENTARIO NEBNEXT® PARA SECUENCIACIÓN POR LIGADURA DE OXFORD NANOPORE TECHNOLOGIES®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "32056.6", "subtotal": "32056.6", "tax": "5129.05", "other_taxes": null, "total": "37185.65" } ] }, { "id": "C-2025-00023433", "internal_reference": "AD-446/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "normalized_name": "SILVERA CIENCIA E INGENIERIA", "rfc_type": null, "slug": "silvera-ciencia-e-ingenieria" }, "contract_period": { "published_at": "2025-03-14T16:30:18.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "825674", "tax": "132107.84", "total": "957781.84", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ENSAYO DE GLUTATIÓN PEROXIDASA ENZYCHROM™", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9894", "subtotal": "19788", "tax": "3166.08", "other_taxes": null, "total": "22954.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "CATALASE FLUOROMETRIC DETECTION KIT", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "12197", "subtotal": "73182", "tax": "11709.12", "other_taxes": null, "total": "84891.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUTATHIONE PEROXIDASE ACTIVITY KIT", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "20009", "subtotal": "120054", "tax": "19208.64", "other_taxes": null, "total": "139262.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT ELISA DE CORTICOSTERONA DE ALTA SENSIBILIDAD", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11390", "subtotal": "11390", "tax": "1822.4", "other_taxes": null, "total": "13212.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT ELISA DE DAÑO RÁPIDO DEL ADN PARA CÁNCER, APOPTOSIS Y ESTRÉS OXIDATIVO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "24847", "subtotal": "99388", "tax": "15902.08", "other_taxes": null, "total": "115290.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEIN CARBONYL ELISA KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "23537", "subtotal": "47074", "tax": "7531.84", "other_taxes": null, "total": "54605.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOD ACTIVITY KIT (5 X 96 WELLS)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "19631", "subtotal": "78524", "tax": "12563.84", "other_taxes": null, "total": "91087.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "INICIADORES PARA PCR (SECUENCIA DE 30 BASES:ATCAAG TACAGTTAGTCTTTATTAGATCAA), LIBRE DE SAL", "unit": "PIEZA", "requested_quantity": "103", "awarded_quantity": null, "unit_price": "217", "subtotal": "22351", "tax": "3576.16", "other_taxes": null, "total": "25927.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBUMINA SÉRICA BÓVINA FRACCIÓN V", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "31027", "subtotal": "31027", "tax": "4964.32", "other_taxes": null, "total": "35991.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "CRYOPRES™ DIMETHYL SULFOXIDE (>99.9% USP DMSO FOR CRYOPRESERVATION)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3323", "subtotal": "3323", "tax": "531.68", "other_taxes": null, "total": "3854.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOCHROME C ( CORAZÓN DE CABALLO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13803", "subtotal": "13803", "tax": "2208.48", "other_taxes": null, "total": "16011.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIMETIL SULFÓXIDO (DIMETHYL SULFOXIDE; DMSO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1276", "subtotal": "1276", "tax": "204.16", "other_taxes": null, "total": "1480.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ß-AMYLOID, FRAGMENT 1-42", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "27074", "subtotal": "54148", "tax": "8663.68", "other_taxes": null, "total": "62811.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "(-)-GALATO DE EPIGALOCATEQUINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6248", "subtotal": "12496", "tax": "1999.36", "other_taxes": null, "total": "14495.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACHE ANTICUERPO (A-11) ALEXA FLUOR® 680", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9371", "subtotal": "9371", "tax": "1499.36", "other_taxes": null, "total": "10870.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANT CRF (2B11)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PCNA ANTIBODY (F-2)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ß-ACTIN ANTICUERPO (C4) ES UN MONOCLONAL DE RATÓN IGG1 (200 µG/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BRDU ANTICUERPO (IIB5)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CDK2 ANTICUERPO (55)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CEFTAZIDIME", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "3465", "subtotal": "24255", "tax": "3880.8", "other_taxes": null, "total": "28135.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "C-FOS ANTICUERPO (D-1)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8295", "subtotal": "16590", "tax": "2654.4", "other_taxes": null, "total": "19244.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CISPLATIN (CAS 15663-27-1)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6720", "subtotal": "6720", "tax": "1075.2", "other_taxes": null, "total": "7795.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLAUDIN-11 ANTICUERPO (D-8)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CRYOPYRIN/NALP3/NLRP3 ANTICUERPO (6F12)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8741", "subtotal": "8741", "tax": "1398.56", "other_taxes": null, "total": "10139.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "DARIFENACIN HYDROBROMIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2284", "subtotal": "2284", "tax": "365.44", "other_taxes": null, "total": "2649.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "DOUBLECORTIN/DCX ANTICUERPO (E-5)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTROGEN RECEPTOR ALPHA ANTICUERPO (2Q418)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "HISTONE DEACETYLASE 6 (HDAC6) ANTICUERPO (D-11)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "HXK II ANTICUERPO (B-8)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "MACHR M3 ANTICUERPO (H-4) ALEXA FLUOR® 594", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9371", "subtotal": "9371", "tax": "1499.36", "other_taxes": null, "total": "10870.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "MTT FORMAZAN (CAS 57360-69-7)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5250", "subtotal": "21000", "tax": "3360", "other_taxes": null, "total": "24360" }, { "number": "0", "cucop_code": "25101-0037", "description": "NORMAL MOUSE IGG ALEXA FLUOR® 488", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1391", "subtotal": "2782", "tax": "445.12", "other_taxes": null, "total": "3227.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "NURR1 ANTIBODY (F-5)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "PKM ANTICUERPO (C-11)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "P-NF?B P50 ANTICUERPO (A-8) ALEXA FLUOR® 546", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9371", "subtotal": "9371", "tax": "1499.36", "other_taxes": null, "total": "10870.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAL TRISÓDICA DEL ÁCIDO DL-ISOCÍTRICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2940", "subtotal": "2940", "tax": "470.4", "other_taxes": null, "total": "3410.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRA1/A2 ANTICUERPO (2103)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRß1 ANTICUERPO (J52)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZO-1 ANTICUERPO (R40.76)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8295", "subtotal": "8295", "tax": "1327.2", "other_taxes": null, "total": "9622.2" } ] }, { "id": "C-2025-00022767", "internal_reference": "AD-447/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "MAYIMEX SA DE CV", "normalized_name": "MAYIMEX", "rfc_type": null, "slug": "mayimex" }, "contract_period": { "published_at": "2025-03-13T22:08:09.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "78320", "tax": "12531.2", "total": "90851.2", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ALBÚMINA DE SUERO BOVINO (BSA) LIOFILIZADA PH ~7", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16200", "subtotal": "16200", "tax": "2592", "other_taxes": null, "total": "18792" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO DE CABALLO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2140", "subtotal": "6420", "tax": "1027.2", "other_taxes": null, "total": "7447.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO DE TERNERA, ÉSTERIL, LIBRE DE MICOPLASMA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1600", "subtotal": "3200", "tax": "512", "other_taxes": null, "total": "3712" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "10500", "subtotal": "52500", "tax": "8400", "other_taxes": null, "total": "60900" } ] }, { "id": "C-2025-00023483", "internal_reference": "AD-448/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "LAUKA MEXICANA SA DE CV", "normalized_name": "LAUKA MEXICANA", "rfc_type": null, "slug": "lauka-mexicana" }, "contract_period": { "published_at": "2025-03-14T16:37:11.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "393208.4", "tax": "62913.26", "total": "456121.66", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "A-673 (EWING'S SARCOMA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "35627.78", "subtotal": "35627.78", "tax": "5700.44", "other_taxes": null, "total": "41328.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIMETIL SULFÓXIDO (DIMETHYL SULFOXIDE; DMSO)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4304.79", "subtotal": "8609.58", "tax": "1377.53", "other_taxes": null, "total": "9987.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM: F-12 MEDIUM", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "2265.68", "subtotal": "27188.16", "tax": "4350.1", "other_taxes": null, "total": "31538.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "EAGLE'S MINIMUM ESSENTIAL MEDIUM (EMEM), BSL: 1 REFRIGERADO", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1963.59", "subtotal": "19635.9", "tax": "3141.74", "other_taxes": null, "total": "22777.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "FHC (COLON HUMANO NORMAL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "35627.78", "subtotal": "35627.78", "tax": "5700.44", "other_taxes": null, "total": "41328.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "HMEC-1, CÉLULA HUMANAS ENDOTELIAL MICROVASCULAR DÉRMICA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "45449.5", "subtotal": "45449.5", "tax": "7271.92", "other_taxes": null, "total": "52721.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO BASAL DE CÉLULAS EPITELIALES DE LAS VÍAS RESPIRATORIAS", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "4531.36", "subtotal": "27188.16", "tax": "4350.1", "other_taxes": null, "total": "31538.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "NIH/3T3 FIBROBLASTOS DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36063.38", "subtotal": "36063.38", "tax": "5770.14", "other_taxes": null, "total": "41833.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE PENICILINA-ESTREPTOMICINA (10 000 UI/ML DE PENICILINA, 10 000 (µG/ML) DE ESTREPTOMICINA)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1737.02", "subtotal": "8685.1", "tax": "1389.61", "other_taxes": null, "total": "10074.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO BOVINO DE TERNERA FORTIFICADO CON HIERRO (ATCC® 30-2030™)", "unit": "PIEZA", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "8159.13", "subtotal": "89750.43", "tax": "14360.06", "other_taxes": null, "total": "104110.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "VAGINAL EPITHELIAL CELL GROWTH KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7778.83", "subtotal": "15557.66", "tax": "2489.22", "other_taxes": null, "total": "18046.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACEITE DE INMERSIÓN TIPO A CARGILLE I.R. 1.5150. (LÍQUIDO VISCOSO Y TRANSPARENTE CON ALTO ÍNDICE REFRACTIVO PARA OBSERVACIONES MICROSCÓPICAS EN UN OBJETIVO 100X)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "966.69", "subtotal": "1933.38", "tax": "309.34", "other_taxes": null, "total": "2242.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "XILENO RA ACS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "353.97", "subtotal": "353.97", "tax": "56.63", "other_taxes": null, "total": "410.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE SODIO, CRISTAL, BAKER ANALYZED™ A.C.S. REACTIVO,", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "211.22", "subtotal": "422.44", "tax": "67.59", "other_taxes": null, "total": "490.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DE SODIO, DIBÁSICO, ANHIDRO, REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "956.76", "subtotal": "2870.28", "tax": "459.24", "other_taxes": null, "total": "3329.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDROXIDO DE SODIO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "601.05", "subtotal": "1202.1", "tax": "192.33", "other_taxes": null, "total": "1394.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL <=99.9% (POR GC, CORREGIDO POR CONTENIDO DE AGUA), BAKER ANALYZED ™ HPLC PARA CROMATOGRAFÍA LÍQUIDA, PARA HPLC / UHPLC", "unit": "PIEZA", "requested_quantity": "19", "awarded_quantity": null, "unit_price": "797.86", "subtotal": "15159.34", "tax": "2425.49", "other_taxes": null, "total": "17584.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE ALUMINIO Y POTASIO, 12 HIDRATOS, CRISTAL, GRADO REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1077.66", "subtotal": "3232.98", "tax": "517.27", "other_taxes": null, "total": "3750.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "XILENOS, GRADO REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "2331.31", "subtotal": "18650.48", "tax": "2984.07", "other_taxes": null, "total": "21634.55" } ] }, { "id": "C-2025-00023583", "internal_reference": "AD-449/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "HIROSTECNOLOGIAS SA DE CV", "normalized_name": "HIROSTECNOLOGIAS", "rfc_type": null, "slug": "hirostecnologias" }, "contract_period": { "published_at": "2025-03-14T21:28:50.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "82764", "tax": "13242.24", "total": "96006.24", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "PUREIT EXOZAP PCR CLEANUP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "43428", "subtotal": "43428", "tax": "6948.48", "other_taxes": null, "total": "50376.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQ DNA POLYMERASE (500 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1848", "subtotal": "3696", "tax": "591.36", "other_taxes": null, "total": "4287.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNA LADDER  50BP , 50-1500BP, 1X500UL VIAL", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "1848", "subtotal": "12936", "tax": "2069.76", "other_taxes": null, "total": "15005.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNA LADDER 100 BP, 100-3000BP (54µG/500µL)", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "1056", "subtotal": "7392", "tax": "1182.72", "other_taxes": null, "total": "8574.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "MIDORI GREEN ADVANCE (TINCIÓN DE ADN/ARN)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2552", "subtotal": "15312", "tax": "2449.92", "other_taxes": null, "total": "17761.92" } ] }, { "id": "C-2025-00022753", "internal_reference": "AD-450/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV", "normalized_name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL", "rfc_type": null, "slug": "distribuidora-quimica-y-hospitalaria-aravel" }, "contract_period": { "published_at": "2025-03-13T22:10:58.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "7443.48", "tax": "1190.95", "total": "8634.43", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "SANGRE DE CARNERO ESTÉRIL DESFIBRINADA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1240.58", "subtotal": "7443.48", "tax": "1190.95", "other_taxes": null, "total": "8634.43" } ] }, { "id": "C-2025-00022775", "internal_reference": "AD-451/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "normalized_name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE", "rfc_type": null, "slug": "distribucion-y-mantenimiento-del-noroeste" }, "contract_period": { "published_at": "2025-03-13T22:08:45.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "569395.44", "tax": "91103.27", "total": "660498.71", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ACEITE DE INMERSIÓN PARA MICROSCOPIA (INMERSION OIL FOR MICROSCOPY)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "642", "subtotal": "1926", "tax": "308.16", "other_taxes": null, "total": "2234.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO ORTO-FOSFÓRICO 85% (EMSURE® ACS, ISO, REAG.)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1915", "subtotal": "1915", "tax": "306.4", "other_taxes": null, "total": "2221.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CALDO MRS (MAN, ROGOSA AND SHARPE) GRANUCULT®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2563", "subtotal": "2563", "tax": "410.08", "other_taxes": null, "total": "2973.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHANOL ABSOLUTE FOR ANALYSIS EMSURE AC", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1044", "subtotal": "5220", "tax": "835.2", "other_taxes": null, "total": "6055.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHANOL ABSOLUTO PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "500", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRAN® MA 02 SUPELCO®, LÍQUIDO, NEUTRO, CONCENTRADO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "836", "subtotal": "4180", "tax": "668.8", "other_taxes": null, "total": "4848.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO IMMOBILON® QUIMOILUMINISCENTE DE HRP PARA TRANSFERENCIAS \"WESTERN\"", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10661", "subtotal": "21322", "tax": "3411.52", "other_taxes": null, "total": "24733.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAMPÓN DE LISIS RIPA, 10X, PARA INMUNOPRECIPITACIÓN Y TRANSFERENCIA WESTERN.", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2396", "subtotal": "7188", "tax": "1150.08", "other_taxes": null, "total": "8338.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO HIPERGRADO PARA LC-MS LICHROSOLV®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4815", "subtotal": "4815", "tax": "770.4", "other_taxes": null, "total": "5585.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRAN® MA 05 SUPELCO, LÍQUIDO ALCALINO, CONCENTRADO, SIN FOSFATOS", "unit": "PIEZA", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "1025", "subtotal": "14350", "tax": "2296", "other_taxes": null, "total": "16646" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓGENO PERÓXIDO 30%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "823", "subtotal": "823", "tax": "131.68", "other_taxes": null, "total": "954.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "VORICONAZOLE. ESTÁNDAR SECUNDARIO FARMACÉUTICO: MATERIAL DE REFERENCIA CERTIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5475", "subtotal": "5475", "tax": "876", "other_taxes": null, "total": "6351" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAR MRS DE PRIMERA CALIDAD GRANUCULT® (DE MAN, ROGOSA Y SHARPE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2912", "subtotal": "2912", "tax": "465.92", "other_taxes": null, "total": "3377.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "MUELLER HINTON BROTH 2, NUTRISELECT ® PLUS, AJUSTADO CON CATIONES, ADECUADO PARA MICROBIOLOGÍA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2928", "subtotal": "5856", "tax": "936.96", "other_taxes": null, "total": "6792.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MUELLER-HINTON AGAR 2", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2182", "subtotal": "8728", "tax": "1396.48", "other_taxes": null, "total": "10124.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO HRP QUIMIOLUMINISCENTE OCCIDENTAL IMMOBILON \"WESTERN BLOT (TRANSFERENCIA WESTERN)\"", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3525", "subtotal": "3525", "tax": "564", "other_taxes": null, "total": "4089" }, { "number": "0", "cucop_code": "25101-0037", "description": "COMPLETE™, MINI, EDTA-FREE PROTEASE INHIBITOR COCKTAIL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5505", "subtotal": "16515", "tax": "2642.4", "other_taxes": null, "total": "19157.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "DTT 1,4-DITHIOTHREITOL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10993", "subtotal": "21986", "tax": "3517.76", "other_taxes": null, "total": "25503.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "NADP DISODIUM SALT 98%. FRASCO CON 1G", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9482", "subtotal": "9482", "tax": "1517.12", "other_taxes": null, "total": "10999.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-PROPANOL (ISOPROPANOL GRADO BIOLOGÍA MOLECULAR )", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1766", "subtotal": "17660", "tax": "2825.6", "other_taxes": null, "total": "20485.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-VINYLPYRIDINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "819", "subtotal": "819", "tax": "131.04", "other_taxes": null, "total": "950.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "4-AMINOBENZOIC ACID", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1390", "subtotal": "1390", "tax": "222.4", "other_taxes": null, "total": "1612.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO, =99,9 %, HPLC PLUS, ADECUADO PARA ESPECTROSCOPIA IR, HPLC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "45110", "subtotal": "45110", "tax": "7217.6", "other_taxes": null, "total": "52327.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO, GRADO HPLC, 99.9% DE PUREZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "1311", "subtotal": "19665", "tax": "3146.4", "other_taxes": null, "total": "22811.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO FÓLICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1587", "subtotal": "1587", "tax": "253.92", "other_taxes": null, "total": "1840.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO L-ASCÓRBICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1161", "subtotal": "1161", "tax": "185.76", "other_taxes": null, "total": "1346.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETÍLICO PURO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10190", "subtotal": "20380", "tax": "3260.8", "other_taxes": null, "total": "23640.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETÍLICO PURO (ETANOL), PARA 200 PRUEBAS BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2030", "subtotal": "2030", "tax": "324.8", "other_taxes": null, "total": "2354.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ARGININA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1345", "subtotal": "1345", "tax": "215.2", "other_taxes": null, "total": "1560.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICARBONATO DE SODIO PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1296", "subtotal": "1296", "tax": "207.36", "other_taxes": null, "total": "1503.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOTINA =99.0% (T)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9972", "subtotal": "9972", "tax": "1595.52", "other_taxes": null, "total": "11567.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "BRILLIANT BLUE G", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4181", "subtotal": "4181", "tax": "668.96", "other_taxes": null, "total": "4849.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "CIPROFLOXACIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2050", "subtotal": "2050", "tax": "328", "other_taxes": null, "total": "2378" }, { "number": "0", "cucop_code": "25101-0037", "description": "CITOCALASINA B DE DRECHSLERA DEMATIOIDEA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2290", "subtotal": "2290", "tax": "366.4", "other_taxes": null, "total": "2656.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOTETRACICLINA CLORHIDRATO (CTC) (=91,0 % BASE SECA (HPLC))", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1643", "subtotal": "3286", "tax": "525.76", "other_taxes": null, "total": "3811.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLÁGENO DE PLACENTA HUMANA, BORNSTEIN Y TRAUB TIPO IV, EN POLVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7920", "subtotal": "7920", "tax": "1267.2", "other_taxes": null, "total": "9187.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CRISTAL VIOLETA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1873", "subtotal": "1873", "tax": "299.68", "other_taxes": null, "total": "2172.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIACETATO DE FLUORESCEINA POLVO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2437", "subtotal": "4874", "tax": "779.84", "other_taxes": null, "total": "5653.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIMETHYL SULFOXIDE (DMSO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1583", "subtotal": "1583", "tax": "253.28", "other_taxes": null, "total": "1836.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM - DULBECCO?S MODIFIED EAGLE?S MEDIUM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1405", "subtotal": "1405", "tax": "224.8", "other_taxes": null, "total": "1629.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL ABSOLUTO GRADO BIOL. MOL", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1497", "subtotal": "7485", "tax": "1197.6", "other_taxes": null, "total": "8682.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7735", "subtotal": "7735", "tax": "1237.6", "other_taxes": null, "total": "8972.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHYL ALCOHOL, PURE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15315", "subtotal": "15315", "tax": "2450.4", "other_taxes": null, "total": "17765.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUOXETINA HIDROCLORADA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2252", "subtotal": "6756", "tax": "1080.96", "other_taxes": null, "total": "7836.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICEROL", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2980", "subtotal": "14900", "tax": "2384", "other_taxes": null, "total": "17284" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCOSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1216", "subtotal": "1216", "tax": "194.56", "other_taxes": null, "total": "1410.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLYCEROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2888", "subtotal": "2888", "tax": "462.08", "other_taxes": null, "total": "3350.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLYCEROL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3555", "subtotal": "7110", "tax": "1137.6", "other_taxes": null, "total": "8247.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "HYDROCORTISONE-WATER SOLUBLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2892", "subtotal": "2892", "tax": "462.72", "other_taxes": null, "total": "3354.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "IGEPAL® CA-630", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1262", "subtotal": "1262", "tax": "201.92", "other_taxes": null, "total": "1463.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "IMIDAZOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4265", "subtotal": "4265", "tax": "682.4", "other_taxes": null, "total": "4947.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "IONOMICINA DE STREPTOMYCES CONGLOBATUS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4882", "subtotal": "4882", "tax": "781.12", "other_taxes": null, "total": "5663.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "IRON(II) SULFATE HEPTAHYDRATE ( REAGENTPLUS®, =99%)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1551", "subtotal": "1551", "tax": "248.16", "other_taxes": null, "total": "1799.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "LB BROTH, MILLER, MEDIO DE CULTIVO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "4199", "subtotal": "20995", "tax": "3359.2", "other_taxes": null, "total": "24354.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-CYSTEINE HYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5500", "subtotal": "5500", "tax": "880", "other_taxes": null, "total": "6380" }, { "number": "0", "cucop_code": "25101-0037", "description": "LECTIN FORMO PHASEOLUS VULGARIS (RED KIDNEY BEAN)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1503", "subtotal": "1503", "tax": "240.48", "other_taxes": null, "total": "1743.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-SERINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3937", "subtotal": "3937", "tax": "629.92", "other_taxes": null, "total": "4566.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "LUGOL SOLUTION", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2148", "subtotal": "6444", "tax": "1031.04", "other_taxes": null, "total": "7475.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "LUMINOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1347", "subtotal": "1347", "tax": "215.52", "other_taxes": null, "total": "1562.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "MENADIONE CRYSTALLINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5238", "subtotal": "5238", "tax": "838.08", "other_taxes": null, "total": "6076.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "METASULFATO DE FENAZINA PMS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5624", "subtotal": "5624", "tax": "899.84", "other_taxes": null, "total": "6523.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-LAUROILSARCOSINA SODIUM SALT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1644", "subtotal": "1644", "tax": "263.04", "other_taxes": null, "total": "1907.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ORNITINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3300", "subtotal": "3300", "tax": "528", "other_taxes": null, "total": "3828" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHLEOMYCIN READY MADE SOLUTION (0,2 µM FILTRADO, 20 MG/ML EN HEPES 20 MM)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2052", "subtotal": "4104", "tax": "656.64", "other_taxes": null, "total": "4760.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "PIPERACILLIN SODIUM SALT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2859", "subtotal": "2859", "tax": "457.44", "other_taxes": null, "total": "3316.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLI-L-LISINA SOLUCION", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12603", "subtotal": "12603", "tax": "2016.48", "other_taxes": null, "total": "14619.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLY-L-LYSINE SOLUTION AL 0.1 % (W/V) EN AGUA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3686", "subtotal": "11058", "tax": "1769.28", "other_taxes": null, "total": "12827.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAL DE SULFATO DE COLISTINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6623", "subtotal": "6623", "tax": "1059.68", "other_taxes": null, "total": "7682.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM DICHLOROACEATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1569", "subtotal": "1569", "tax": "251.04", "other_taxes": null, "total": "1820.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE POLIETILENGLICOL HYBRI-MAX™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2453", "subtotal": "2453", "tax": "392.48", "other_taxes": null, "total": "2845.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE ROJO FENOL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "741", "subtotal": "1482", "tax": "237.12", "other_taxes": null, "total": "1719.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE VIOLETA CRISTAL DE GRAM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3396", "subtotal": "3396", "tax": "543.36", "other_taxes": null, "total": "3939.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE YODURO DE PROPIDIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2699", "subtotal": "2699", "tax": "431.84", "other_taxes": null, "total": "3130.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "TEMOZOLOMIDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3169", "subtotal": "3169", "tax": "507.04", "other_taxes": null, "total": "3676.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "THIAZOLYL BLUE TETRAZOLIUM BROMIDE (MTT)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4292", "subtotal": "8584", "tax": "1373.44", "other_taxes": null, "total": "9957.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "THIUREA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1160", "subtotal": "1160", "tax": "185.6", "other_taxes": null, "total": "1345.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIAMINA HYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1775", "subtotal": "1775", "tax": "284", "other_taxes": null, "total": "2059" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIZOXANIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8517", "subtotal": "8517", "tax": "1362.72", "other_taxes": null, "total": "9879.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRYPSIN-EDTA SOLUTION", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1279.72", "subtotal": "2559.44", "tax": "409.51", "other_taxes": null, "total": "2968.95" }, { "number": "0", "cucop_code": "25101-0037", "description": "VITAMINA B12", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9415", "subtotal": "9415", "tax": "1506.4", "other_taxes": null, "total": "10921.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETYL-COENZYME A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10958", "subtotal": "10958", "tax": "1753.28", "other_taxes": null, "total": "12711.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELL PROLIFERATION KIT II (XTT)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12997", "subtotal": "12997", "tax": "2079.52", "other_taxes": null, "total": "15076.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELL PROLIFERATION REAGENT WST-1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13827", "subtotal": "13827", "tax": "2212.32", "other_taxes": null, "total": "16039.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "COMPLETE™, MINI PROTEASE INHIBITOR COCKTAIL. TABLETS PROVIDED IN EASYPACKS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5165", "subtotal": "5165", "tax": "826.4", "other_taxes": null, "total": "5991.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMIKACIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3806", "subtotal": "3806", "tax": "608.96", "other_taxes": null, "total": "4414.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEROPENEM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6302", "subtotal": "6302", "tax": "1008.32", "other_taxes": null, "total": "7310.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "CONCENTRADO DE TAMPÓN SSC 20×", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2434", "subtotal": "4868", "tax": "778.88", "other_taxes": null, "total": "5646.88" } ] }, { "id": "C-2025-00025153", "internal_reference": "AD-452/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "DIAGNOSTICO INNOVACION Y ASESORIA SA DE CV", "normalized_name": "DIAGNOSTICO INNOVACION Y ASESORIA", "rfc_type": null, "slug": "diagnostico-innovacion-y-asesoria" }, "contract_period": { "published_at": "2025-03-19T21:49:29.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "358671.48", "tax": "57387.43", "total": "416058.91", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "KIT NO DERIVATIZADO PARA CUANTIFICACIÓN DE AMINOÁCIDOS, ACILCARNITINAS Y SUCCINILACETONA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "179335.74", "subtotal": "358671.48", "tax": "57387.43", "other_taxes": null, "total": "416058.91" } ] }, { "id": "C-2025-00023530", "internal_reference": "AD-453/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "normalized_name": "CONTROL TECNICO Y REPRESENTACIONES", "rfc_type": null, "slug": "control-tecnico-y-representaciones" }, "contract_period": { "published_at": "2025-03-14T21:28:11.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "805053", "tax": "128808.48", "total": "933861.48", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-BRDU ANTIBODY [BU1/75 (ICR1)]", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14306", "subtotal": "28612", "tax": "4577.92", "other_taxes": null, "total": "33189.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-BDNF [EPR1292]: BAJO CONTENIDO DE ENDOTOXINAS, LIBRE DE AZIDA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "25386", "subtotal": "50772", "tax": "8123.52", "other_taxes": null, "total": "58895.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL DE CONEJO DCAMKL1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13464", "subtotal": "13464", "tax": "2154.24", "other_taxes": null, "total": "15618.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO RECOMBINANTE ANTI-RECEPTOR DE GLUTAMATO 1 (SUBTIPO AMPA) [EPR19522]", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14867", "subtotal": "14867", "tax": "2378.72", "other_taxes": null, "total": "17245.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-INSULIN ANTIBODY", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "10659", "subtotal": "42636", "tax": "6821.76", "other_taxes": null, "total": "49457.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE TRIYODOTIRONINA LIBRE (ELISA DE T3 LIBRE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9724", "subtotal": "9724", "tax": "1555.84", "other_taxes": null, "total": "11279.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE HORMONA ESTIMULANTE DE LA TIROIDES (TSH ELISA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4900", "subtotal": "4900", "tax": "784", "other_taxes": null, "total": "5684" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE TIROXINA LIBRE (ELISA DE T4 LIBRE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7817", "subtotal": "7817", "tax": "1250.72", "other_taxes": null, "total": "9067.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE TIROXINA TOTAL (ELISA DE T4 TOTAL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5910", "subtotal": "5910", "tax": "945.6", "other_taxes": null, "total": "6855.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA MEDICIÓN DE TSH EN SUERO DE RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "18551", "subtotal": "18551", "tax": "2968.16", "other_taxes": null, "total": "21519.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAT INSULIN ELISA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10360", "subtotal": "20720", "tax": "3315.2", "other_taxes": null, "total": "24035.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL™ SENSI-DISC™ MEROPENEM 10 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2300", "subtotal": "9200", "tax": "1472", "other_taxes": null, "total": "10672" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL™ SENSI-DISC™ CLINDAMYCIN, 2 µG", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2239", "subtotal": "4478", "tax": "716.48", "other_taxes": null, "total": "5194.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL™ SENSI-DISC™ ERTAPENEM,10 µG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2554", "subtotal": "2554", "tax": "408.64", "other_taxes": null, "total": "2962.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL™ SENSI-DISC™ IMIPENEM,10 µG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2171", "subtotal": "2171", "tax": "347.36", "other_taxes": null, "total": "2518.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAR MEDIO SIM-BD BIOXON®", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1972", "subtotal": "3944", "tax": "631.04", "other_taxes": null, "total": "4575.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAR MUELLER HINTON BD BIOXON®", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1654", "subtotal": "4962", "tax": "793.92", "other_taxes": null, "total": "5755.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD CULTURESWAB™ PLUS AMIES GEL WITHOUT CHARCOALSINGLE SWAB ( GEL AMIES SIN CARBÓN HISOPO SIMPLE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1123", "subtotal": "1123", "tax": "179.68", "other_taxes": null, "total": "1302.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANNEXIN V RECOMB FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6494", "subtotal": "6494", "tax": "1039.04", "other_taxes": null, "total": "7533.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD PHARMINGEN™ FITC ANNEXIN V APOPTOSIS DETECTION KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6905", "subtotal": "6905", "tax": "1104.8", "other_taxes": null, "total": "8009.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "FITC GOAR ANTI-RABBIT IGG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5850", "subtotal": "5850", "tax": "936", "other_taxes": null, "total": "6786" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAR SOYA TRIPTICASEINA BD BIOXON®", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1402", "subtotal": "2804", "tax": "448.64", "other_taxes": null, "total": "3252.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL™ SENSI-DISC™ - VANCOMYCIN, 30 µG (VA-30)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2319", "subtotal": "4638", "tax": "742.08", "other_taxes": null, "total": "5380.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BBL ™ SENSI-DISC ™ AMPICILINA AM- 10 µG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2201", "subtotal": "2201", "tax": "352.16", "other_taxes": null, "total": "2553.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE ZINC HEPTAHIDRATADO RA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1165", "subtotal": "5825", "tax": "932", "other_taxes": null, "total": "6757" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 25%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1235", "subtotal": "1235", "tax": "197.6", "other_taxes": null, "total": "1432.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TETROXIDO DE OSMIO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1384", "subtotal": "2768", "tax": "442.88", "other_taxes": null, "total": "3210.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "GIBCO™ MEDIO BASAL DE EXPANSIÓN DE FIBROBLASTOS HUMANOS (ANTERIORMENTE MEDIO 106)", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "2351", "subtotal": "23510", "tax": "3761.6", "other_taxes": null, "total": "27271.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUTATHIONE COLORIMETRIC DETECTION KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "15903", "subtotal": "31806", "tax": "5088.96", "other_taxes": null, "total": "36894.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-PROPANOL, PARA ANALISIS EMSURE®, ACS,ISO,REAG. PH EUR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1823", "subtotal": "1823", "tax": "291.68", "other_taxes": null, "total": "2114.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "NEO-CLEAR™, SUSTITUTO DE XILENO, PARA MICROSCOPIA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2468", "subtotal": "2468", "tax": "394.88", "other_taxes": null, "total": "2862.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "884", "subtotal": "2652", "tax": "424.32", "other_taxes": null, "total": "3076.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA PARA CROMATOGRAFÍA DE GASES ECD Y FID SUPRASOLV®", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "4576", "subtotal": "22880", "tax": "3660.8", "other_taxes": null, "total": "26540.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL ABSOLUTO PARA ANÁLISIS EMPARTA® ACS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4926", "subtotal": "9852", "tax": "1576.32", "other_taxes": null, "total": "11428.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIAPHORASE FROM CLOSTRIDIUM KLUYVERI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12240", "subtotal": "12240", "tax": "1958.4", "other_taxes": null, "total": "14198.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FANCD2 - LIBRE DE BSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10571", "subtotal": "10571", "tax": "1691.36", "other_taxes": null, "total": "12262.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO BDNF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11207", "subtotal": "11207", "tax": "1793.12", "other_taxes": null, "total": "13000.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE PURIFICACIÓN QIAQUICK PCR, PARA LA PURIFICACIÓN DE 250 REACCIONES PCR: 250 QIAQUICK SPIN COLUMNS, BUFFERS, COLLECTION TUBES (2 ML)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "14890", "subtotal": "44670", "tax": "7147.2", "other_taxes": null, "total": "51817.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE DNA MINI KIT QIAAMP®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14260", "subtotal": "14260", "tax": "2281.6", "other_taxes": null, "total": "16541.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BIOTINILADO CONTRA IL-10 HUMANA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13045", "subtotal": "13045", "tax": "2087.2", "other_taxes": null, "total": "15132.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BIOTINILADO IL-6 HUMANO/DE PRIMATES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13520", "subtotal": "13520", "tax": "2163.2", "other_taxes": null, "total": "15683.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA DETERMINACIÓN DE FACTOR DE NECROSIS TUMARAL DUOSET DE TNF-ALFA HUMANO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10455", "subtotal": "20910", "tax": "3345.6", "other_taxes": null, "total": "24255.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA DETERMINACIÓN DE INTERLEUCINA DUOSET DE IL-10 HUMANA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10455", "subtotal": "20910", "tax": "3345.6", "other_taxes": null, "total": "24255.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA DETERMINACIÓN DE INTERLEUCINA DUOSET DE IL-6 HUMANA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10455", "subtotal": "20910", "tax": "3345.6", "other_taxes": null, "total": "24255.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT HUMAN IL-22 PROTEIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9504", "subtotal": "9504", "tax": "1520.64", "other_taxes": null, "total": "11024.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT HUMAN IL-23 PROTEIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10099", "subtotal": "10099", "tax": "1615.84", "other_taxes": null, "total": "11714.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "1-OCTANOL ANHIDRO, =99%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2170", "subtotal": "2170", "tax": "347.2", "other_taxes": null, "total": "2517.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO CLORHÍDRICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6038", "subtotal": "6038", "tax": "966.08", "other_taxes": null, "total": "7004.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACTINOMYCIN D", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3808", "subtotal": "3808", "tax": "609.28", "other_taxes": null, "total": "4417.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-ACTINA PRODUCIDO EN CONEJO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16447", "subtotal": "16447", "tax": "2631.52", "other_taxes": null, "total": "19078.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL ANTI-IGG1-BIOTINA HUMANA PRODUCIDO EN RATÓN.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8428", "subtotal": "8428", "tax": "1348.48", "other_taxes": null, "total": "9776.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-MOUSE IGG2B (?-CHAIN SPECIFIC)-PEROXIDASE ANTIBODY PRODUCED IN RABBIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7208", "subtotal": "7208", "tax": "1153.28", "other_taxes": null, "total": "8361.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-MOUSE IGG3 (?-CHAIN SPECIFIC)-PEROXIDASE ANTIBODY PRODUCED IN RABBIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6831", "subtotal": "6831", "tax": "1092.96", "other_taxes": null, "total": "7923.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "BRADFORD REACTIVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2731", "subtotal": "2731", "tax": "436.96", "other_taxes": null, "total": "3167.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-PANTOTHENIC ACID HEMICALCIUM SALT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1101", "subtotal": "1101", "tax": "176.16", "other_taxes": null, "total": "1277.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUOLINK® IN SITU RED STARTER KIT MOUSE/RABBIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "39358", "subtotal": "39358", "tax": "6297.28", "other_taxes": null, "total": "45655.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "KAEMPFEROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "44186", "subtotal": "44186", "tax": "7069.76", "other_taxes": null, "total": "51255.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERSULFATO DE AMONIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1408", "subtotal": "1408", "tax": "225.28", "other_taxes": null, "total": "1633.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "S-(5?-ADENOSYL)-L-METHIONINE CHLORIDE DIHYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4991", "subtotal": "4991", "tax": "798.56", "other_taxes": null, "total": "5789.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "CÉLULAS COMPETENTES E. COLI DH5ALPHA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1747", "subtotal": "1747", "tax": "279.52", "other_taxes": null, "total": "2026.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO HRP MOUSE ANTI MOUSE IGG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5274", "subtotal": "5274", "tax": "843.84", "other_taxes": null, "total": "6117.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6059", "subtotal": "6059", "tax": "969.44", "other_taxes": null, "total": "7028.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-RABBIT IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5910", "subtotal": "11820", "tax": "1891.2", "other_taxes": null, "total": "13711.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "HORSE ANTI-GOAT IGG ANTIBODY (H+L), BIOTINYLATED _X000B_", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5872", "subtotal": "5872", "tax": "939.52", "other_taxes": null, "total": "6811.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "HORSE ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5910", "subtotal": "5910", "tax": "945.6", "other_taxes": null, "total": "6855.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE MONTAJE ANTIDECOLORACIÓN VECTASHIELD® CON DAPI", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6097", "subtotal": "18291", "tax": "2926.56", "other_taxes": null, "total": "21217.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "VECTASHIELD® ANTIFADE MOUNTING MEDIUM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5685", "subtotal": "5685", "tax": "909.6", "other_taxes": null, "total": "6594.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "VECTASTAIN® ELITE® ABC-HRP KIT (PEROXIDASE, UNIVERSAL) DUPLICIDAD", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17728", "subtotal": "17728", "tax": "2836.48", "other_taxes": null, "total": "20564.48" } ] }, { "id": "C-2025-00023488", "internal_reference": "AD-454/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "CRISSOF DE MEXICO S DE RL DE CV", "normalized_name": "CRISSOF DE MEXICO", "rfc_type": null, "slug": "crissof-de-mexico" }, "contract_period": { "published_at": "2025-03-14T16:37:55.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "87799.2", "tax": "14047.84", "total": "101847.04", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "100X BIOLYTE® 3/10 AMPHOLYTE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1100", "subtotal": "1100", "tax": "176", "other_taxes": null, "total": "1276" }, { "number": "0", "cucop_code": "25101-0037", "description": "30% ACRYLAMIDE/BIS SOLUTION", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1382.5", "subtotal": "6912.5", "tax": "1106", "other_taxes": null, "total": "8018.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "30% ACRYLAMIDE/BIS SOLUTION, 29:1", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2813.2", "subtotal": "14066", "tax": "2250.56", "other_taxes": null, "total": "16316.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACRILAMIDA PURO AL 99,9 %", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5657.4", "subtotal": "11314.8", "tax": "1810.36", "other_taxes": null, "total": "13125.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "DITHIOTHREITOL (DTT)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1885.4", "subtotal": "3770.8", "tax": "603.32", "other_taxes": null, "total": "4374.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "IMMUNO-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M (1 ROLL, 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9439", "subtotal": "9439", "tax": "1510.24", "other_taxes": null, "total": "10949.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS (MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES TEÑIDAS DE AZUL (10–250 KD), INCLUIDAS TRES BANDAS DE REFERENCIA (25, 50, 75 KD), 50 APLICACIONES)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2325.6", "subtotal": "13953.6", "tax": "2232.57", "other_taxes": null, "total": "16186.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "PRECISION PLUS PROTEIN™ KALEIDOSCOPE™ PRESTAINED PROTEIN STANDARDS (500 µL, MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES (10–250 KD))", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3236.8", "subtotal": "12947.2", "tax": "2071.55", "other_taxes": null, "total": "15018.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROFINITY™ IMAC RESIN, NI-CHARGED 25 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6803.6", "subtotal": "6803.6", "tax": "1088.57", "other_taxes": null, "total": "7892.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "SSOADVANCED™ UNIVERSAL SYBR® GREEN SUPERMIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7491.7", "subtotal": "7491.7", "tax": "1198.67", "other_taxes": null, "total": "8690.37" } ] }, { "id": "C-2025-00023567", "internal_reference": "AD-455/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "normalized_name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS", "rfc_type": null, "slug": "comercializadora-e-importadora-de-productos-quimicos" }, "contract_period": { "published_at": "2025-03-14T21:27:39.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1030016", "tax": "164802.56", "total": "1194818.56", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA MEDICIÓN DE LONGITUD DE TELOMEROS POR CITOMETRÍA DE FLUJO PNA KIT/FITC", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "47299", "subtotal": "94598", "tax": "15135.68", "other_taxes": null, "total": "109733.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIHUMAN CD45 BV605 BD HORIZON™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "35248", "subtotal": "35248", "tax": "5639.68", "other_taxes": null, "total": "40887.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD13 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19803", "subtotal": "19803", "tax": "3168.48", "other_taxes": null, "total": "22971.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD14 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16319", "subtotal": "16319", "tax": "2611.04", "other_taxes": null, "total": "18930.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD19 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21230", "subtotal": "21230", "tax": "3396.8", "other_taxes": null, "total": "24626.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD29 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19803", "subtotal": "19803", "tax": "3168.48", "other_taxes": null, "total": "22971.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD31 PE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20798", "subtotal": "20798", "tax": "3327.68", "other_taxes": null, "total": "24125.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD34 FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17315", "subtotal": "17315", "tax": "2770.4", "other_taxes": null, "total": "20085.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD73-PE, AD-2", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "17912", "subtotal": "35824", "tax": "5731.84", "other_taxes": null, "total": "41555.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL CD90 PE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21661", "subtotal": "21661", "tax": "3465.76", "other_taxes": null, "total": "25126.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ECOMOUNT, ES UN MEDIO DE MONTAJE PERMANENTE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9104", "subtotal": "9104", "tax": "1456.64", "other_taxes": null, "total": "10560.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "7-AAD VIABILITY STAINING SOLUTION (50 µG/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1001", "subtotal": "1001", "tax": "160.16", "other_taxes": null, "total": "1161.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR® 488 DONKEY ANTI-RABBIT IGG (MINIMAL X-REACTIVITY) ANTIBODY", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "4703", "subtotal": "18812", "tax": "3009.92", "other_taxes": null, "total": "21821.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR® 647 DONKEY ANTI-RABBIT IGG (MINIMAL X-REACTIVITY) ANTIBODY", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4703", "subtotal": "14109", "tax": "2257.44", "other_taxes": null, "total": "16366.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-BACH2 DE PE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7137", "subtotal": "7137", "tax": "1141.92", "other_taxes": null, "total": "8278.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FITC ANTI-IGG DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3869", "subtotal": "3869", "tax": "619.04", "other_taxes": null, "total": "4488.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN GM-CSF BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10939", "subtotal": "10939", "tax": "1750.24", "other_taxes": null, "total": "12689.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IL-22 BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8838", "subtotal": "8838", "tax": "1414.08", "other_taxes": null, "total": "10252.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN TNF-ALPHA BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9105", "subtotal": "9105", "tax": "1456.8", "other_taxes": null, "total": "10561.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC ANTI-HUMAN CD63 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10106", "subtotal": "10106", "tax": "1616.96", "other_taxes": null, "total": "11722.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC/CYANINE7 ANTI-HUMAN CD4 ANTIBODY", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10372", "subtotal": "20744", "tax": "3319.04", "other_taxes": null, "total": "24063.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "FITC ANNEXIN V APOPTOSIS DETECTION KIT WITH PI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8438", "subtotal": "8438", "tax": "1350.08", "other_taxes": null, "total": "9788.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "FITC ANTI-HUMAN CD203C (E-NPP3) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8838", "subtotal": "8838", "tax": "1414.08", "other_taxes": null, "total": "10252.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "FITC ANTI-HUMAN TNF-ALPHA ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3135", "subtotal": "3135", "tax": "501.6", "other_taxes": null, "total": "3636.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-HUMAN CD86 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4069", "subtotal": "4069", "tax": "651.04", "other_taxes": null, "total": "4720.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-HUMAN CXCL10 (IP-10) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5103", "subtotal": "5103", "tax": "816.48", "other_taxes": null, "total": "5919.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-HUMAN IFN-GAMMA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8238", "subtotal": "8238", "tax": "1318.08", "other_taxes": null, "total": "9556.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERCP ANTI-HUMAN CD4 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11173", "subtotal": "11173", "tax": "1787.68", "other_taxes": null, "total": "12960.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERCP/CYANINE5.5 ANTI-HUMAN CD3 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12740", "subtotal": "12740", "tax": "2038.4", "other_taxes": null, "total": "14778.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERCP/CYANINE5.5 ANTI-NOS2 (INOS) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5503", "subtotal": "5503", "tax": "880.48", "other_taxes": null, "total": "6383.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT HUMAN IFN-? (CARRIER-FREE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2769", "subtotal": "2769", "tax": "443.04", "other_taxes": null, "total": "3212.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT HUMAN IL-2 (E. COLI EXPRESSED, CARRIER-FREE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2769", "subtotal": "2769", "tax": "443.04", "other_taxes": null, "total": "3212.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT HUMAN IL-21 (CARRIER-FREE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13507", "subtotal": "13507", "tax": "2161.12", "other_taxes": null, "total": "15668.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "FETAL BOVINE SERUM (MÉXICO, USDA APPROVED)", "unit": "PIEZA", "requested_quantity": "13", "awarded_quantity": null, "unit_price": "11264", "subtotal": "146432", "tax": "23429.12", "other_taxes": null, "total": "169861.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRANSFERRINA, BOVINA (FORMA HOLO), LIOFILIZADA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6843", "subtotal": "6843", "tax": "1094.88", "other_taxes": null, "total": "7937.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "24XCYTE HUMAN MULTICOLOR FISH", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "44612", "subtotal": "89224", "tax": "14275.84", "other_taxes": null, "total": "103499.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA DE DNA PARA LAS REGIONES 1P36.3 Y 1Q25.2 MARCADAS CON FLUOROCROMOS NARANJA Y VERDE RESPECTIVAMENTE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "26696", "subtotal": "53392", "tax": "8542.72", "other_taxes": null, "total": "61934.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "CD117. MICROBEADS, MOUSE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24628", "subtotal": "24628", "tax": "3940.48", "other_taxes": null, "total": "28568.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACHE ASSAY KIT :: GENERAL ACETYLCHOLINESTERASE ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9651", "subtotal": "9651", "tax": "1544.16", "other_taxes": null, "total": "11195.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "APIGENIN, BIOCHEMICAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7188", "subtotal": "7188", "tax": "1150.08", "other_taxes": null, "total": "8338.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "CAPTOPRIL DISULFIDE, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16606", "subtotal": "16606", "tax": "2656.96", "other_taxes": null, "total": "19262.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIALLYL DISULFIDE, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6318", "subtotal": "6318", "tax": "1010.88", "other_taxes": null, "total": "7328.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "EBSELEN SMALL MOLECULE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8202", "subtotal": "8202", "tax": "1312.32", "other_taxes": null, "total": "9514.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "MYRICETIN, BIOCHEMICAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6898", "subtotal": "6898", "tax": "1103.68", "other_taxes": null, "total": "8001.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ROSMARINIC ACID, BIOCHEMICAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6753", "subtotal": "6753", "tax": "1080.48", "other_taxes": null, "total": "7833.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM OXAMATE BIOCHEMICAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5883", "subtotal": "5883", "tax": "941.28", "other_taxes": null, "total": "6824.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SYNEPHRINE, INHIBITOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6028", "subtotal": "6028", "tax": "964.48", "other_taxes": null, "total": "6992.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TERT-BUTHYL PITAVASTATIN BIOCHEMICAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6173", "subtotal": "6173", "tax": "987.68", "other_taxes": null, "total": "7160.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN NF-KAPPAB P65 ACTIVITY ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20349", "subtotal": "20349", "tax": "3255.84", "other_taxes": null, "total": "23604.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN NRF2 ACTIVITY ASSAY KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "20349", "subtotal": "40698", "tax": "6511.68", "other_taxes": null, "total": "47209.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "DAPI (4´,6-DIAMIDINO-2-PHENYLINDOLE DIHYDROCHLORIDE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1639", "subtotal": "1639", "tax": "262.24", "other_taxes": null, "total": "1901.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUOLINK® REACTIVOS DE DETECCIÓN IN SITU ROJA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "16193", "subtotal": "32386", "tax": "5181.76", "other_taxes": null, "total": "37567.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-HUMAN IGG ANTIBODY, HRP CONJUGATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16978", "subtotal": "16978", "tax": "2716.48", "other_taxes": null, "total": "19694.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROPYLEN GLYCOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4034", "subtotal": "4034", "tax": "645.44", "other_taxes": null, "total": "4679.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "LENTI-X™ CONCENTRATOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11068", "subtotal": "11068", "tax": "1770.88", "other_taxes": null, "total": "12838.88" } ] }, { "id": "C-2025-00023480", "internal_reference": "AD-456/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "BIOSYSTEMS LIFESCIENCE SA DE CV", "normalized_name": "BIOSYSTEMS LIFESCIENCE", "rfc_type": null, "slug": "biosystems-lifescience" }, "contract_period": { "published_at": "2025-03-14T16:31:10.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "130707.55", "tax": "20913.18", "total": "151620.73", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "PCR EXPANSION KIT (PCR PRIMERS (PRM) AND PCR ADAPTERS (PCA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16387.78", "subtotal": "16387.78", "tax": "2622.04", "other_taxes": null, "total": "19009.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "ADAPTADOR MINION™ MK1B PARA CARTUCHO MINION™ Y GRIDION™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "37002.34", "subtotal": "37002.34", "tax": "5920.37", "other_taxes": null, "total": "42922.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIGATION SEQUENCING KIT V14", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23531.41", "subtotal": "23531.41", "tax": "3765.02", "other_taxes": null, "total": "27296.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "CDNA - PCR BACODING KIT V14", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "30254.61", "subtotal": "30254.61", "tax": "4840.73", "other_taxes": null, "total": "35095.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIRECT RNA SEQUENCING KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23531.41", "subtotal": "23531.41", "tax": "3765.02", "other_taxes": null, "total": "27296.43" } ] }, { "id": "C-2025-00023432", "internal_reference": "AD-457/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "BIOADVANCED SYSTEMS SA DE CV", "normalized_name": "BIOADVANCED SYSTEMS", "rfc_type": null, "slug": "bioadvanced-systems" }, "contract_period": { "published_at": "2025-03-14T16:31:58.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "837176.15", "tax": "133948", "total": "971124.15", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "AMPLITAQ GOLD DNA POLYMERASE, WITH BUFFER II AND MGCL2, 3000 UNITS (12 TUBES X 50 UL, 250 UNITS PER TUBE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "61201.19", "subtotal": "61201.19", "tax": "9792.19", "other_taxes": null, "total": "70993.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMPLITAQ GOLD™ 360 MASTER MIX", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "55491.72", "subtotal": "110983.44", "tax": "17757.35", "other_taxes": null, "total": "128740.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "CUSTOM TAQMAN™ SNP GENOTYPING ASSAY, HUMAN S (300 REACTIONS)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "7712.73", "subtotal": "46276.38", "tax": "7404.22", "other_taxes": null, "total": "53680.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "GENECHIP™ HUMAN GENOME U133 PLUS 2.0", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "241399.49", "subtotal": "241399.49", "tax": "38623.91", "other_taxes": null, "total": "280023.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA RT-PCR (TAQMAN REVERSE TRANSCRIPTION), MULTISCRIBE REVERSE TRANSCRIPTASE, RNASE INHIBITOR, DNTP MIXTURE, OLIGO D(T)16, RANDOM HEXAMERS, 10X RT BUFFER, MGCL2 SOLUTION.", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "17428.94", "subtotal": "69715.76", "tax": "11154.52", "other_taxes": null, "total": "80870.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SEQUENCE DETECTION PRIMER", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2924.94", "subtotal": "5849.88", "tax": "935.98", "other_taxes": null, "total": "6785.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMNIOMAX™- II COMPLETE MEDIUM", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2644.33", "subtotal": "13221.65", "tax": "2115.46", "other_taxes": null, "total": "15337.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBIÓTICO-ANTIMICÓTICO (100X)", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1066.86", "subtotal": "10668.6", "tax": "1706.97", "other_taxes": null, "total": "12375.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "BD BIOSATE™ PEPTONE, 454 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4367.19", "subtotal": "4367.19", "tax": "698.75", "other_taxes": null, "total": "5065.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO), POLVO, ALTO CONTENIDO EN GLUCOSA, EN POLVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "717.44", "subtotal": "717.44", "tax": "114.79", "other_taxes": null, "total": "832.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM, ALTO CONTENIDO EN GLUCOSA, PIRUVATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6009.99", "subtotal": "6009.99", "tax": "961.59", "other_taxes": null, "total": "6971.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIBRIDOMA-SFM", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2504.13", "subtotal": "10016.52", "tax": "1602.64", "other_taxes": null, "total": "11619.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "PBS PH 7.4", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "615.76", "subtotal": "615.76", "tax": "98.52", "other_taxes": null, "total": "714.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "PIRUVATO DE SODIO (100 MM)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "312.21", "subtotal": "1248.84", "tax": "199.81", "other_taxes": null, "total": "1448.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE AMINOÁCIDOS NO ESENCIALES MEM (100X)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "554.31", "subtotal": "3325.86", "tax": "532.13", "other_taxes": null, "total": "3857.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN EN HBSS KARYOMAX™ COLCEMID™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "570.97", "subtotal": "570.97", "tax": "91.35", "other_taxes": null, "total": "662.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "1 M DE TRIS-HCI ULTRAPURE™, PH 8,0", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1457.39", "subtotal": "1457.39", "tax": "233.18", "other_taxes": null, "total": "1690.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "100 BP DNA LADDER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7532.5", "subtotal": "7532.5", "tax": "1205.2", "other_taxes": null, "total": "8737.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA LIBRE DE NUCLEASAS (NO TRATADA CON DEPC)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3185.22", "subtotal": "6370.44", "tax": "1019.27", "other_taxes": null, "total": "7389.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBÚMINA: ULTRAPURE™ BSA (50 MG/ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3245.37", "subtotal": "6490.74", "tax": "1038.51", "other_taxes": null, "total": "7529.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "INDICADOR ROJO DE SUPERÓXIDO MITOCONDRIAL MITOSOX™, PARA IMÁGENES DE CÉLULAS VIVAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8734.37", "subtotal": "8734.37", "tax": "1397.49", "other_taxes": null, "total": "10131.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "INVITROGEN™ TRUEGUIDE™ SGRNA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "2103.43", "subtotal": "21034.3", "tax": "3365.48", "other_taxes": null, "total": "24399.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUBIT™ 1X DSDNA HS ASSAY KIT. ENSAYO: ADNDS 1X, ALTA SENSIBILIDAD- 0,1-120 NG", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2844.68", "subtotal": "5689.36", "tax": "910.29", "other_taxes": null, "total": "6599.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUBIT™ 1X DSDNA HS Y BR ASSAY KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8574.27", "subtotal": "8574.27", "tax": "1371.88", "other_taxes": null, "total": "9946.15" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPERSCRIPT™ III FIRST-STRAND SYNTHESIS SUPERMIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13742.84", "subtotal": "13742.84", "tax": "2198.85", "other_taxes": null, "total": "15941.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNTP MIX CONTIENE: 10 MM DE CADA UNO DE DATP, DTTP, DCTP Y DGTP.", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2721.78", "subtotal": "8165.34", "tax": "1306.45", "other_taxes": null, "total": "9471.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "ECORI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "895.72", "subtotal": "895.72", "tax": "143.31", "other_taxes": null, "total": "1039.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN DPNI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "942.46", "subtotal": "942.46", "tax": "150.79", "other_taxes": null, "total": "1093.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN NDEI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3711.84", "subtotal": "7423.68", "tax": "1187.78", "other_taxes": null, "total": "8611.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "FASTDIGEST BAMHI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1232.16", "subtotal": "1232.16", "tax": "197.14", "other_taxes": null, "total": "1429.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIGADURA RÁPIDA DE ADN KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4119.46", "subtotal": "8238.92", "tax": "1318.22", "other_taxes": null, "total": "9557.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIGASA DE ADN T4 (5 U/µL)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5038.98", "subtotal": "15116.94", "tax": "2418.71", "other_taxes": null, "total": "17535.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "MAXIMA SYBER GREEN/ROX Q PCR MASTER MIX 200 X 25 UL RXN", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4799.9", "subtotal": "9599.8", "tax": "1535.96", "other_taxes": null, "total": "11135.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA DE DNTP (10 MM CADA UNO)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "14744.37", "subtotal": "58977.48", "tax": "9436.39", "other_taxes": null, "total": "68413.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "NDEI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "772.4", "subtotal": "772.4", "tax": "123.58", "other_taxes": null, "total": "895.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGO (DT)18 PRIMER", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3034.42", "subtotal": "12137.68", "tax": "1942.02", "other_taxes": null, "total": "14079.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHUSION HIGH-FIDELITY DNA POLYMERASE (2 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2519.49", "subtotal": "5038.98", "tax": "806.23", "other_taxes": null, "total": "5845.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRANSCRIPTASA INVERSA REVERTAID (200 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8790.63", "subtotal": "17581.26", "tax": "2813", "other_taxes": null, "total": "20394.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "XHOI (10 U/µL), ENZIMA DE RESTRICCIÓN", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "747.95", "subtotal": "1495.9", "tax": "239.34", "other_taxes": null, "total": "1735.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "INHIBIDORES DE LA ARNASA RIBOLOCK (40 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1682.83", "subtotal": "3365.66", "tax": "538.5", "other_taxes": null, "total": "3904.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "MAXIMA PROBE/ROX QPCR MASTER MIX (200 X 25 µL RXNS)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5094.15", "subtotal": "20376.6", "tax": "3260.25", "other_taxes": null, "total": "23636.85" } ] }, { "id": "C-2025-00022783", "internal_reference": "AD-458/2025", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "ACCESORIOS PARA LABORATORIOS SA DE CV", "normalized_name": "ACCESORIOS PARA LABORATORIOS", "rfc_type": null, "slug": "accesorios-para-laboratorios" }, "contract_period": { "published_at": "2025-03-13T22:09:45.000Z", "starts_at": "2025-03-11T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "352055.07", "tax": "56328.61", "total": "408383.68", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO, CERTIFICADO DE EE.UU", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "15870.3", "subtotal": "31740.6", "tax": "5078.49", "other_taxes": null, "total": "36819.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAROSA ULTRAPURE™", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14091.42", "subtotal": "28182.84", "tax": "4509.25", "other_taxes": null, "total": "32692.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGLUTININA DE GERMEN DE TRIGO (WGA), CONJUGADO ALEXA FLUOR™ 488", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10686.06", "subtotal": "10686.06", "tax": "1709.76", "other_taxes": null, "total": "12395.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETOFENONA PARA SÍNTESIS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "615.66", "subtotal": "615.66", "tax": "98.5", "other_taxes": null, "total": "714.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE NESSLER PARA SALES DE AMONIO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "644.49", "subtotal": "1288.98", "tax": "206.23", "other_taxes": null, "total": "1495.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "HITRAP® Q HIGH PERFORMANCE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11789.61", "subtotal": "11789.61", "tax": "1886.33", "other_taxes": null, "total": "13675.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "AQUATEX® MEDIO DE MONTAJE ACUOSO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "871.41", "subtotal": "3485.64", "tax": "557.7", "other_taxes": null, "total": "4043.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "CASEIN HYDROLYSATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1992.06", "subtotal": "1992.06", "tax": "318.72", "other_taxes": null, "total": "2310.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHANOL FOR MOLECULAR BIOLOGY FCO 250 ML", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "804.45", "subtotal": "6435.6", "tax": "1029.69", "other_taxes": null, "total": "7465.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "MALTOSE MONOHYDRATE FOR MICROBIOLOGY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2082.27", "subtotal": "2082.27", "tax": "333.16", "other_taxes": null, "total": "2415.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEÍNA G AGAROSA, FLUJO RÁPIDO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13790.97", "subtotal": "13790.97", "tax": "2206.55", "other_taxes": null, "total": "15997.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, POD (IN SITU CELL DEATH DETECTION)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "13963.95", "subtotal": "41891.85", "tax": "6702.69", "other_taxes": null, "total": "48594.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "NADH (?-NICOTINAMIDA ADENINA DINUCLEÓTIDO, FORMA REDUCIDA, SAL DISÓDICA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3015.06", "subtotal": "3015.06", "tax": "482.4", "other_taxes": null, "total": "3497.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÉTER TERC-BUTILMETÍLICO (TERT-BUTYL METHYL ETHER LICHROSOLV®)", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "2163.18", "subtotal": "17305.44", "tax": "2768.87", "other_taxes": null, "total": "20074.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-(+)- TREHALOSA DIHIDRATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14739.57", "subtotal": "14739.57", "tax": "2358.33", "other_taxes": null, "total": "17097.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, FLUORESCEÍNA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "13015.35", "subtotal": "39046.05", "tax": "6247.36", "other_taxes": null, "total": "45293.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "3- O -METILQUERCETINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13839.33", "subtotal": "13839.33", "tax": "2214.29", "other_taxes": null, "total": "16053.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO TRICLOROACÉTICO, GRADO REACTIVO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "863.04", "subtotal": "1726.08", "tax": "276.17", "other_taxes": null, "total": "2002.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMPICILINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6384.45", "subtotal": "12768.9", "tax": "2043.02", "other_taxes": null, "total": "14811.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "CALCOFLUOR WHITE STAIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1019.28", "subtotal": "1019.28", "tax": "163.08", "other_taxes": null, "total": "1182.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE CALCIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1548.45", "subtotal": "1548.45", "tax": "247.75", "other_taxes": null, "total": "1796.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE RUBIDIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2296.17", "subtotal": "2296.17", "tax": "367.38", "other_taxes": null, "total": "2663.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-(+)-GALACTOSE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2679.33", "subtotal": "2679.33", "tax": "428.69", "other_taxes": null, "total": "3108.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "DISOLUCIÓN ANTIBIÓTICA ANTIMICÓTICA (100X) ESTABILIZADA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1179.24", "subtotal": "2358.48", "tax": "377.35", "other_taxes": null, "total": "2735.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "DL-GLYCERALDEHYDE 3-PHOSPHATE DIETHYL ACETAL BARIUM SALT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15762.57", "subtotal": "15762.57", "tax": "2522.01", "other_taxes": null, "total": "18284.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "FORMALDEHÍDO EN SOLUCIÓN MÍN. 37% EXENTO DE ÁCIDO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1240.62", "subtotal": "4962.48", "tax": "793.99", "other_taxes": null, "total": "5756.47" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLURARALDEHIDO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1903.71", "subtotal": "1903.71", "tax": "304.59", "other_taxes": null, "total": "2208.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "INTERLEUKIN-17A HUMAN, IL-17A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4131.99", "subtotal": "4131.99", "tax": "661.11", "other_taxes": null, "total": "4793.1" }, { "number": "0", "cucop_code": "25101-0037", "description": "INTERLEUKIN-17F HUMAN, IL-17F", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4092.93", "subtotal": "4092.93", "tax": "654.86", "other_taxes": null, "total": "4747.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "INULIN FROM CHICORY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3880.89", "subtotal": "3880.89", "tax": "620.94", "other_taxes": null, "total": "4501.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOPROPANOL GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "886.29", "subtotal": "3545.16", "tax": "567.22", "other_taxes": null, "total": "4112.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "NICOTINAMIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1755.84", "subtotal": "1755.84", "tax": "280.93", "other_taxes": null, "total": "2036.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEINASE K FROM TRITIRACHIUM ALBUM", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4420.29", "subtotal": "8840.58", "tax": "1414.49", "other_taxes": null, "total": "10255.07" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE FENOL DE FOLIN Y CIOCALTEU", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1737.24", "subtotal": "5211.72", "tax": "833.87", "other_taxes": null, "total": "6045.59" }, { "number": "0", "cucop_code": "25101-0037", "description": "RPMI-1640 MEDIO (CON L-GLUTAMINA Y BICARBONATO DE SODIO, LÍQUIDO, ESTERILIZADO POR FILTRACIÓN, APTO PARA CULTIVO CELULAR)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1174.59", "subtotal": "5872.95", "tax": "939.67", "other_taxes": null, "total": "6812.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE SAFRANINA DE GRAM'S, PARA MICROSCOPÍA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6096.15", "subtotal": "6096.15", "tax": "975.38", "other_taxes": null, "total": "7071.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DECOLORANTE DE GRAM (MEZCLA DE ACETONA Y ETANOL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3200.13", "subtotal": "3200.13", "tax": "512.02", "other_taxes": null, "total": "3712.15" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN FORMALDEHÍDO PARA BIOLOGÍA MOLECULAR 36.5%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1409.88", "subtotal": "1409.88", "tax": "225.58", "other_taxes": null, "total": "1635.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE NÍQUEL (II) HEXAHIDRATADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3803.7", "subtotal": "3803.7", "tax": "608.59", "other_taxes": null, "total": "4412.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIMETROPRIM", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3645.6", "subtotal": "3645.6", "tax": "583.29", "other_taxes": null, "total": "4228.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 VISCOUS LIQUID", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1470.33", "subtotal": "1470.33", "tax": "235.25", "other_taxes": null, "total": "1705.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "SALES BILIARES OXOID™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3525.69", "subtotal": "3525.69", "tax": "564.11", "other_taxes": null, "total": "4089.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASA DE RÁBANO PIERCE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2618.49", "subtotal": "2618.49", "tax": "418.95", "other_taxes": null, "total": "3037.44" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "JUSTIFICACION.pdf", "availability": "available", "size_bytes": "585679", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:45:02.760Z", "updated_at": "2025-11-04T08:45:02.761Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "ANEXO TECNICO.pdf", "availability": "available", "size_bytes": "1920843", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:45:34.286Z", "updated_at": "2025-11-04T08:45:34.287Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "ARAVEL.pdf", "availability": "available", "size_bytes": "207645", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:45:51.072Z", "updated_at": "2025-11-04T08:45:51.073Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OF_ADJ_AD_443.pdf", "availability": "available", "size_bytes": "150393", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:46:10.514Z", "updated_at": "2025-11-04T08:46:10.515Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OF_ADJ_AD_447.pdf", "availability": "available", "size_bytes": "138309", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:46:28.681Z", "updated_at": "2025-11-04T08:46:28.682Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OF_ADJ_AD_451.pdf", "availability": "available", "size_bytes": "343026", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:54:09.381Z", "updated_at": "2025-11-04T08:54:09.382Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OF_ADJ_AD_458.pdf", "availability": "available", "size_bytes": "235120", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:54:31.166Z", "updated_at": "2025-11-04T08:54:31.167Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "ABALAT.pdf", "availability": "available", "size_bytes": "840743", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:54:53.101Z", "updated_at": "2025-11-04T08:54:53.103Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT BIOADVANCED.pdf", "availability": "available", "size_bytes": "408569", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:55:12.790Z", "updated_at": "2025-11-04T08:55:12.791Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT SILVERA.pdf", "availability": "available", "size_bytes": "298837", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:55:33.581Z", "updated_at": "2025-11-04T08:55:33.582Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT BIOSYS.pdf", "availability": "available", "size_bytes": "211120", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:55:54.637Z", "updated_at": "2025-11-04T08:55:54.638Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "STANDARDTEST.pdf", "availability": "available", "size_bytes": "231111", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:56:12.149Z", "updated_at": "2025-11-04T08:56:12.150Z" }, { "id": null, "annex_number": 14, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "LAUKA MEXICANA.pdf", "availability": "available", "size_bytes": "205503", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:56:25.067Z", "updated_at": "2025-11-04T08:56:25.068Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "CRISSOF.pdf", "availability": "available", "size_bytes": "157462", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:56:39.310Z", "updated_at": "2025-11-04T08:56:39.311Z" }, { "id": null, "annex_number": 16, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "DATHOLLI.pdf", "availability": "available", "size_bytes": "406681", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:56:51.174Z", "updated_at": "2025-11-04T08:56:51.175Z" }, { "id": null, "annex_number": 17, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "AD-453 OFI.pdf", "availability": "available", "size_bytes": "1679383", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:57:06.173Z", "updated_at": "2025-11-04T08:57:06.174Z" }, { "id": null, "annex_number": 18, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "455 COMER.pdf", "availability": "available", "size_bytes": "1338011", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:57:19.088Z", "updated_at": "2025-11-04T08:57:19.089Z" }, { "id": null, "annex_number": 19, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "449 HIR.pdf", "availability": "available", "size_bytes": "680923", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:57:31.213Z", "updated_at": "2025-11-04T08:57:31.214Z" }, { "id": null, "annex_number": 20, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "INNOVACION.pdf", "availability": "available", "size_bytes": "208683", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:57:47.335Z", "updated_at": "2025-11-04T08:57:47.336Z" }, { "id": null, "annex_number": 21, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "445 ofi.pdf", "availability": "available", "size_bytes": "1288677", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-04T08:58:02.554Z", "updated_at": "2025-11-04T08:58:02.555Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "aa-12-ncz-012ncz001-n-97-2024", "nombre_procedimiento": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "dependencia": "INP", "siglas": "INP", "score": 0.04548868672515971 }, { "numero_procedimiento": "aa-12-ncz-012ncz001-n-104-2023", "nombre_procedimiento": "PRODUCTOS QUIMICOS BASICOS", "dependencia": "INSTITUTO NACIONAL DE PEDIATRÍA", "siglas": "INP", "score": 0.053560495376586914 }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-46-2024", "nombre_procedimiento": "MATERIALES Y REACTIVOS PARA SER UTILIZADOS EN LOS PROTOCOLOS DE INVESTIGACION", "dependencia": "INER", "siglas": "INER", "score": 0.09772188053857411 }, { "numero_procedimiento": "aa-12-ndf-012ndf999-n-360-2024", "nombre_procedimiento": "PEDIDO MAYOR 520", "dependencia": "INR", "siglas": "INR", "score": 0.12426233291625977 }, { "numero_procedimiento": "aa-12-ncd-012ncd001-n-294-2025", "nombre_procedimiento": "ATTUNE WASH SOLUTION 250 ML", "dependencia": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "siglas": "INER", "score": 0.128801167011261 }, { "numero_procedimiento": "aa-12-ndf-012ndf999-n-562-2023", "nombre_procedimiento": "INR/2023/607 ACCESOLAB", "dependencia": "INR", "siglas": "INR", "score": 0.13036763668060303 } ] }