{ "html_url": "https://licitia.com.mx/adjudicacion/aa-12-ncz-012ncz001-n-97-2024", "canonical": "https://licitia.com.mx/adjudicacion/aa-12-ncz-012ncz001-n-97-2024", "id": "e54f9441950f4df3a9a175ef8b37dfa2", "procedure_number": "AA-12-NCZ-012NCZ001-N-97-2024", "file_number": "E-2024-00017791", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "description": { "short": "Equipos especializados, sustancias y materiales químicos, físico químico o bioquímico, para proyectos de investigación científica y desarrollo tecnológico.", "detailed": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "INP", "acronym": "INP", "branch": "12 - SALUD", "buying_unit": "DIRECCION DE ADMINISTRACION", "requesting_unit": "unidad requiriente data", "requesting_group": "DIRECCIÓN DE ADMINISTRACIÓN", "entity": "INSTITUTO NACIONAL DE PEDIATRIA", "slug": "inp", "unit_slug": "direccion-de-administracion-012ncz001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2024, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "38", "exception_basis": "Art. 41 fr. XVII", "internal_control_number": "COMITE 2A ORDINARIA 001 2024", "supply_source_number": null }, "schedule": { "published_at": "2024-03-02T00:15:14.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2024-03-01T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "ABALAT", "description": "REACTIVOS", "requirement_group_id": "123789", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1451276 - ANTIBIÓTICO-ANTIMICÓTICO (100X)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461389 - KIT PARA RT-PCR (TAQMAN REVERSE TRANSCRIPTION), MULTISCRIBE REVERSE TRANSCRIPTASE, RNASE INHIBITOR, DNTP MIXTURE, OLIGO D(T)16, RANDOM HEXAMERS, 10X RT BUFFER, MGCL2 SOLUTION.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461453 - KIT DE PURIFICACIÓN QIAQUICK PCR, PARA LA PURIFICACIÓN DE 250 REACCIONES PCR: 250 QIAQUICK SPIN COLUMNS, BUFFERS, COLLECTION TUBES (2 ML)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461455 - MINI KIT DE ADN QIAAMP®. PARA EL AISLAMIENTO DE ADN GENÓMICO, MITOCONDRIAL, BACTERIANO, PARASITARIO O VIRAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1462525 - RNASE A (17,500 U). VIAL CON 2.5 ML (100 MG/ML; 7000 UNIDADES/ML, SOLUCIÓN)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1462927 - KIT 1 KB PLUS DNA LADDER (1 KB PLUS DNA LADDERT (1 µG/µL) IN 10 MM TRIS-HCL (PH 7.5), 50 MM NACL, AND 1 MM EDTA)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463636 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12, POLVO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463802 - HIBRIDOMA-SFM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463854 - CLONEJET PCR CLONING KIT 20 REACT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463856 - GENERULER 100 BP DNA LADDER (MARCADOR DE PESO MOLECULAR, ESCALERA DE 100 BP TO 1000 BP )", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463857 - MARCADOR DE PESO MOLECULAR PARA DNA 50 BP", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464642 - PBS (SOLUCIÓN SALINA TAMPONADA CON FOSFATO), PH 7.4", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464665 - PIRUVATO DE SODIO (100 MM)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464730 - DNTP MIX CONTIENE: 10 MM DE CADA UNO DE DATP, DTTP, DCTP Y DGTP.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464733 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER, DE 10 A 180 KDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464737 - SPECTRA MULTICOLOR HIGH RANGE PROTEIN LADDER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1465465 - SOLUCIÓN DE AMINOÁCIDOS NO ESENCIALES MEM (100X)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466179 - AMNIOMAX- II COMPLETE MEDIUM", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466245 - BD PHARMINGEN FITC ANNEXIN V APOPTOSIS DETECTION KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466855 - MAXIMA PROBE/ROX QPCR MASTER MIX (200 X 25 µL RXNS)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466871 - MEDIO RPMI (L-GLUTAMINA Y ROJO FENOL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466873 - PLATINUM TAQ DNA POLIMERASE HIGH FIDELITY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466875 - SUPLEMENTO B-27 (50X), SIN SUERO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467860 - CTS GLUTAMAX-I SUPPLEMENT (100X)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467877 - TAQ DNA POLYMERASE, RECOMBINANT 100RX", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467929 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE 3000", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468160 - FASTDIGEST BAMHI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468757 - BD PERCP MOUSE ANTI-HUMAN CD3 (20 µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468812 - AGUA LIBRE DE NUCLEASAS (NO TRATADA CON DEPC)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468820 - MEDIO DMEM/F-12, GLUTAMAX SUPPLEMENT", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468826 - ULTRAPURE DITHIOTHREITOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468894 - BUFFER ATL (4X50ML) GPR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469020 - MAXIMA SYBR GREEN/ROX QPCR MASTER MIX (2X)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469022 - PHUSION HIGH-FIDELITY DNA POLYMERASE (2 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469023 - 2-NBDG (2-(N-(7-NITROBENZ-2-OXA-1,3-DIAZOL-4-YL)AMINO)-2-DEOXYGLUCOSE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469025 - DMEM, ALTO CONTENIDO EN GLUCOSA", "requested_quantity": "19", "minimum_quantity": "19", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469026 - ENZIMA DE RESTRICCIÓN DPNI (10 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469029 - ULTRAPURE AGAROSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469033 - DEPC-TREATED WATER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469301 - PET151 DIRECTIONAL TOPO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469431 - TRIPSINA-EDTA (0.05 %), ROJO FENOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469432 - XTT (2,3-BIS-(2-METOXI-4-NITRO-5-SULFOFENIL)-2H-TETRAZOLIO-5-CARBOXANILIDA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469433 - AMPLITAQ GOLD DNA POLYMERASE, WITH BUFFER II AND MGCL2, 3000 UNITS (12 TUBES X 50 UL, 250 UNITS PER TUBE)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469509 - PROTEASA ACTEV", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469517 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469529 - HUMAN EGF (EPIDERMAL GROWTH FACTOR) RECOMBINANT PROTEIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469643 - AMPLITAQ GOLD 360 MASTER MIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470345 - GENECHIP® HYBRIDIZATION WASH AND STAIN KIT FOR 30 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469651 - SEQUENCE DETECTION PRIMER", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470483 - BD CYTOFIX/CYTOPERM. FIXATION/PERMEABLIZATION KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469697 - BD PHARMINGEN FITC MOUSE ANTI-HUMAN CD69 (20 µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469759 - GIBCO 2-MERCAPTOETHANOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469045 - OPTI-MEM I REDUCED SERUM MEDIUM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469763 - SOLUCIÓN SALINA EQUILIBRADA DE HANK´S (HBSS, SIN CALCIO, SIN MAGNESIO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469768 - 100 BP DNA LADDER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469781 - INDICADOR ROJO DE SUPERÓXIDO MITOCONDRIAL MITOSOX, PARA IMÁGENES DE CÉLULAS VIVAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470396 - SUPERMIX DE SÍNTESIS DE PRIMERA CADENA SUPERSCRIPT III", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469793 - ANTICUERPO RECEPTOR A ANDROGENOS POLICLONAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469869 - MINI KIT DE SANGRE DE ADN QIAAMP (250)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470762 - CYP1A2 BACULOSOMES PLUS REAGENT, RHUMAN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470404 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER PLUS, DE 10 A 250 KDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470762 - LIGADURA RÁPIDA DE ADN KIT", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470954 - CD4 FITC/CD8 PE/CD3 PERCP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471010 - MEDIO RPMI 1640 (MEDIO ROSWELL PARK MEMORIAL INSTITUTE 1640), SIN GLUCOSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471014 - TRIPSINA-EDTA (0,25%), ROJO DE FENOL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471025 - ANTICUERPO POLICLONAL CYP2C11 CONEJO ANTI-FELINO, HUMANO, RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471027 - ANTICUERPO POLICLONAL FCGRT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471032 - CYP2J2 CONEJO ANTIHUMANO, RATÓN, RATA, POLICLONAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471040 - KIT DE ELISA PARA INSULINA HUMANA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471044 - KIT ELISA HUMANO PARA ADIPONECTINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471057 - KIT DE ELISA PARA LEPTINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471142 - KIT DE ADN QIAAMP POWERFECAL PRO", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471146 - KIT DE SANGRE Y TEJIDO DNEASY (50). MINICOLUMNAS, PROTEINASA K, TAMPONES, TUBOS DE RECOGIDA (2 ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471152 - PUREGENE® SOLUCIÓN DE PRECIPITACIÓN DE PROTEÍNAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471316 - GLUCÓGENO, GRADO DE BIOLOGÍA MOLECULAR", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471324 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471455 - ENZIMAS DE RESTRICCIÓN NDEI (10 U/µL)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471456 - MEDIO DE CARIOTIPADO PB-MAX", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471457 - BUFFER TE LOW", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471458 - ENZIMA DE RESTRICCIÓN BAMHI (10 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471459 - ENZIMA DE RESTRICCIÓN FASTDIGEST XHOI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471460 - LIGASA DE ADN T4 (5 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471461 - TRANSCRIPCIÓN INVERSA SUPERSCRIPT III (200 U/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471462 - MINIPASTILLAS INHIBIDORAS DE FOSFATASAS PIERCE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471463 - TRUEGUIDE MODIFIED SGRNA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471464 - PROTEÍNA CAS9 V2 TRUECUT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471465 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE CRISPRMAX CAS9", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471466 - KIT DE DETECCIÓN DE DISOCIACIÓN GENÓMICA GENEART", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471467 - TRUEGUIDE SGRNA CONTROL NEGATIVO, NO DIRIGIDO 1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471468 - TRUEGUIDE SGRNA POSITIVE CONTROL, AAVS1 (HUMANO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471469 - MINI KIT DE PLÁSMIDOS (25)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471470 - GLUCÓGENO (5 MG/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471471 - SOLUCIÓN DE LISIS CELULAR PUREGENE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471472 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO), POLVO, ALTO CONTENIDO EN GLUCOSA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471473 - SOLUCIÓN DE HIDRATACIÓN DE ADN PUREGENE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471474 - ANTICUERPO POLICLONAL CD42B", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471475 - ANTICUERPO POLICLONAL DE FIBRINÓGENO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471476 - ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA IGG (H+L) ANTI-RATÓN DE CABRA, BIOTINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471477 - SULFO-NHS-LC-BIOTINA EZ-LINK", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471478 - ESTREPTAVIDINA, CONJUGADO ALEXA FLUOR 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471479 - ESCALERA DE ADN DE 1 KB GENERULER PLUS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471480 - IONOMICINA, SAL DE CALCIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471481 - ANTIHUMANO CD154 DE RATÓN PE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471482 - ANTI-PERFORINA HUMANA, PE MOUSE IGG2B, KIT CON CONTROL DE ISOTIPO ¿ (ANTI-DANSYL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471483 - ESTREPTAVIDINA PE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471484 - ANTICUERPO POLICLONAL ANTI-CONEJO DE CABRA CONJUGADO CON FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471485 - RATÓN ALEXA FLUOR 647 ANTI-FOXP3 HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471486 - BD BBL SENSI-DISC AMPICILINA CON SULBACTAM SAM-20 (10 µG)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471487 - BD BBL SENSI-DISC AMOXICILINA CON ÁCIDO CLAVULÁNICO AMC-30 (20/10 MICROGRAMOS)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471488 - MEDIO NEUROBASAL SIN ROJO FENOL", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471489 - SOLUCIÓN DE DETERGENTE NP-40 SURFACT-AMPS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471490 - SUSTRATO DE SENSIBILIDAD QUIMIOLUMINISCENTE PARA IDENTIFICAR DE PROTEÍNAS DE ALTO ATTOGRAMO SUPERSIGNAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471491 - ANTICUERPO POLICLONAL ANTI-EPXH2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471492 - ANTICUERPO NFKB P50 MONOCLONAL (2J10D7)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471493 - ANTICUERPO POLICLONAL C-REL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471494 - ANTICUERPO POLICLONAL RELB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471495 - ANTICUERPO MONOCLONAL IBA1 (GT10312)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471496 - KIT DE ENSAYO DE PROTEÍNAS PIERCE COOMASSIE (BRADFORD)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471497 - ANTICUERPO MONOCLONAL DE CONEJO RECOMBINANTE GLUT2 (JJ20-21)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471498 - RNEASY MINI KIT (50)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471499 - QIAAMP DNA FFPE TISSUE KIT (50)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471500 - KIT RNEASY DSP FFPE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471501 - MINIGELES DE PROTEÍNAS NUPAGE, BIS-TRIS DEL 4 AL 12 %, 1,0–1,5 MM. X 10 POCILLOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "2", "name": "ACCESORIOS PARA LABORATORIOS", "description": "REACTIVOS", "requirement_group_id": "123774", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461624 - SUERO FETAL BOVINO, CERTIFICADO DE EE.UU", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464112 - AMPICILINA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464809 - ETHANOL FOR MOLECULAR BIOLOGY FCO 250 ML", "requested_quantity": "13", "minimum_quantity": "13", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467876 - DNTP MIX (10 MM EA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467893 - ETANOL ABSOLUTO PARA ANÁLISIS EMPARTA® ACS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468827 - MARROWMAX™ MEDIO PARA MÉDULA ÓSEA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468888 - THERMO SCIENTIFIC™ PIERCE™ SUPERSIGNAL™ SUPERSIGNAL MOLECULAR WEIGHT PROTEIN LADDER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468926 - HIDROQUINONA (HYDROQUINONE REAGENTPLUS®, >=99%)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469309 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, POD (IN SITU CELL DEATH DETECTION)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469511 - AGAROSA ULTRAPURE™", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470589 - ACETONITRILO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470591 - KAPA SYBR® FAST ONE-STEP. QRT-PCR KITS - 100 X 20 µL REACTIONS (UNIVERSAL)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469932 - ANTI-MOUSE IGG (FC SPECIFIC)–PEROXIDASE ANTIBODY PRODUCED IN GOAT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470711 - FISETIN", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471157 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, FLUORESCEÍNA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471238 - FLUORURO DE SODIO (NAF)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471536 - TIZOXANIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471540 - NADPH", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471554 - KAPA HIFI HOTSTART+DNTPS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471559 - 3- O -METILQUERCETINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471616 - KIT CYTOSCAN™ 750K PLUS 24", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471617 - KIT CYTOSCAN™ 750K SUITE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471632 - KIT DE EXTRACCIÓN DE GEL EZNA® (V-SPIN)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471666 - KIT PARA DETERMINACIÓN IL-6 HUMANA DUOSET® ELISA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471701 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, RÁPIDO), MONOCLONAL DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471702 - ANTICUERPO MONOCLONAL ANTI-DNA/RNA DAÑO PRODUCIDO EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471704 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, LENTO) PRODUCIDO EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471705 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, RÁPIDO)-FOSFATASA ALCALINA PRODUCIDO EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471729 - 2-METILBUTANO, PARA ESPECTROSCOPIA UVASOL®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471735 - DAPI, DICLORHIDRATO (TINTE DE UNIÓN AL ADN PERMEABLE A LAS CÉLULAS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471772 - ANTICUERPO ANTI-BRAF (V600E), MONOCLONAL DE CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "3", "name": "APPLIED BIOSYSTEMS DE MEXICO", "description": "REACTIVOS", "requirement_group_id": "123790", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463628 - TAQMAN™ TAMRA PROBE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464603 - TAQMAN™ CYP4A11. ENSAYOS DE EXPRESIÓN GÉNICA HS04194779_G1 FAM-MGB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464604 - TAQMAN™ CYP4F2. ENSAYOS DE EXPRESIÓN GÉNICA HS00426608_M1 FAM-MGB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1465346 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468730 - TAQMAN™ CYP4F3 TAQMAN GENE EXPRESSION ASSAYS HS01587860_MH", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469225 - TAQMAN GENE EXPRESSION MASTER MIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469441 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469673 - TAQMAN™ GENOTYPING MASTER MIX", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470371 - TAQMAN™ MGB PROBE (LABEL 5\" ,FAM™, VIC™, TET™, Y NED™ , 6-FAM™)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469676 - TAQMAN™ MGB PROBE (6-FAM™)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468719 - TAQMAN™ MICRORNA REVERSE TRANSCRIPTION KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470887 - TAQMAN™ ARRAY, HUMAN CYP450 & OTHER OXYGENASES, FAST 96-WELL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470892 - TAQMAN™ FAST ADVANCED, MEZCLA MAESTRA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470894 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHR. ASSAY ID: HS00169233_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470895 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHRR. ASSAY ID: HS01005075_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470896 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: ARNT. ASSAY ID: HS01121918_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470897 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: CYP2J2. ASSAY ID: HS00356035_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470898 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: EPHX2. ASSAY ID: HS00932316_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470899 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: KEAP1. ASSAY ID: HS00202227_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470901 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFE2L2. ASSAY ID: HS00975961_G1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470902 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARA. ASSAY ID: HS00947536_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470903 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARG. ASSAY ID: HS01115513_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470904 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1804538. GENE: TOP2A. ASSAY ID: C___7477997_20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470905 - TAQMAN™ GENOTYPING ASSAY SNP ID:RS2236168. GENE: XDH. ASSAY ID: C__26435993_20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470906 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS373455425. GENE: XDH. ASSAY ID: C_365253619_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470908 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS487121. GENE: MIR924HG. ASSAY ID: C___2313112_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470909 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS4987121. GENE: CBR3 ASSAY ID: C__43955396_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470910 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1800566. GENE: NQO1. ASSAY ID: C___2091255_30", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470911 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS2835286. GENE: CBR3-AS1. ASSAY ID: C__16075424_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470912 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS3014216. GENE: AKR1A1. ASSAY ID: C__11869471_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470913 - TAQMAN™ MATRIZ, NFKB HUMANA,", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470914 - TAQMAN™ MATRIZ, TRANSPORTADORES HUMANOS DE FÁRMACOS, RÁPIDO DE 96 POCILLOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471561 - TAQMAN™ GTXPRESS™ MASTER MIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471562 - TAQMAN™ GENOTYPING ASSAY SNP RS1065411, GENE: GSTM1  ASSAY ID: C__44202997_20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471563 - TAQMAN™ SNP GENOTYPING ASSAY, HUMAN. SNP ID:RS1056806. GENE GSTM1, ASSAY ID: C_175674977_10.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471565 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP: RS749174, GENE: GSTP1. ASSAY ID:C___3237199_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471566 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP:RS762803, GENE: GSTP1, ASSAY ID: C___3237197_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471613 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS4132601 GENE IKZF1. ASSAY ID: C__26019772_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471614 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP RS2836371 GENE ERG. ASSAY ID: C__2439755_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471615 - TAQMAN™PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS3731249. GENE CDKN2A . ASSAY ID: C__25611114_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471618 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS7090445 GENE ARID5B. ASSAY ID: C__30203240_10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471750 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELA. ASSAY ID: HS01042014_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471751 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELB. ASSAY ID: HS00232399_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471752 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFKB1. ASSAY ID: HS00765730_M1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471755 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: RAT. GENE: AIF1. ASSAY ID: RN03993468_G1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "4", "name": "BIOADVANCED SYSTEMS", "description": "REACTIVOS", "requirement_group_id": "123779", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1459666 - TRIZOL™ REAGENT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461996 - FAST SYBR® GREEN MASTER MIX", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468717 - MULTISCRIBE™ REVERSE TRANSCRIPTASE ( 50 UNITS / µL)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469217 - MICROAMP™ OPTICAL ADHESIVE FILM (96-WELL, STANDARD PLATE)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471330 - HOSTZERO™ MICROBIAL DNA KIT", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471334 - ZYMOTAQ™ PREMIX", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471511 - SALIVA DNA COLLECTION AND PRESERVATION DEVICES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471512 - SALIVA DNA ISOLATION KIT,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471656 - KIT MAGMAX™ ADN MULTIMUESTRA ULTRA 2.0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471657 - DYNABEADS® DNA DIRECT™ UNIVERSAL KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471726 - SUERO BOVINO FETAL, DESPOJADO DE CARBÓN VEGETAL, REGIONES APROBADAS POR EE.UU", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471774 - CLARIOM™ D ARRAY, HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471775 - ENSAYO GENECHIP™ GENOMA HUMANO U133 PLUS 2.0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471778 - KIT QUICK -DNA/RNA MAGBEAD", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "5", "name": "BIOSYSTEMS CORP", "description": "REACTIVOS", "requirement_group_id": "123781", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471776 - KIT DE CODIFICACIÓN DE BARRAS PCR-CDNA 24", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471777 - KIT DE LAVADO DE CELDA DE FLUJO (MINION™ Y PROMETHION™)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471779 - VIALES AUXILIARES DE SECUENCIACIÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "6", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS", "description": "REACTIVOS", "requirement_group_id": "123787", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463983 - GLUTATHIONE REDUCTASE ACTIVITY KIT", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464717 - KIT PARA MEDICIÓN DE T3 EN SUERO DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464718 - KIT PARA MEDICIÓN DE T4 EN SUERO DE RATA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1465512 - DAB (3,3’-DIAMINOBENZIDINE ) CHROMOGEN SYSTEM. KIT DE 100 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468876 - ANTICUERPO PRIMARIO BDNF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470497 - ALEXA FLUOR® 647 ANTI-HUMAN CD127 (IL-7R?) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469733 - 20-HETE (20-HYDROXY ARACHIDONIC ACID)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469740 - KIT DETERMINACIÓN TESTOSTERONA 96 POZOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470731 - RESORUFIN ETHYL ETER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470938 - BD BBL™ SENSI-DISC™ LINEZOLID, 30 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470965 - APC/CYANINE7 ANTI-HUMAN CD196 (CCR6) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470970 - PE ANTI-HUMAN CD183 (CXCR3) ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470980 - SUCCINIL-COA SINTETASA ( E. COLI )", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471506 - DETECCIÓN UNIVERSAL DE POLÍMERO HRP MACH 1™", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471513 - KIT ELISA DEL FACTOR NEUROTRÓFICO DERIVADO DEL CEREBRO DE RATA. (BDNF): BRAIN DERIVED NEUROTROPHIC FACTOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471514 - KIT ST ELISA, SEROTONINA DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471515 - HIDRATO DE SULFURO DE SODIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471533 - 2-AMINOBENZOXAZOLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471569 - NANOCOMPOSIX SILVER NANOSPHERES, 10 NM (BIOPURE, 1 MG/ML, BARE (CITRATE), 1 ML, AQUEOUS 2 MM SODIUM CITRATE)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471580 - Z -FR-AMC FLUOROGENIC PEPTIDE SUBSTRATE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471584 - KIT DE ENSAYO DE MICROPLACAS DE HEXOQUINASA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471585 - KIT DE ENSAYO DE ACTIVIDAD DE 6-FOSFOFRUCTOQUINASA (PFK)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471586 - KIT DE ENSAYO COLORIMÉTRICO DE PIRUVATO QUINASA (PK)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471590 - CÉLULAS HEK-BLUE™-HTLR5 (CÉLULAS SEAP REPORTER 293 QUE EXPRESAN EL GEN TLR5 HUMANO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471594 - INTEGRINA ALFAV, BETA3, PROTEÍNA ACTIVA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471595 - COFILINA 1, NO MUSCULAR (CFL1), PROTEÍNA ACTIVA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471612 - AGAROSA LE, EEO BAJO, GRADO DE BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471624 - ANTICUERPO CD34 ANTI-RATÓN PURIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471625 - ANTICUERPO RECOMBINANTE ANTI-CD45 DE RATÓN PURIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471626 - ANTICUERPO CD54 O ICAM-1, ANTI-RATÓN PURIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471627 - ANTICUERPO ANTI-RATÓN CD284 (TLR4) PURIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471628 - ANTICUERPO DE GALECTINA-3 (MAC-2) ANTI-RATÓN/HUMANO PURIFICADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471634 - DETECCIÓN RATÓN HRP-POLÍMERO MACH 2™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471640 - PROTEÍNA IL-12 HUMANA RECOMBINANTE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471641 - PROTEÍNA IL-23 HUMANA RECOMBINANTE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471646 - ANTICUERPO ANTI-CD25 HUMANO PACIFIC BLUE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471649 - ANTIHUMAN CD4 PERCP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471650 - ANTICUERPO ANTI-CD45RA HUMANO FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471651 - ANTICUERPO BIOTINILADO DE IFN-GAMMA HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471652 - ANTICUERPO BIOTINILADO IL-6 HUMANO/PRIMATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471653 - ANTICUERPO BIOTINILADO IL-17/IL-17A HUMANO/PRIMATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471660 - ÁCIDO DL- P -HIDROXIFENILLÁCTICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471663 - ÁCIDO 3-HIDROXIPROPIÓNICO, SOLUCIÓN AL 30% EN AGUA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471667 - KIT PARA DETERMINACIÓN TNF-ALFA HUMANO DUOSET® ELISA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471668 - KIT PARA DETERMINACIÓN IL-10 HUMANA DUOSET® ELISA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471675 - MENADIONA (K3)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471697 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU , AP", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471703 - ANTICUERPO ANTI-COLINA ACETILTRANSFERASA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471707 - KIT DE ELISA ULTRA SENSIBLE PARA DETECTAR INSULINA DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471730 - PANEL DE INFLAMACIÓN DE RATAS LEGENDPLEX™ (13-PLEX) CON FP V02", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471733 - ANTICUERPO DE CABRA ANTI-IGG HUMANA, EL CONJUGADO HRP DETECTA EL NIVEL DE IGG HUMANA Y HA SIDO PUBLICADO Y VALIDADO PARA SU USO EN ELISA Y WB.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471734 - KIT DE TINCIÓN DE MITOCONDRIAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471742 - (±)14(15)-EET", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471745 - ARREGLO DE INFLAMACIÓN HUMANA C3", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471746 - MATRIZ C2 DE NF-¿B HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471748 - PROTEÍNA RECOMBINANTE CYP2J2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471761 - KIT PARA MEDICIÓN DE LONGITUD DE TELOMEROS POR CITOMETRÍA DE FLUJO PNA KIT/FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471764 - SULFATO DE CEFTOLOZANO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471769 - ANTICUERPO BIOTINA ANTI-IGE HUMANA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471770 - ANEXINA V FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471771 - AGENCOURT® RNACLEAN® XP, 40ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "7", "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE", "description": "REACTIVOS", "requirement_group_id": "123751", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1451016 - FOSFATO DE SODIO, DIBÁSICO, ANHIDRO, REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463996 - ETHANOL ABSOLUTO PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464015 - ETHANOL ABSOLUTE FOR ANALYSIS EMSURE AC", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464018 - EXTRAN® MA 02 SUPELCO®, LÍQUIDO, NEUTRO, CONCENTRADO", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464103 - 2-PROPANOL (ISOPROPANOL GRADO BIOLOGÍA MOLECULAR )", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464120 - D-GLUCOSE 6 PHOSPHATE DISODIUM SALT HYDRATE", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464128 - ETANOL ABSOLUTO GRADO BIOL. MOL", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464157 - PHENOL-CLOROFORMO-ISOAMILICO (25:24:1)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464177 - TWEEN 20 VISCOUS LIQUID", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464762 - METANOL SUPELCO® PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466198 - COMPLETE™ PROTEASE INHIBITOR COCKTAIL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466209 - DNASE I RECOMBINANT, RNASE-FREE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466296 - TRIPTONA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466877 - CLORURO DE SODIO, CRISTAL, BAKER ANALYZED™ A.C.S. REACTIVO,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466967 - O-PHENYLENEDIAMINE DIHYDROCHLORIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467895 - HIDRÓGENO PERÓXIDO 30%", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468013 - BRDU", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468047 - GLYCEROL", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468734 - AZUL TRIPÁN SOLUCIÓN DE 0.4%, LÍQUIDO, FILTRADO ESTÉRIL, ADECUADO PARA CULTIVO CELULAR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468746 - BACTO™ AGAR SOLDIFYING AGENT, BD DIAGNOSTICS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468841 - ÁCIDO ORTO-FOSFÓRICO 85% (EMSURE® ACS, ISO, REAG.)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468842 - ACEITE DE INMERSIÓN PARA MICROSCOPIA (INMERSION OIL FOR MICROSCOPY)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468877 - CELL PROLIFERATION KIT II (XTT)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468898 - DTT 1,4-DITHIOTHREITOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468899 - COMPLETE™, MINI, EDTA-FREE PROTEASE INHIBITOR COCKTAIL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468916 - CHLORAMPHENICOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468938 - QUERCETINA (QUERCETIN) 95% (HPLC), SÓLIDO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468949 - AGAROSA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468958 - AURANOFIN ?98% (HPLC)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468977 - HEMATOXYLIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468993 - AMERSHAM™ PROTRAN® WESTERN BLOTTING MEMBRANES, NITROCELLULOSE ( 0.45 ?M, SHEET W × L 100 MM × 100 MM)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468997 - PROTEINASE K FROM TRITIRACHIUM ALBUM", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469001 - RESVERATROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469307 - HUMAN ADIPONECTIN ELISA KIT 96 PZOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469376 - CITOCROMO C DE CORAZÓN BOVINO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469392 - ISOPROPANOL GRADO BIOLOGÍA MOLECULAR", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469394 - LB BROTH, MILLER, MEDIO DE CULTIVO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469414 - SULFATO DE MAGNESIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469423 - CLORHIDRATO DE CISTEAMINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470488 - CALDO SOYA TRIPTICASEÍNA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469823 - ANTI-NEUN ANTIBODY, CLONE A60 CHEMICON® DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469894 - LECTIN FORMO PHASEOLUS VULGARIS (RED KIDNEY BEAN)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469906 - ETANOL GRADO BIOLOGIA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469915 - N,O-BIS(TRIMETHYLSILYL)TRIFLUOROACETAMIDE WITH TRIMETHYLCHLOROSILANE FOR GC DERIVATIZATION, LICHROPUR™, CONTAINS 1% TMCS, 99% (EXCLUDING TMCS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470690 - MALTOSA (D-(+)-MALTOSA MONOHIDRATO)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470702 - BUTYRYL COENZYME A LITHIUM SALT HYDRATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470718 - KAEMPFEROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470722 - MINIMUM ESSENTIAL MEDIUM EAGLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470724 - MYRICETIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470732 - S-(5?-ADENOSYL)-L-METHIONINE CHLORIDE DIHYDROCHLORIDE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469969 - TARTRATO DE POTASIO Y SODIO TETRAHIDRATADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469971 - TRICINE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469977 - CELL PROLIFERATION REAGENT WST-1", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469982 - ADENOSINE 5´-TRIPHOSPHATE DISODIUM SALT HYDRATE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470945 - SOBRES DE SISTEMA DE RECIPIENTES DE CO2 GASPAK™ EZ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471103 - TAMPÓN DE LISIS RIPA, 10X, PARA INMUNOPRECIPITACIÓN Y TRANSFERENCIA WESTERN.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471105 - ACETONITRILO HIPERGRADO PARA LC-MS LICHROSOLV®", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471106 - METANOL PARA CROMATOGRAFÍA LÍQUIDA LICHROSOLV®", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471156 - GLUCOSA-6-FOSFATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471195 - 5,5'-DITHIOBIS(2-NITROBENZOIC ACID): (DTNB).BIOREAGENT®", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471200 - ÁCIDO BÓRICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471207 - ALCOHOL ETÍLICO PURO (ETANOL), PARA 200 PRUEBAS BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471220 - CLORHIDRATO DE VITAMINA B12A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471224 - COENZIMA A HIDRATO (COA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471240 - GUANOSINE 5'-DIPHOSPHATE SODIUM SALT (GDP)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471257 - METILMALONIL COENZIMA A TETRALITIO SAL HIDRATADA (MM-COA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471265 - PHOSPHATE BUFFERED SALINE. PH 7.4, PHAST PACK™, POWDER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471271 - RPMI-1640 MEDIO (CON L-GLUTAMINA Y BICARBONATO DE SODIO, LÍQUIDO, ESTERILIZADO POR FILTRACIÓN, APTO PARA CULTIVO CELULAR)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471282 - SOLUCIÓN DE ROJO FENOL", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471294 - ß-NAPHTHOFLAVONE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471504 - GLICEROL PARA BIOLOGÍA MOLECULAR, =99,0%", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471507 - METRONIDAZOL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471508 - ALBENDAZOL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471516 - CITRATO DE SODIO TRIBÁSICO DIHYDRATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471526 - TEMOZOLOMIDA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471527 - 2-AMINO-5-NITROTHIAZOLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471528 - CLOROQUINA SAL DE DIFOSFATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471529 - SULFATO DE HIDROXICLOROQUINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471530 - NITAZOXANIDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471531 - 2-AMINOTHIAZOLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471532 - 2-AMINOBENZOTHIAZOLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471534 - 2-AMINO-6-NITROBENZOTIAZOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471535 - 2-AMINO-6-METILBENZOTIAZOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471537 - ISPF (A-ISONITROSOPROPIOPHENONE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471538 - GLUTAMATO DESHIDROGENASA (GLDH) DE HÍGADO DE RES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471539 - UREASA DE CANAVALIA ENSIFORMIS (JUDÍA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471541 - POLYVINYLPYRROLIDONE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471542 - TETRACICLINA CLORHIDRATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471544 - GENTAMICINA SULFATE SALT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471545 - TAURINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471546 - ANFOTERICINA B SOLUTION", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471547 - PIRUVATO SÓDICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471548 - SAL TRISÓDICA DE INOSINA 5'-TRIFOSFATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471549 - ZIDOVUDINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471550 - SULFATO DE COBRE (II)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471551 - UREA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471552 - CITRATO DE HIERRO Y AMONIO (III)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471553 - CEFALOTINA SAL SÓDICA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471555 - ACETONITRILO, GRADO HPLC, 99.9% DE PUREZA", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471556 - EXTRAN® MA 05 (LÍQUIDO, ALCALINO, CONCENTRADO SIN FOSFATOS)", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471560 - KAEMPFEROL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471567 - ANTIBIOTIC ANTIMICOTIC SOLUTION (100X), STIBILIZED", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471570 - AGAR CETRIMIDA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471571 - COLLAGEN FROM HUMAN PLACENTA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471572 - ASPARAGINE PROLINE BROTH", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471573 - NESSLER'S REAGENT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471577 - SUCCINATO DE SOLIFENACINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471578 - BROMHIDRATO DE DARIFENACINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471582 - SODIO CARBONATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471583 - L-CARNOSINE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471592 - SOLUCIÓN DE D-GLICERALDEHÍDO 3-FOSFATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471599 - FENOL, PARA BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471600 - DODECILSULFATO DE SODIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471601 - CLORURO DE GUANIDINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471602 - ACETATO DE POTASIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471603 - CITRATO DE SODIO TRIBÁSICO DIHIDRATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471604 - ACETATO DE SODIO TRIHYDRATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471605 - KIT DE TRADUCCIÓN DE NICK", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471606 - FLUORESCEÍNA-12-DUTP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471608 - TETRAMETIL-RODAMINA-5-DUTP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471611 - TIMIDINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471621 - EVANS BLUE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471623 - PROTEÍNA A-SEPHAROSE ® DE STAPHYLOCOCCUS AUREUS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471635 - ACETATO DE LEUPRORELINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471637 - PROGESTERONA (POLVO, BIOREAGENT, APTO PARA CULTIVO CELULAR)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471658 - AGUA GRADO UHPLC, PARA USO EN ESPECTROMETRÍA DE MASAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471659 - ÁCIDO 4-HIDROXI-FENILPIRÚVICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471661 - ÁCIDO 4-HIDROXI-FENIL-ACÉTICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471662 - ÁCIDO METILMALÓNICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471664 - ÁCIDO ß-HIDROXIISOVALÉRICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471665 - ÁCIDO 4-METIL-2-OXOVALÉRICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471669 - AGAR SOYA BD BBL™ TRYPTICASE™ (MEDIO DE AGAR DIGERIDO DE SOJA Y CASEÍNA)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471674 - DISCOS DE FACTOR X", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471680 - SOLUCIÓN DE HEMINA (0.5 G/L)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471681 - TIMIDINA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471686 - BD DIFCO ™ CALDO MUELLER HINTON 500G", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471687 - GENTAMICINA SAL DE SULFATO DE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471689 - DALVABANCINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471690 - DAPTOMICINA (ANTIBIÓTICO LIPOPÉPTIDO CÍCLICO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471691 - SAL DE MESILATO DE DEFEROXAMINA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471692 - 1,1,3,3-TETRAETOXIPROPANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471693 - QUERCETIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471694 - REACTIVO DE FENOL DE FOLIN & CIOCALTEU", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471699 - HEXAHIDRATO DE CLORURO DE COBALTO (II). REACTIVO ACS, 98%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471700 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, LENTO), MONOCLONAL DE RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471724 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, TMR ROJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471725 - ELTROMBOPAG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471736 - POLIVINILPIRROLIDONA (PESO MOLAR PROMEDIO 40,000)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471740 - ÁCIDO GÁLICO ANHIDRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471756 - CH-223191", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471757 - CLOTETRACICLINA (CTC)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471758 - LECTINA DE ARACHIS HIPOGAEA (MANÍ)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471759 - HIALURONIDASA DE TESTÍCULOS BOVINOS. TIPO IV-S, POLVO LIOFILIZADO (ESENCIALMENTE SIN SAL), 750-3000 UNIDADES/MG DE SÓLIDO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471766 - AVIBACTAM SÓDICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471768 - SOLUCIÓN PREPARADA DE FLEOMICINA (0,2 µM FILTRADO, 20 MG/ML EN HEPES DE 20 MM)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471780 - MEZCLA ESTÁNDAR DE ÉSTERES METÍLICOS DE ÁCIDOS GRASOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471782 - IONÓFORO DE CALCIO A23187. =98% (TLC), POLVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471783 - M16 MEDIUM", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466955 - ESTROPTOZOCINA, >=75 % EN BASE A ANÓMERO ALFA, >=98 % (HPLC), POLVO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "8", "name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL", "description": "REACTIVOS", "requirement_group_id": "123784", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464621 - BD BBL™ AGAR SAL Y MANITOL, 500 G", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470924 - BD BBL™ BASE DE AGAR SANGRE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470957 - SENSIDISCOS DE AMPICILINA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470958 - SENSIDISCOS DE VANCOMICINA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471502 - AGAROSA D1 BAJA EEO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471655 - LYSE/FIX BUFFER 5X", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471677 - DISCO DE PRUEBA DE SUSCEPTIBILIDAD ANTIMICROBIANA SENSI-DISC™ CEFAZOLINA 30 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471682 - BD SENSI-DISC ™ PENICILINA P-10 UNIDADES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471683 - BBL™ SENSI-DISC™ TETRACICLINA 30 µG", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471684 - DISCO OXACILINA OX-1 µG", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471685 - BD SENSI-DISC™ TOBRAMICINA 10 µG", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471688 - SENSIDISCOS DE GENTAMICINA ALTA CARGA\nBD SENSI-DISC™ GENTAMICINA 120 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471765 - AGAROSA D5", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "9", "name": "EQUIVER", "description": "REACTIVOS", "requirement_group_id": "123775", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1456677 - PROFINITY™ IMAC RESIN, NI-CHARGED 25 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1461235 - 30% ACRYLAMIDE/BIS SOLUTION", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467793 - SOLUCIÓN BLOQUEADORA (BLOTTING-GRADE BLOCKER)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469262 - DITHIOTHREITOL (DTT)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469498 - PRECISION PLUS PROTEIN™ KALEIDOSCOPE™ PRESTAINED PROTEIN STANDARDS (500 µL, MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES (10–250 KD))", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469499 - PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS (MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES TEÑIDAS DE AZUL (10–250 KD), INCLUIDAS TRES BANDAS DE REFERENCIA (25, 50, 75 KD), 50 APLICACIONES)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469726 - MINI-PROTEAN® TGX™ 4–15% PRECAST PROTEIN GELS, 10-WELL, 30 µL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469730 - TEMED (TETRAMETHYLETHYLENEDIAMINE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469731 - 30% ACRYLAMIDE/BIS SOLUTION, 29:1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470973 - IMMUNO-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M (1 ROLL, 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471607 - COLUMNAS DE GEL MICRO BIO-SPIN™ P-30, TAMPÓN TRIS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471722 - ESTÁNDARES DE TRANSFERENCIA PRECISION PLUS PROTEIN™ WESTERNC™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "10", "name": "HIROSTECNOLOGIAS", "description": "REACTIVOS", "requirement_group_id": "123776", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468791 - DNA LADDER 100 BP, 100-3000BP (54µG/500µL)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469276 - DNA LADDER  50BP , 50-1500BP, 1X500UL VIAL", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469277 - DNA LADDER 100 BP, 100-1500 BP (50µG/500µL )", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469641 - TAQ DNA POLYMERASE (500 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469852 - MIDORI GREEN ADVANCE (TINCIÓN DE ADN/ARN)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470871 - DNTP MIX 10 MM (2,5 MM CADA UNO)- ATP, DCTP, DGTP Y DCTP MEZCLADOS EN UN TUBO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470872 - TAQ DNA POLYMERASE (5000 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471543 - RESINA DE NÍQUEL PARA UNA ALTA RECUPERACIÓN DE PROTEÍNAS MARCADAS CON HISTIDINA. NI SEPHAROSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471738 - HYCLONE™ DULBECCO'S MODIFIED EAGLE MEDIUM (DMEM) CON GLUCOSA ALTA: POLVO. CON: L-GLUTAMINA, GLUCOSA SIN: PIRUVATO DE SODIO, BICARBONATO DE SODIO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471739 - RPMI 1640, CON L-GLUTAMINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471753 - MEDIOS DE CRIOCONSERVACIÓN HYCLONE HYCRYO-STEM 2X PARA CÉLULAS MADRE; FILTRADO ESTÉRIL DE 0,2 UM.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "11", "name": "INSUMOS Y ACCESORIOS CIENTIFICOS", "description": "REACTIVOS", "requirement_group_id": "123782", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466249 - TETROXIDO DE OSMIO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469742 - GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 25%", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470991 - SOLUCIÓN DE ACEITE ROJO O-ISOPROPANOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471696 - GLUTARALDEHÍDO GRADO PARA MICROSCOPÍA ELECTRÓNICA. SOLUCIÓN ACUOSA AL 70%", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471698 - KIT EMBED 812 PARA INCLUSIÓN EN MICROSCOPÍA ELECTRÓNICA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "12", "name": "LAB-TECH INSTRUMENTACION", "description": "REACTIVOS", "requirement_group_id": "123752", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1460497 - SULFATO DE ALUMINIO Y POTASIO, 12 HIDRATOS, CRISTAL, GRADO REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1462752 - BILIS DE BUEY. ELABORADA BAJO PROCESO DE BAJAS TEMPERATURAS Y DESHIDRATACIÓN", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463447 - METANOL <=99.9% (POR GC, CORREGIDO POR CONTENIDO DE AGUA), BAKER ANALYZED ™ HPLC PARA CROMATOGRAFÍA LÍQUIDA, PARA HPLC / UHPLC", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466303 - XILENOS, GRADO REACTIVO BAKER ANALYZED™ ACS", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469495 - ALCOHOL ETILICO (ETANOL) AL 96 %", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469500 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 10, COLOR AZUL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469501 - AMORTIGUADOR (BUFFER)DE REFERENCIA PH 4.0, COLOR ROSA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469502 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 7, COLOR AMARILLO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470571 - 2-PROPANOL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "13", "name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "description": "REACTIVOS", "requirement_group_id": "123783", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1462615 - CLOROFORMO GRADO BIOLOGIA MOLECULAR", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464589 - LYMPHOPREP™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464686 - GELRED® NUCLEIC ACID GEL STAIN, 10,000X IN WATER", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464802 - DAB PEROXIDASE (HRP) SUBSTRATE KIT (WITH NICKEL), 3,3’-DIAMINOBENZIDINE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464806 - VECTASHIELD® ANTIFADE MOUNTING MEDIUM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466828 - BUFFER DE CITRATOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468880 - RAT IL-6 ELISA KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469198 - LIOFILCHEM™ MTS™ AMOXICILLIN [AML] 0.016-256 µG/ML. MIC TEST STRIP 30 TIRAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469199 - LIOFILCHEM™ MTS™ CLARITHROMYCIN [CLR] 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469200 - LIOFILCHEM™ MTS™ LEVOFLOXACIN [LEV] 0.002-32 µG/ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469201 - LIOFILCHEM™ MTS™ METRONIDAZOLE [MTZ] 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470534 - POLY-L-LYSINE SOLUTION 0.1% DE SOLUCIÓN ACUOSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469765 - XILENO, A.C.S.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469842 - ß-NICOTINAMIDE ADENINE DINUCLEOTIDE REDUCED DISODIUM SALT =98%", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469843 - SALSA® MLPA® EK1 REAGENT KIT 100 REACTIONS (6 VIALS) - FAM: ABI-PRISM 3100, ABI-PRISM 3100 AVANT , ABI-3130, ABI-3130XL, ABI-3730, ABI-3730XL, ABI-3500", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470018 - GOAT ANTI-RABBIT IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470019 - HORSE ANTI-GOAT IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470020 - HORSE ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470022 - M.O.M.® (MOUSE ON MOUSE) IMMUNODETECTION KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470975 - REACTIVO DE TINCIÓN FLUORO-JADE® C RTDTM®", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470976 - ÁCIDO ARAQUIDÓNICO (AA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470990 - KIT DE ENSAYO ELISA 20-HETE (ÁCIDO 20-HIDROXIEICOSATETRAENOICO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471005 - ANTICUERPO POLICLONAL PPAR GAMMA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471059 - FSL-1 (PAM2CGDPKHPKSF), LIPOPROTEÍNA DIACILADA SINTÉTICA; AGONISTA DE TLR2/TLR6", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471060 - HEK-BLUE™ SELECTION. ANTIBIÓTICOS PARA EL MANTENIMIENTO DE HEK-BLUE™ CELLS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471062 - LPS-EK ESTÁNDAR (LPS DE E. COLI K12)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471063 - NORMOCIN™ REACTIVO ANTIMICROBIANO (1 BOTELLA DE 20 ML (1 G) )", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471064 - PAM3CSK4 (PAM3CYSSERLYS4), LIPOPÉPTIDO TRIACILADO SINTÉTICO; AGONISTA DE TLR2/TLR1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471067 - QUANTI-BLUE™ MEDIO DE DETECCIÓN DE FOSFATASA ALCALINA, FORMA LÍQUIDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471074 - TIRA DE PRUEBA AMIKACIN [AK] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471076 - TIRA DE PRUEBA CEFEPIME [FEP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471077 - TIRA DE PRUEBA CEFTAZIDIME [CAZ] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471078 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471079 - TIRA DE PRUEBA IMIPENEM - RELEBACTAM [I/R] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002/4-32/4 µG/ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471080 - TIRA DE PRUEBA MEROPENEM [MRP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471081 - TIRA DE PRUEBA AZTREONAM - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471082 - TIRA DE PRUEBA CEFIDEROCOL MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471083 - TIRA DE PRUEBA CEFTAZIDIME - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471085 - TIRA DE PRUEBA CIPROFLOXACIN [CIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471086 - TIRA DE PRUEBA COLISTIN [CS] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471089 - TIRA DE PRUEBA IMIPENEM [IMI] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471090 - TIRA DE PRUEBA MEROPENEM - VABORBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/8-256/8 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471094 - TIRA DE PRUEBA PIPERACILLIN [PIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471095 - TIRA DE PRUEBA PIPERACILLIN-TAZOBACTAM [TZP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471096 - TIRA DE PRUEBA TICARCILLIN-CLAVULANIC ACID [TTC] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/2-256/2 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471097 - TIRA DE PRUEBA TOBRAMYCIN [TOB] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471114 - ALCOHOL, ANHIDRO, REACTIVO ACS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471119 - SALSA ® MLPA ® PROBEMIX P034 DMD-1. REGIÓN: DMD XP21.1-P21.2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471227 - DESOXICOLATO DE SODIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471517 - MEDIO DE MONTAJE ANTIDECOLORACIÓN VECTASHIELD® CON DAPI", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471518 - REACTIVO DE TRANSFECCIÓN TRANS IT®-LT1", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471568 - 10NM SILVER NANOPARTICLES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471574 - ENSAYOS DE CALPROTECTINA FECAL EN HECES HUMANAS, BÜHLMANN FCAL® ELISA (RANGO:30-1800 µG/G)", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471575 - DISPOSITIVO BÜHLMANN CALEX® CAP, CONTIENE 5 ML, TAMPÓN DE EXTRACCIÓN FECAL DE CALPROTECTINA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471576 - POLYMYXIN B (UN INHIBIDOR DE LA ACTIVACIÓN DE TLR4 INDUCIDA POR LPS)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471587 - ZEOCIN® (ANTIBIÓTICO SELECTIVO PARA EL GEN SH BLE; CULTIVO CELULAR PROBADO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471588 - BLASTICIDINA (SOLUCIÓN)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471589 - G418 (GENETICINA), SOLUCIÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471591 - FLA-ST ULTRAPURE ( FAGELINA PURIFICADA DE S. TYPHIMURIUM; LIGANDO TLR5)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471620 - PROTEÍNA SAG1 DE TOXOPLASMA GONDII RECOMBINANTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471631 - MINI KIT I DE ADN PLASMÍDICO EZNA® (V-SPIN)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471636 - TINCIÓN EOSINA NIGROSINA DE ESPERMATOZOIDES 30 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471639 - SALSA ® MLPA ® PROBEMIX P035 DMD-1. REGIÓN: DMD XP21.1-P21.2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471642 - PE-CYANINE7 ANTI-HUMAN CD45RA (HI100)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471643 - APC-CIANINA7 CD45RO ANTIHUMANO (UCHL1)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471644 - ANTICUERPO MONOCLONAL CD185 (CXCR5) (MU5UBEE), BRILLIANT VIOLET™ 421, EBIOSCIENCE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471645 - ANTICUERPO MONOCLONAL CD69 (FN50), BRILLIANT VIOLET™ 650, EBIOSCIENCE™", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471648 - PROTEÍNA DE FUSIÓN CD40 (HUMANA)-MUIG (R-PE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471670 - DISCOS DE SUSCEPTIBILIDAD ANTIMICROBIANA DE CEFTAROLINA OXOID™, 30 µG. CPT30", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471671 - DISCOS PARA ANTIBIOGRAMAS CON TEICOPLANINA OXOID™, 30 µG", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471678 - DISCOS PARA ANTIBIOGRAMAS CON TRIMETOPRIMA/SULFAMETOXAZOL 1:19 OXOID™, 25 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471723 - ANTICUERPO TAU (CONEJO, POLICLONAL, IGG)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471741 - (±)11(12)-EET", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471743 - KIT DE ENSAYO ELISA 11,12 EET DHET", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471744 - KIT DE ENSAYO ELISA 14,15 DHET", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471747 - 17- ÁCIDO OCTADECINOICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471749 - PROTEÍNA RECOMBINANTE CYP2C9", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471767 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471773 - KIT DE SECUENCIACIÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "14", "name": "MAYIMEX", "description": "REACTIVOS", "requirement_group_id": "123753", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463952 - SUERO FETAL BOVINO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463961 - FETAL BOVINE SERUM (MÉXICO, USDA APPROVED)", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469732 - SUERO DE CABALLO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "15", "name": "PERKIN ELMER DE MEXICO", "description": "REACTIVOS", "requirement_group_id": "123785", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464845 - KIT NO DERIVATIZADO PARA CUANTIFICACIÓN DE AMINOÁCIDOS, ACILCARNITINAS Y SUCCINILACETONA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "16", "name": "QUIMICA VALANER", "description": "REACTIVOS", "requirement_group_id": "123786", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463839 - ANTI-RABBIT IGG, HRP-LINKED ANTIBODY", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464093 - KIT PARA CUANTIFICACIÓN NEONATAL HTSH FEIA PLUS, EN MICROPLACA DE LA HORMONA ESTIMULANTE DE LA TIROIDES TIROTROFINA (TSH) EN SANGRE TOTAL DE NEONATOS COLECTADA EN PAPEL FILTRO CON CALIBRADORES Y CONTROLES INTERNOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464689 - ANTI-MOUSE IGG HRP- LINKED ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464713 - MARCADOR DE PROTEÍNA AZUL PRETEÑIDO, RANGO AMPLIO (11-250 KDA)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467736 - KIT PARA CUANTIFICACIÓN NEONATAL G6PD (GLUCOSA 6-FOSFATO DESHIDROGENASA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469314 - ENZIMA DE RESTRICCION APAI", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469316 - ENZIMA DE RESTRICCIÓN MSPA1I KIT (10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470619 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469022 - PHUSION® HIGH-FIDELITY DNA POLYMERASE (2,000 UNITS/ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471122 - ENZIMA DE RESTRICCION ALWI (CONCENTRACIÓN: 10,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471123 - ENZIMA DE RESTRICCION NLAIII. CONCENTRACIÓN:10.000 UNIDADES/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471124 - ENZIMA DE RESTRICCION SMAI (PEQUEÑO, RECOMBINANTE). CONCENTRACIÓN: 20.000 UNIDADES/ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471130 - KIT DE MUTAGÉNESIS DIRIGIDA AL SITIO Q5 ® (SIN CÉLULAS COMPETENTES)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471503 - ENZIMA XBAI (20.000 UNIDADES/ML)", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471519 - ANTICUERPO MTOR (7C10) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471520 - ANTICUERPO ATG7 (D12B11) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471521 - ANTICUERPO FOSFO-ULK1 (SER555) (D1H4) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471522 - ANTICUERPOS ATG14 (D1A1N) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471609 - CVIQI, ENZIMAS DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471610 - ALUI (ALUMINIO), ENZIMA DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471647 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471672 - ENZIMA SPEI, RECOMBINANTE (10,000 U/ML)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471708 - BECLIN-1 ANTIBODY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471709 - ANTICUERPO FOSFO-ULK1 (SER757) (D7O6U) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471710 - ANTICUERPO ULK1 (D8H5) RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471711 - ANTICUERPO PROTEÍNA RIBOSOMAL FOSFO-S6 (SER240/244) (D68F8) XP ® RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471712 - ANTICUERPO PROTEÍNA RIBOSOMAL S6 (5G10) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471713 - ANTICUERPO FOSFO-4E-BP1 (THR37/46) (236B4) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471714 - ANTICUERPOS 4E-BP1 (53H11) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471715 - ANTICUERPO LC3B (E7X4S) XP® RABBIT MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471716 - ANTICUERPO MTOR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471717 - ANTICUERPO FOSFO-MTOR (SER2448)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471718 - ANTICUERPO PHOSPHO-ATG14 (SER29) (D4B8M) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471719 - ANTICUERPO FOSFO-BECLIN-1 (SER30) (E1C4X) CONEJO MAB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471720 - BAFILOMYCIN A1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471721 - A-769662", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471737 - ENDONUCLEASAS DE RESTRICCIÓN HAEIII (10.000 UNIDADES/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471763 - ENZIMAS DE RESTRICCIÓN DE ALTA FIDELIDAD (SPEI-HF ®). (20.000 UNIDADES/ML)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471781 - ENZIMAS DE RESTRICCIÓN HPY188I, CONCENTRACIÓN: 10.000 UNIDADES/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "17", "name": "QUIMICA VIRMEL", "description": "REACTIVOS", "requirement_group_id": "123777", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467902 - HUMAN LEPTIN DUAL RANGE ELISA KIT/96 POZOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471248 - KIT ELISA DE IL18 HUMANA/INTERLEUCINA-18", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471564 - HIDROXIDO DE AMONIO SOLUCIÓN. REACTIVO ACS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471673 - DISCOS DE FACTOR X + V", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471676 - BD BBL ™ SENSI-DISC ™ AZTREONAM ATM-30 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471679 - DISCO NITROFURANTOÍNA F/M-300 µG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471695 - ÓXIDO DE 1,2-PROPILENO", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471754 - A (ALPHA)-NAFTOFLAVONA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "18", "name": "QUIMILAB", "description": "REACTIVOS", "requirement_group_id": "123780", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469795 - GOAT ANTI-MOUSE IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY, BIOTIN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470861 - SONDA VYSIS LSI D7S486 SPECTRUMORANGE/CEP 7 SPECTRUMGREEN SE HIBRIDAN CON LA BANDA 7Q31 (SPECTRUMORANGE LSI D7S486)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470994 - SONDA EN BAC PARA EL CROMOSOMA XP MARCADA EN VERDE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470996 - SONDA EN BAC PARA EL CROMOSOMA XQ MARCADA EN NARANJA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471505 - TARJETAS DE IDENTIFICACIÓN VITEK®2 AST-N403", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471509 - ANEUVYSION MULTICOLOR DNA. KIT CON 5 DIFERENTES SONDAS DE DNA PARA DETECCIÓN DE LOS CROMOSOMAS X,Y, 18 Y 13, 21. PARA 30 ENSAYOS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471510 - SONDA DE DNA PARA LA DETECCIÓN DE LA MICRODELECIÓN LSI 1P36 CON SONDAS PARA 1PTEL Y 1Q25", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471619 - KIT PARA DETERMINAR OH PROGESTERONA (17-OHP) EN SUERO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471732 - SULFATO DE ZINC HEPTAHIDRATADO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "19", "name": "SILVERA CIENCIA E INGENIERIA", "description": "REACTIVOS", "requirement_group_id": "123778", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463898 - ANTICUERPO ß-ACTIN ANTICUERPO (C4) ES UN MONOCLONAL DE RATÓN IGG1 (200 µG/ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463976 - CATALASE FLUOROMETRIC DETECTION KIT", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1463980 - SOD ACTIVITY KIT (5 X 96 WELLS)", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464720 - PROTEIN CARBONYL ELISA KIT", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464816 - ACIDO TIOBARBITÚRICO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466853 - KIT ELISA DE CORTICOSTERONA DE ALTA SENSIBILIDAD", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466929 - ANTICUERPO ANT CRF (2B11)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1467977 - PROTEÍNA A/G PLUS-AGAROSA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468830 - ANTIMOUSE IGG ESPECÍFICO PARA FCGAMMA SUBLASE 2C PEROXIDASE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468903 - NURR1 ANTIBODY (F-5)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469504 - INICIADORES PARA PCR (SECUENCIA DE 30 BASES:ATCAAG TACAGTTAGTCTTTATTAGATCAA), LIBRE DE SAL", "requested_quantity": "174", "minimum_quantity": "174", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469515 - MTT FORMAZAN (CAS 57360-69-7)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469800 - SUERO DE BURRO NORMAL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469827 - ACETYL COENZYME A TRILITHIUM SALT TRIHYDRATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469828 - ALBUMINA SÉRICA BÓVINA FRACCIÓN V", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470602 - CATALASE, >=2000 U/MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469877 - TRA1/A2 ANTICUERPO (2103)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469883 - NADP, DISODIUM SALT (CAS 24292-60-2)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1469890 - ANTI-IBA1 ANTIBODY (1022-5)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1470999 - KIT ELISA DE DAÑO RÁPIDO DEL ADN PARA CÁNCER, APOPTOSIS Y ESTRÉS OXIDATIVO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471069 - PEROXIDASA AFFINIPURE CABRA ANTI-RATÓN IGG (H+L). (MIN X HU, BOV, HRS SR PROT)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471169 - CASPASE-1 ANTICUERPO (14F468)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471171 - COENZIMA A", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471180 - KV1.3 ANTICUERPO (G-9)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471184 - PERMETRINA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471523 - ANTICUERPO GFAP (2E1)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471524 - ANTICUERPO SOX-2 (E-4)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471525 - EF-CAB1 ANTICUERPO (B-2)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471557 - KIT DE GLUTATIÓN REDUCTASA (GR) ENZYCHROM™", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471558 - KIT DE ENSAYO ENZYCHROM™ GSH/GSSG", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471579 - TIM ANTICUERPO (H-11) ALEXA FLUOR® 680", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471593 - INTEGRIN AV/ß3/CD51/CD61 ANTICUERPO (23C6) ALEXA FLUOR® 405", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471596 - CDK2 ANTICUERPO (D-12) ALEXA FLUOR® 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471597 - COFILIN ANTICUERPO (E-8) ALEXA FLUOR® 594", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471598 - SORORIN ANTICUERPO (B-9) ALEXA FLUOR® 790", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471622 - PEROXIDASA AFFINIPURE GOAT ANTI-MOUSE IGM, ESPECÍFICO DE CADENA µ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471629 - CYTOKERATIN 19 ANTIBODY (BA17)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471630 - HISTONE H3 ANTICUERPO (1G1)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471633 - (-)-GALATO DE EPIGALOCATEQUINA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471638 - ANTICUERPO POLICLONAL RECEPTOR DE ESTRÓGENO ß (BETA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471654 - IGG 1 DE RATÓN NORMAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471706 - CLORURO DE SODIO (NACI), REACTIVO DE CULTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471727 - CASPASE-3 ANTICUERPO (31A1067)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471728 - BML-275, INHIBIDOR DE AMPK", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471731 - 5-BROMO-2'-DEOXYURIDINE (5-BRDU)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471760 - SOMATOSTATIN ANTICUERPO (H-11)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471762 - AGAR PARA BACTERIOLOGIA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] }, { "number": "20", "name": "UNIPARTS", "description": "REACTIVOS", "requirement_group_id": "123788", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1464191 - KIT DE PURIFICACIÓN DE ADN GENÓMICO WIZARD®", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1466364 - GOTAQ® GREEN MASTER MIX. MEZCLA MASTERMIX PARA LA ACTIVIDAD DE DNA POLIMERASA GO TAQ ( DNA POLIMERASA, DNTPS, MGCL2 Y BUFFERS DE REACCIÓN ÓPTIMOS)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468857 - MS COLUMNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1468892 - PROMEGA ROS-GLO™ H2O2 ASSAY", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R1471581 - CD3 MICROBEADS, HUMANO - LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] } ], "awards": [ { "id": "C-2024-00023159", "internal_reference": "AD-508/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "ABALAT SA DE CV", "normalized_name": "ABALAT", "rfc_type": null, "slug": "abalat" }, "contract_period": { "published_at": "2024-03-02T00:15:14.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "1295988", "tax": "207358.08", "total": "1503346.08", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1451276 - ANTIBIÓTICO-ANTIMICÓTICO (100X)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "853", "subtotal": "4265", "tax": "682.4", "other_taxes": null, "total": "4947.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1461389 - KIT PARA RT-PCR (TAQMAN REVERSE TRANSCRIPTION), MULTISCRIBE REVERSE TRANSCRIPTASE, RNASE INHIBITOR, DNTP MIXTURE, OLIGO D(T)16, RANDOM HEXAMERS, 10X RT BUFFER, MGCL2 SOLUTION.", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "12885", "subtotal": "51540", "tax": "8246.4", "other_taxes": null, "total": "59786.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1461453 - KIT DE PURIFICACIÓN QIAQUICK PCR, PARA LA PURIFICACIÓN DE 250 REACCIONES PCR: 250 QIAQUICK SPIN COLUMNS, BUFFERS, COLLECTION TUBES (2 ML)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "14146", "subtotal": "70730", "tax": "11316.8", "other_taxes": null, "total": "82046.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1461455 - MINI KIT DE ADN QIAAMP®. PARA EL AISLAMIENTO DE ADN GENÓMICO, MITOCONDRIAL, BACTERIANO, PARASITARIO O VIRAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13547", "subtotal": "13547", "tax": "2167.52", "other_taxes": null, "total": "15714.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1462525 - RNASE A (17,500 U). VIAL CON 2.5 ML (100 MG/ML; 7000 UNIDADES/ML, SOLUCIÓN)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7210", "subtotal": "14420", "tax": "2307.2", "other_taxes": null, "total": "16727.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1462927 - KIT 1 KB PLUS DNA LADDER (1 KB PLUS DNA LADDERT (1 µG/µL) IN 10 MM TRIS-HCL (PH 7.5), 50 MM NACL, AND 1 MM EDTA)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3224", "subtotal": "6448", "tax": "1031.68", "other_taxes": null, "total": "7479.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463636 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12, POLVO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1444", "subtotal": "4332", "tax": "693.12", "other_taxes": null, "total": "5025.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463802 - HIBRIDOMA-SFM", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1965", "subtotal": "3930", "tax": "628.8", "other_taxes": null, "total": "4558.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463854 - CLONEJET PCR CLONING KIT 20 REACT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3039", "subtotal": "3039", "tax": "486.24", "other_taxes": null, "total": "3525.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463856 - GENERULER 100 BP DNA LADDER (MARCADOR DE PESO MOLECULAR, ESCALERA DE 100 BP TO 1000 BP )", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4517", "subtotal": "4517", "tax": "722.72", "other_taxes": null, "total": "5239.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463857 - MARCADOR DE PESO MOLECULAR PARA DNA 50 BP", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2082", "subtotal": "8328", "tax": "1332.48", "other_taxes": null, "total": "9660.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464642 - PBS (SOLUCIÓN SALINA TAMPONADA CON FOSFATO), PH 7.4", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4198", "subtotal": "8396", "tax": "1343.36", "other_taxes": null, "total": "9739.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464665 - PIRUVATO DE SODIO (100 MM)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "244", "subtotal": "732", "tax": "117.12", "other_taxes": null, "total": "849.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464730 - DNTP MIX CONTIENE: 10 MM DE CADA UNO DE DATP, DTTP, DCTP Y DGTP.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2401", "subtotal": "2401", "tax": "384.16", "other_taxes": null, "total": "2785.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464733 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER, DE 10 A 180 KDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2603", "subtotal": "2603", "tax": "416.48", "other_taxes": null, "total": "3019.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464737 - SPECTRA MULTICOLOR HIGH RANGE PROTEIN LADDER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3560", "subtotal": "3560", "tax": "569.6", "other_taxes": null, "total": "4129.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1465465 - SOLUCIÓN DE AMINOÁCIDOS NO ESENCIALES MEM (100X)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "429", "subtotal": "1716", "tax": "274.56", "other_taxes": null, "total": "1990.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466179 - AMNIOMAX- II COMPLETE MEDIUM", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2082", "subtotal": "10410", "tax": "1665.6", "other_taxes": null, "total": "12075.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466245 - BD PHARMINGEN FITC ANNEXIN V APOPTOSIS DETECTION KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6163", "subtotal": "6163", "tax": "986.08", "other_taxes": null, "total": "7149.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466855 - MAXIMA PROBE/ROX QPCR MASTER MIX (200 X 25 µL RXNS)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "4466", "subtotal": "17864", "tax": "2858.24", "other_taxes": null, "total": "20722.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466871 - MEDIO RPMI (L-GLUTAMINA Y ROJO FENOL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4718", "subtotal": "4718", "tax": "754.88", "other_taxes": null, "total": "5472.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466873 - PLATINUM TAQ DNA POLIMERASE HIGH FIDELITY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20584", "subtotal": "20584", "tax": "3293.44", "other_taxes": null, "total": "23877.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466875 - SUPLEMENTO B-27 (50X), SIN SUERO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "21356", "subtotal": "42712", "tax": "6833.92", "other_taxes": null, "total": "49545.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467860 - CTS GLUTAMAX-I SUPPLEMENT (100X)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1134", "subtotal": "2268", "tax": "362.88", "other_taxes": null, "total": "2630.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467877 - TAQ DNA POLYMERASE, RECOMBINANT 100RX", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1109", "subtotal": "2218", "tax": "354.88", "other_taxes": null, "total": "2572.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467929 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE 3000", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1415", "subtotal": "1415", "tax": "226.4", "other_taxes": null, "total": "1641.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468160 - FASTDIGEST BAMHI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1100", "subtotal": "1100", "tax": "176", "other_taxes": null, "total": "1276" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468757 - BD PERCP MOUSE ANTI-HUMAN CD3 (20 µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14387", "subtotal": "14387", "tax": "2301.92", "other_taxes": null, "total": "16688.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468812 - AGUA LIBRE DE NUCLEASAS (NO TRATADA CON DEPC)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2552", "subtotal": "12760", "tax": "2041.6", "other_taxes": null, "total": "14801.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468820 - MEDIO DMEM/F-12, GLUTAMAX SUPPLEMENT", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "1037", "subtotal": "18666", "tax": "2986.56", "other_taxes": null, "total": "21652.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468826 - ULTRAPURE DITHIOTHREITOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3006", "subtotal": "3006", "tax": "480.96", "other_taxes": null, "total": "3486.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468894 - BUFFER ATL (4X50ML) GPR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3224", "subtotal": "3224", "tax": "515.84", "other_taxes": null, "total": "3739.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469020 - MAXIMA SYBR GREEN/ROX QPCR MASTER MIX (2X)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17864", "subtotal": "17864", "tax": "2858.24", "other_taxes": null, "total": "20722.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469022 - PHUSION HIGH-FIDELITY DNA POLYMERASE (2 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2217", "subtotal": "2217", "tax": "354.72", "other_taxes": null, "total": "2571.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469023 - 2-NBDG (2-(N-(7-NITROBENZ-2-OXA-1,3-DIAZOL-4-YL)AMINO)-2-DEOXYGLUCOSE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4970", "subtotal": "4970", "tax": "795.2", "other_taxes": null, "total": "5765.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469025 - DMEM, ALTO CONTENIDO EN GLUCOSA", "unit": "PIEZA", "requested_quantity": "19", "awarded_quantity": null, "unit_price": "545", "subtotal": "10355", "tax": "1656.8", "other_taxes": null, "total": "12011.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469026 - ENZIMA DE RESTRICCIÓN DPNI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "839", "subtotal": "1678", "tax": "268.48", "other_taxes": null, "total": "1946.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469029 - ULTRAPURE AGAROSE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3711", "subtotal": "3711", "tax": "593.76", "other_taxes": null, "total": "4304.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469033 - DEPC-TREATED WATER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2468", "subtotal": "2468", "tax": "394.88", "other_taxes": null, "total": "2862.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469301 - PET151 DIRECTIONAL TOPO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26023", "subtotal": "26023", "tax": "4163.68", "other_taxes": null, "total": "30186.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469431 - TRIPSINA-EDTA (0.05 %), ROJO FENOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "932", "subtotal": "932", "tax": "149.12", "other_taxes": null, "total": "1081.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469432 - XTT (2,3-BIS-(2-METOXI-4-NITRO-5-SULFOFENIL)-2H-TETRAZOLIO-5-CARBOXANILIDA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3963", "subtotal": "3963", "tax": "634.08", "other_taxes": null, "total": "4597.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469433 - AMPLITAQ GOLD DNA POLYMERASE, WITH BUFFER II AND MGCL2, 3000 UNITS (12 TUBES X 50 UL, 250 UNITS PER TUBE)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "49359", "subtotal": "98718", "tax": "15794.88", "other_taxes": null, "total": "114512.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469509 - PROTEASA ACTEV", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6498", "subtotal": "6498", "tax": "1039.68", "other_taxes": null, "total": "7537.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469517 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7085", "subtotal": "7085", "tax": "1133.6", "other_taxes": null, "total": "8218.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469529 - HUMAN EGF (EPIDERMAL GROWTH FACTOR) RECOMBINANT PROTEIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2334", "subtotal": "2334", "tax": "373.44", "other_taxes": null, "total": "2707.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469643 - AMPLITAQ GOLD 360 MASTER MIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "44743", "subtotal": "44743", "tax": "7158.88", "other_taxes": null, "total": "51901.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470345 - GENECHIP® HYBRIDIZATION WASH AND STAIN KIT FOR 30 RXNS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12189", "subtotal": "12189", "tax": "1950.24", "other_taxes": null, "total": "14139.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469651 - SEQUENCE DETECTION PRIMER", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2401", "subtotal": "9604", "tax": "1536.64", "other_taxes": null, "total": "11140.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470483 - BD CYTOFIX/CYTOPERM. FIXATION/PERMEABLIZATION KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6892", "subtotal": "13784", "tax": "2205.44", "other_taxes": null, "total": "15989.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469697 - BD PHARMINGEN FITC MOUSE ANTI-HUMAN CD69 (20 µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4938", "subtotal": "4938", "tax": "790.08", "other_taxes": null, "total": "5728.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469759 - GIBCO 2-MERCAPTOETHANOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "903", "subtotal": "903", "tax": "144.48", "other_taxes": null, "total": "1047.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469045 - OPTI-MEM I REDUCED SERUM MEDIUM", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1138", "subtotal": "2276", "tax": "364.16", "other_taxes": null, "total": "2640.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469763 - SOLUCIÓN SALINA EQUILIBRADA DE HANK´S (HBSS, SIN CALCIO, SIN MAGNESIO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "247", "subtotal": "247", "tax": "39.52", "other_taxes": null, "total": "286.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469768 - 100 BP DNA LADDER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5893", "subtotal": "5893", "tax": "942.88", "other_taxes": null, "total": "6835.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469781 - INDICADOR ROJO DE SUPERÓXIDO MITOCONDRIAL MITOSOX, PARA IMÁGENES DE CÉLULAS VIVAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6934", "subtotal": "6934", "tax": "1109.44", "other_taxes": null, "total": "8043.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470396 - SUPERMIX DE SÍNTESIS DE PRIMERA CADENA SUPERSCRIPT III", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10712", "subtotal": "10712", "tax": "1713.92", "other_taxes": null, "total": "12425.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469793 - ANTICUERPO RECEPTOR A ANDROGENOS POLICLONAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8059", "subtotal": "8059", "tax": "1289.44", "other_taxes": null, "total": "9348.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469869 - MINI KIT DE SANGRE DE ADN QIAAMP (250)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "12419", "subtotal": "62095", "tax": "9935.2", "other_taxes": null, "total": "72030.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470762 - CYP1A2 BACULOSOMES PLUS REAGENT, RHUMAN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4785", "subtotal": "4785", "tax": "765.6", "other_taxes": null, "total": "5550.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470404 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER PLUS, DE 10 A 250 KDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3106", "subtotal": "3106", "tax": "496.96", "other_taxes": null, "total": "3602.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470762 - LIGADURA RÁPIDA DE ADN KIT", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3090", "subtotal": "9270", "tax": "1483.2", "other_taxes": null, "total": "10753.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470954 - CD4 FITC/CD8 PE/CD3 PERCP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10691", "subtotal": "10691", "tax": "1710.56", "other_taxes": null, "total": "12401.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471010 - MEDIO RPMI 1640 (MEDIO ROSWELL PARK MEMORIAL INSTITUTE 1640), SIN GLUCOSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "790", "subtotal": "790", "tax": "126.4", "other_taxes": null, "total": "916.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471014 - TRIPSINA-EDTA (0,25%), ROJO DE FENOL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "936", "subtotal": "1872", "tax": "299.52", "other_taxes": null, "total": "2171.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471025 - ANTICUERPO POLICLONAL CYP2C11 CONEJO ANTI-FELINO, HUMANO, RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7555", "subtotal": "7555", "tax": "1208.8", "other_taxes": null, "total": "8763.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471027 - ANTICUERPO POLICLONAL FCGRT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7320", "subtotal": "7320", "tax": "1171.2", "other_taxes": null, "total": "8491.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471032 - CYP2J2 CONEJO ANTIHUMANO, RATÓN, RATA, POLICLONAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7320", "subtotal": "7320", "tax": "1171.2", "other_taxes": null, "total": "8491.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471040 - KIT DE ELISA PARA INSULINA HUMANA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9671", "subtotal": "19342", "tax": "3094.72", "other_taxes": null, "total": "22436.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471044 - KIT ELISA HUMANO PARA ADIPONECTINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9537", "subtotal": "19074", "tax": "3051.84", "other_taxes": null, "total": "22125.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471057 - KIT DE ELISA PARA LEPTINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9772", "subtotal": "19544", "tax": "3127.04", "other_taxes": null, "total": "22671.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471142 - KIT DE ADN QIAAMP POWERFECAL PRO", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "8942", "subtotal": "62594", "tax": "10015.04", "other_taxes": null, "total": "72609.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471146 - KIT DE SANGRE Y TEJIDO DNEASY (50). MINICOLUMNAS, PROTEINASA K, TAMPONES, TUBOS DE RECOGIDA (2 ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3201", "subtotal": "6402", "tax": "1024.32", "other_taxes": null, "total": "7426.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471152 - PUREGENE® SOLUCIÓN DE PRECIPITACIÓN DE PROTEÍNAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "11382", "subtotal": "34146", "tax": "5463.36", "other_taxes": null, "total": "39609.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471316 - GLUCÓGENO, GRADO DE BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1444", "subtotal": "4332", "tax": "693.12", "other_taxes": null, "total": "5025.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471324 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11585", "subtotal": "11585", "tax": "1853.6", "other_taxes": null, "total": "13438.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471455 - ENZIMAS DE RESTRICCIÓN NDEI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2821", "subtotal": "5642", "tax": "902.72", "other_taxes": null, "total": "6544.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471456 - MEDIO DE CARIOTIPADO PB-MAX", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4852", "subtotal": "9704", "tax": "1552.64", "other_taxes": null, "total": "11256.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471457 - BUFFER TE LOW", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1763", "subtotal": "1763", "tax": "282.08", "other_taxes": null, "total": "2045.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471458 - ENZIMA DE RESTRICCIÓN BAMHI (10 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "636", "subtotal": "636", "tax": "101.76", "other_taxes": null, "total": "737.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471459 - ENZIMA DE RESTRICCIÓN FASTDIGEST XHOI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1041", "subtotal": "1041", "tax": "166.56", "other_taxes": null, "total": "1207.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471460 - LIGASA DE ADN T4 (5 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4416", "subtotal": "4416", "tax": "706.56", "other_taxes": null, "total": "5122.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471461 - TRANSCRIPCIÓN INVERSA SUPERSCRIPT III (200 U/µL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2082", "subtotal": "2082", "tax": "333.12", "other_taxes": null, "total": "2415.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471462 - MINIPASTILLAS INHIBIDORAS DE FOSFATASAS PIERCE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3795", "subtotal": "3795", "tax": "607.2", "other_taxes": null, "total": "4402.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471463 - TRUEGUIDE MODIFIED SGRNA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1763", "subtotal": "10578", "tax": "1692.48", "other_taxes": null, "total": "12270.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471464 - PROTEÍNA CAS9 V2 TRUECUT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3711", "subtotal": "7422", "tax": "1187.52", "other_taxes": null, "total": "8609.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471465 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE CRISPRMAX CAS9", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1780", "subtotal": "3560", "tax": "569.6", "other_taxes": null, "total": "4129.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471466 - KIT DE DETECCIÓN DE DISOCIACIÓN GENÓMICA GENEART", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4181", "subtotal": "8362", "tax": "1337.92", "other_taxes": null, "total": "9699.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471467 - TRUEGUIDE SGRNA CONTROL NEGATIVO, NO DIRIGIDO 1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3627", "subtotal": "3627", "tax": "580.32", "other_taxes": null, "total": "4207.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471468 - TRUEGUIDE SGRNA POSITIVE CONTROL, AAVS1 (HUMANO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3627", "subtotal": "3627", "tax": "580.32", "other_taxes": null, "total": "4207.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471469 - MINI KIT DE PLÁSMIDOS (25)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5627", "subtotal": "5627", "tax": "900.32", "other_taxes": null, "total": "6527.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471470 - GLUCÓGENO (5 MG/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3946", "subtotal": "3946", "tax": "631.36", "other_taxes": null, "total": "4577.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471471 - SOLUCIÓN DE LISIS CELULAR PUREGENE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14142", "subtotal": "28284", "tax": "4525.44", "other_taxes": null, "total": "32809.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471472 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO), POLVO, ALTO CONTENIDO EN GLUCOSA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1041", "subtotal": "2082", "tax": "333.12", "other_taxes": null, "total": "2415.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471473 - SOLUCIÓN DE HIDRATACIÓN DE ADN PUREGENE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8819", "subtotal": "8819", "tax": "1411.04", "other_taxes": null, "total": "10230.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471474 - ANTICUERPO POLICLONAL CD42B", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7488", "subtotal": "7488", "tax": "1198.08", "other_taxes": null, "total": "8686.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471475 - ANTICUERPO POLICLONAL DE FIBRINÓGENO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7388", "subtotal": "7388", "tax": "1182.08", "other_taxes": null, "total": "8570.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471476 - ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA IGG (H+L) ANTI-RATÓN DE CABRA, BIOTINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3291", "subtotal": "3291", "tax": "526.56", "other_taxes": null, "total": "3817.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471477 - SULFO-NHS-LC-BIOTINA EZ-LINK", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6011", "subtotal": "6011", "tax": "961.76", "other_taxes": null, "total": "6972.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471478 - ESTREPTAVIDINA, CONJUGADO ALEXA FLUOR 488", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6061", "subtotal": "6061", "tax": "969.76", "other_taxes": null, "total": "7030.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471479 - ESCALERA DE ADN DE 1 KB GENERULER PLUS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2888", "subtotal": "2888", "tax": "462.08", "other_taxes": null, "total": "3350.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471480 - IONOMICINA, SAL DE CALCIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3660", "subtotal": "3660", "tax": "585.6", "other_taxes": null, "total": "4245.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471481 - ANTIHUMANO CD154 DE RATÓN PE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6913", "subtotal": "6913", "tax": "1106.08", "other_taxes": null, "total": "8019.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471482 - ANTI-PERFORINA HUMANA, PE MOUSE IGG2B, KIT CON CONTROL DE ISOTIPO ¿ (ANTI-DANSYL)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9044", "subtotal": "9044", "tax": "1447.04", "other_taxes": null, "total": "10491.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471483 - ESTREPTAVIDINA PE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3558", "subtotal": "3558", "tax": "569.28", "other_taxes": null, "total": "4127.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471484 - ANTICUERPO POLICLONAL ANTI-CONEJO DE CABRA CONJUGADO CON FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5223", "subtotal": "5223", "tax": "835.68", "other_taxes": null, "total": "6058.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471485 - RATÓN ALEXA FLUOR 647 ANTI-FOXP3 HUMANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8263", "subtotal": "8263", "tax": "1322.08", "other_taxes": null, "total": "9585.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471486 - BD BBL SENSI-DISC AMPICILINA CON SULBACTAM SAM-20 (10 µG)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2285", "subtotal": "9140", "tax": "1462.4", "other_taxes": null, "total": "10602.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471487 - BD BBL SENSI-DISC AMOXICILINA CON ÁCIDO CLAVULÁNICO AMC-30 (20/10 MICROGRAMOS)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2335", "subtotal": "4670", "tax": "747.2", "other_taxes": null, "total": "5417.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471488 - MEDIO NEUROBASAL SIN ROJO FENOL", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "1713", "subtotal": "34260", "tax": "5481.6", "other_taxes": null, "total": "39741.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471489 - SOLUCIÓN DE DETERGENTE NP-40 SURFACT-AMPS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3039", "subtotal": "3039", "tax": "486.24", "other_taxes": null, "total": "3525.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471490 - SUSTRATO DE SENSIBILIDAD QUIMIOLUMINISCENTE PARA IDENTIFICAR DE PROTEÍNAS DE ALTO ATTOGRAMO SUPERSIGNAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11921", "subtotal": "11921", "tax": "1907.36", "other_taxes": null, "total": "13828.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471491 - ANTICUERPO POLICLONAL ANTI-EPXH2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7320", "subtotal": "7320", "tax": "1171.2", "other_taxes": null, "total": "8491.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471492 - ANTICUERPO NFKB P50 MONOCLONAL (2J10D7)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9335", "subtotal": "9335", "tax": "1493.6", "other_taxes": null, "total": "10828.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471493 - ANTICUERPO POLICLONAL C-REL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6632", "subtotal": "6632", "tax": "1061.12", "other_taxes": null, "total": "7693.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471494 - ANTICUERPO POLICLONAL RELB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7488", "subtotal": "7488", "tax": "1198.08", "other_taxes": null, "total": "8686.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471495 - ANTICUERPO MONOCLONAL IBA1 (GT10312)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8328", "subtotal": "8328", "tax": "1332.48", "other_taxes": null, "total": "9660.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471496 - KIT DE ENSAYO DE PROTEÍNAS PIERCE COOMASSIE (BRADFORD)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2485", "subtotal": "2485", "tax": "397.6", "other_taxes": null, "total": "2882.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471497 - ANTICUERPO MONOCLONAL DE CONEJO RECOMBINANTE GLUT2 (JJ20-21)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9167", "subtotal": "9167", "tax": "1466.72", "other_taxes": null, "total": "10633.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471498 - RNEASY MINI KIT (50)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7206", "subtotal": "7206", "tax": "1152.96", "other_taxes": null, "total": "8358.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471499 - QIAAMP DNA FFPE TISSUE KIT (50)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5314", "subtotal": "5314", "tax": "850.24", "other_taxes": null, "total": "6164.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471500 - KIT RNEASY DSP FFPE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12522", "subtotal": "12522", "tax": "2003.52", "other_taxes": null, "total": "14525.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471501 - MINIGELES DE PROTEÍNAS NUPAGE, BIS-TRIS DEL 4 AL 12 %, 1,0–1,5 MM. X 10 POCILLOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2720", "subtotal": "5440", "tax": "870.4", "other_taxes": null, "total": "6310.4" } ] }, { "id": "C-2024-00023214", "internal_reference": "AD-509/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2024-03-02T00:32:12.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "47628.25", "tax": "7620.52", "total": "55248.77", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1464191 - KIT DE PURIFICACIÓN DE ADN GENÓMICO WIZARD®", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4189.12", "subtotal": "12567.36", "tax": "2010.78", "other_taxes": null, "total": "14578.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466364 - GOTAQ® GREEN MASTER MIX. MEZCLA MASTERMIX PARA LA ACTIVIDAD DE DNA POLIMERASA GO TAQ ( DNA POLIMERASA, DNTPS, MGCL2 Y BUFFERS DE REACCIÓN ÓPTIMOS)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1247.54", "subtotal": "7485.24", "tax": "1197.64", "other_taxes": null, "total": "8682.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468857 - MS COLUMNS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4383", "subtotal": "4383", "tax": "701.28", "other_taxes": null, "total": "5084.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468892 - PROMEGA ROS-GLO™ H2O2 ASSAY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11287.9", "subtotal": "11287.9", "tax": "1806.06", "other_taxes": null, "total": "13093.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471581 - CD3 MICROBEADS, HUMANO - LIOFILIZADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11904.75", "subtotal": "11904.75", "tax": "1904.76", "other_taxes": null, "total": "13809.51" } ] }, { "id": "C-2024-00023167", "internal_reference": "AD-510/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "EQUIVER SA DE CV", "normalized_name": "EQUIVER", "rfc_type": null, "slug": "equiver" }, "contract_period": { "published_at": "2024-03-02T00:18:57.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "75982.03", "tax": "12157.12", "total": "88139.15", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1456677 - PROFINITY™ IMAC RESIN, NI-CHARGED 25 ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5855.25", "subtotal": "11710.5", "tax": "1873.68", "other_taxes": null, "total": "13584.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1461235 - 30% ACRYLAMIDE/BIS SOLUTION", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1190.7", "subtotal": "3572.1", "tax": "571.54", "other_taxes": null, "total": "4143.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467793 - SOLUCIÓN BLOQUEADORA (BLOTTING-GRADE BLOCKER)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1013.42", "subtotal": "1013.42", "tax": "162.15", "other_taxes": null, "total": "1175.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469262 - DITHIOTHREITOL (DTT)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1631.88", "subtotal": "6527.52", "tax": "1044.4", "other_taxes": null, "total": "7571.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469498 - PRECISION PLUS PROTEIN™ KALEIDOSCOPE™ PRESTAINED PROTEIN STANDARDS (500 µL, MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES (10–250 KD))", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "2786.24", "subtotal": "22289.92", "tax": "3566.39", "other_taxes": null, "total": "25856.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469499 - PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS (MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES TEÑIDAS DE AZUL (10–250 KD), INCLUIDAS TRES BANDAS DE REFERENCIA (25, 50, 75 KD), 50 APLICACIONES)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2001.96", "subtotal": "8007.84", "tax": "1281.25", "other_taxes": null, "total": "9289.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469726 - MINI-PROTEAN® TGX™ 4–15% PRECAST PROTEIN GELS, 10-WELL, 30 µL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2193.71", "subtotal": "6581.13", "tax": "1052.98", "other_taxes": null, "total": "7634.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469730 - TEMED (TETRAMETHYLETHYLENEDIAMINE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "362.15", "subtotal": "362.15", "tax": "57.94", "other_taxes": null, "total": "420.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469731 - 30% ACRYLAMIDE/BIS SOLUTION, 29:1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1190.7", "subtotal": "1190.7", "tax": "190.51", "other_taxes": null, "total": "1381.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470973 - IMMUNO-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M (1 ROLL, 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7779.24", "subtotal": "7779.24", "tax": "1244.68", "other_taxes": null, "total": "9023.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471607 - COLUMNAS DE GEL MICRO BIO-SPIN™ P-30, TAMPÓN TRIS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3748.5", "subtotal": "3748.5", "tax": "599.76", "other_taxes": null, "total": "4348.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471722 - ESTÁNDARES DE TRANSFERENCIA PRECISION PLUS PROTEIN™ WESTERNC™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3199.01", "subtotal": "3199.01", "tax": "511.84", "other_taxes": null, "total": "3710.85" } ] }, { "id": "C-2024-00023163", "internal_reference": "AD-511/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "BIOSYSTEMS LIFESCIENCE SA DE CV", "normalized_name": "BIOSYSTEMS LIFESCIENCE", "rfc_type": null, "slug": "biosystems-lifescience" }, "contract_period": { "published_at": "2024-03-02T00:16:40.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "24435.18", "tax": "3909.63", "total": "28344.81", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1471776 - KIT DE CODIFICACIÓN DE BARRAS PCR-CDNA 24", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19348.98", "subtotal": "19348.98", "tax": "3095.84", "other_taxes": null, "total": "22444.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471777 - KIT DE LAVADO DE CELDA DE FLUJO (MINION™ Y PROMETHION™)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2543.1", "subtotal": "2543.1", "tax": "406.9", "other_taxes": null, "total": "2950" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471779 - VIALES AUXILIARES DE SECUENCIACIÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2543.1", "subtotal": "2543.1", "tax": "406.9", "other_taxes": null, "total": "2950" } ] }, { "id": "C-2024-00023201", "internal_reference": "AD-512/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "ACCESORIOS PARA LABORATORIOS SA DE CV", "normalized_name": "ACCESORIOS PARA LABORATORIOS", "rfc_type": null, "slug": "accesorios-para-laboratorios" }, "contract_period": { "published_at": "2024-03-02T00:26:54.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "831975.95", "tax": "133116.15", "total": "965092.1", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1461624 - SUERO FETAL BOVINO, CERTIFICADO DE EE.UU", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "13080.95", "subtotal": "65404.75", "tax": "10464.76", "other_taxes": null, "total": "75869.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464112 - AMPICILINA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6172.41", "subtotal": "18517.23", "tax": "2962.76", "other_taxes": null, "total": "21479.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464809 - ETHANOL FOR MOLECULAR BIOLOGY FCO 250 ML", "unit": "PIEZA", "requested_quantity": "13", "awarded_quantity": null, "unit_price": "775.62", "subtotal": "10083.06", "tax": "1613.29", "other_taxes": null, "total": "11696.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467876 - DNTP MIX (10 MM EA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2141.3", "subtotal": "2141.3", "tax": "342.61", "other_taxes": null, "total": "2483.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467893 - ETANOL ABSOLUTO PARA ANÁLISIS EMPARTA® ACS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "4434.24", "subtotal": "44342.4", "tax": "7094.78", "other_taxes": null, "total": "51437.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468827 - MARROWMAX™ MEDIO PARA MÉDULA ÓSEA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3776.79", "subtotal": "7553.58", "tax": "1208.57", "other_taxes": null, "total": "8762.15" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468888 - THERMO SCIENTIFIC™ PIERCE™ SUPERSIGNAL™ SUPERSIGNAL MOLECULAR WEIGHT PROTEIN LADDER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6575.54", "subtotal": "6575.54", "tax": "1052.09", "other_taxes": null, "total": "7627.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468926 - HIDROQUINONA (HYDROQUINONE REAGENTPLUS®, >=99%)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "663.09", "subtotal": "663.09", "tax": "106.09", "other_taxes": null, "total": "769.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469309 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, POD (IN SITU CELL DEATH DETECTION)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "13690.53", "subtotal": "68452.65", "tax": "10952.42", "other_taxes": null, "total": "79405.07" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469511 - AGAROSA ULTRAPURE™", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "11565.96", "subtotal": "57829.8", "tax": "9252.77", "other_taxes": null, "total": "67082.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470589 - ACETONITRILO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2345.46", "subtotal": "2345.46", "tax": "375.27", "other_taxes": null, "total": "2720.73" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470591 - KAPA SYBR® FAST ONE-STEP. QRT-PCR KITS - 100 X 20 µL REACTIONS (UNIVERSAL)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "3331.26", "subtotal": "19987.56", "tax": "3198.01", "other_taxes": null, "total": "23185.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469932 - ANTI-MOUSE IGG (FC SPECIFIC)–PEROXIDASE ANTIBODY PRODUCED IN GOAT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6356.55", "subtotal": "6356.55", "tax": "1017.05", "other_taxes": null, "total": "7373.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470711 - FISETIN", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8759.67", "subtotal": "17519.34", "tax": "2803.09", "other_taxes": null, "total": "20322.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471157 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, FLUORESCEÍNA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "12760.53", "subtotal": "51042.12", "tax": "8166.74", "other_taxes": null, "total": "59208.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471238 - FLUORURO DE SODIO (NAF)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "983.01", "subtotal": "983.01", "tax": "157.28", "other_taxes": null, "total": "1140.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471536 - TIZOXANIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8308.62", "subtotal": "8308.62", "tax": "1329.38", "other_taxes": null, "total": "9638" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471540 - NADPH", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3414.03", "subtotal": "3414.03", "tax": "546.24", "other_taxes": null, "total": "3960.27" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471554 - KAPA HIFI HOTSTART+DNTPS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2628.18", "subtotal": "2628.18", "tax": "420.51", "other_taxes": null, "total": "3048.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471559 - 3- O -METILQUERCETINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16679.55", "subtotal": "16679.55", "tax": "2668.73", "other_taxes": null, "total": "19348.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471616 - KIT CYTOSCAN™ 750K PLUS 24", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "178088.08", "subtotal": "178088.08", "tax": "28494.09", "other_taxes": null, "total": "206582.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471617 - KIT CYTOSCAN™ 750K SUITE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "145842.46", "subtotal": "145842.46", "tax": "23334.79", "other_taxes": null, "total": "169177.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471632 - KIT DE EXTRACCIÓN DE GEL EZNA® (V-SPIN)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5075.95", "subtotal": "20303.8", "tax": "3248.61", "other_taxes": null, "total": "23552.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471666 - KIT PARA DETERMINACIÓN IL-6 HUMANA DUOSET® ELISA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1745.61", "subtotal": "1745.61", "tax": "279.3", "other_taxes": null, "total": "2024.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471701 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, RÁPIDO), MONOCLONAL DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15742.11", "subtotal": "15742.11", "tax": "2518.74", "other_taxes": null, "total": "18260.85" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471702 - ANTICUERPO MONOCLONAL ANTI-DNA/RNA DAÑO PRODUCIDO EN RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12365.28", "subtotal": "12365.28", "tax": "1978.44", "other_taxes": null, "total": "14343.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471704 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, LENTO) PRODUCIDO EN RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15671.43", "subtotal": "15671.43", "tax": "2507.43", "other_taxes": null, "total": "18178.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471705 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, RÁPIDO)-FOSFATASA ALCALINA PRODUCIDO EN RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12271.35", "subtotal": "12271.35", "tax": "1963.42", "other_taxes": null, "total": "14234.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471729 - 2-METILBUTANO, PARA ESPECTROSCOPIA UVASOL®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4619.31", "subtotal": "4619.31", "tax": "739.09", "other_taxes": null, "total": "5358.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471735 - DAPI, DICLORHIDRATO (TINTE DE UNIÓN AL ADN PERMEABLE A LAS CÉLULAS)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3807.42", "subtotal": "3807.42", "tax": "609.19", "other_taxes": null, "total": "4416.61" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471772 - ANTICUERPO ANTI-BRAF (V600E), MONOCLONAL DE CONEJO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10691.28", "subtotal": "10691.28", "tax": "1710.6", "other_taxes": null, "total": "12401.88" } ] }, { "id": "C-2024-00023165", "internal_reference": "AD-513/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "HIROSTECNOLOGIAS SA DE CV", "normalized_name": "HIROSTECNOLOGIAS", "rfc_type": null, "slug": "hirostecnologias" }, "contract_period": { "published_at": "2024-03-02T00:17:49.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "101154.02", "tax": "16184.64", "total": "117338.66", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1468791 - DNA LADDER 100 BP, 100-3000BP (54µG/500µL)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "799.2", "subtotal": "3996", "tax": "639.36", "other_taxes": null, "total": "4635.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469276 - DNA LADDER  50BP , 50-1500BP, 1X500UL VIAL", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "1498.5", "subtotal": "10489.5", "tax": "1678.32", "other_taxes": null, "total": "12167.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469277 - DNA LADDER 100 BP, 100-1500 BP (50µG/500µL )", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1132.2", "subtotal": "5661", "tax": "905.76", "other_taxes": null, "total": "6566.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469641 - TAQ DNA POLYMERASE (500 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1365.3", "subtotal": "4095.9", "tax": "655.34", "other_taxes": null, "total": "4751.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469852 - MIDORI GREEN ADVANCE (TINCIÓN DE ADN/ARN)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1964.7", "subtotal": "11788.2", "tax": "1886.11", "other_taxes": null, "total": "13674.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470871 - DNTP MIX 10 MM (2,5 MM CADA UNO)- ATP, DCTP, DGTP Y DCTP MEZCLADOS EN UN TUBO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "732.6", "subtotal": "2197.8", "tax": "351.65", "other_taxes": null, "total": "2549.45" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470872 - TAQ DNA POLYMERASE (5000 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "9274.05", "subtotal": "46370.25", "tax": "7419.24", "other_taxes": null, "total": "53789.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471543 - RESINA DE NÍQUEL PARA UNA ALTA RECUPERACIÓN DE PROTEÍNAS MARCADAS CON HISTIDINA. NI SEPHAROSE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9525.65", "subtotal": "9525.65", "tax": "1524.1", "other_taxes": null, "total": "11049.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471738 - HYCLONE™ DULBECCO'S MODIFIED EAGLE MEDIUM (DMEM) CON GLUCOSA ALTA: POLVO. CON: L-GLUTAMINA, GLUCOSA SIN: PIRUVATO DE SODIO, BICARBONATO DE SODIO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1301.29", "subtotal": "2602.58", "tax": "416.41", "other_taxes": null, "total": "3018.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471739 - RPMI 1640, CON L-GLUTAMINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1350.46", "subtotal": "2700.92", "tax": "432.15", "other_taxes": null, "total": "3133.07" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471753 - MEDIOS DE CRIOCONSERVACIÓN HYCLONE HYCRYO-STEM 2X PARA CÉLULAS MADRE; FILTRADO ESTÉRIL DE 0,2 UM.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1726.22", "subtotal": "1726.22", "tax": "276.2", "other_taxes": null, "total": "2002.42" } ] }, { "id": "C-2024-00023168", "internal_reference": "AD-514/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "normalized_name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "rfc_type": null }, "contract_period": { "published_at": "2024-03-02T00:20:13.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "1256080", "tax": "200972.8", "total": "1457052.8", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1462615 - CLOROFORMO GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2500", "subtotal": "12500", "tax": "2000", "other_taxes": null, "total": "14500" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464589 - LYMPHOPREP™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7200", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464686 - GELRED® NUCLEIC ACID GEL STAIN, 10,000X IN WATER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3700", "subtotal": "3700", "tax": "592", "other_taxes": null, "total": "4292" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464802 - DAB PEROXIDASE (HRP) SUBSTRATE KIT (WITH NICKEL), 3,3’-DIAMINOBENZIDINE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5800", "subtotal": "17400", "tax": "2784", "other_taxes": null, "total": "20184" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464806 - VECTASHIELD® ANTIFADE MOUNTING MEDIUM", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5600", "subtotal": "11200", "tax": "1792", "other_taxes": null, "total": "12992" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466828 - BUFFER DE CITRATOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6600", "subtotal": "13200", "tax": "2112", "other_taxes": null, "total": "15312" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468880 - RAT IL-6 ELISA KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14900", "subtotal": "29800", "tax": "4768", "other_taxes": null, "total": "34568" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469198 - LIOFILCHEM™ MTS™ AMOXICILLIN [AML] 0.016-256 µG/ML. MIC TEST STRIP 30 TIRAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469199 - LIOFILCHEM™ MTS™ CLARITHROMYCIN [CLR] 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469200 - LIOFILCHEM™ MTS™ LEVOFLOXACIN [LEV] 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2990", "subtotal": "11960", "tax": "1913.6", "other_taxes": null, "total": "13873.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469201 - LIOFILCHEM™ MTS™ METRONIDAZOLE [MTZ] 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470534 - POLY-L-LYSINE SOLUTION 0.1% DE SOLUCIÓN ACUOSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5900", "subtotal": "5900", "tax": "944", "other_taxes": null, "total": "6844" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469765 - XILENO, A.C.S.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "5600", "subtotal": "56000", "tax": "8960", "other_taxes": null, "total": "64960" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469842 - ß-NICOTINAMIDE ADENINE DINUCLEOTIDE REDUCED DISODIUM SALT =98%", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3500", "subtotal": "14000", "tax": "2240", "other_taxes": null, "total": "16240" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469843 - SALSA® MLPA® EK1 REAGENT KIT 100 REACTIONS (6 VIALS) - FAM: ABI-PRISM 3100, ABI-PRISM 3100 AVANT , ABI-3130, ABI-3130XL, ABI-3730, ABI-3730XL, ABI-3500", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13800", "subtotal": "13800", "tax": "2208", "other_taxes": null, "total": "16008" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470018 - GOAT ANTI-RABBIT IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5800", "subtotal": "5800", "tax": "928", "other_taxes": null, "total": "6728" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470019 - HORSE ANTI-GOAT IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5800", "subtotal": "5800", "tax": "928", "other_taxes": null, "total": "6728" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470020 - HORSE ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5800", "subtotal": "11600", "tax": "1856", "other_taxes": null, "total": "13456" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470022 - M.O.M.® (MOUSE ON MOUSE) IMMUNODETECTION KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9900", "subtotal": "9900", "tax": "1584", "other_taxes": null, "total": "11484" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470975 - REACTIVO DE TINCIÓN FLUORO-JADE® C RTDTM®", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "17300", "subtotal": "34600", "tax": "5536", "other_taxes": null, "total": "40136" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470976 - ÁCIDO ARAQUIDÓNICO (AA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6000", "subtotal": "6000", "tax": "960", "other_taxes": null, "total": "6960" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470990 - KIT DE ENSAYO ELISA 20-HETE (ÁCIDO 20-HIDROXIEICOSATETRAENOICO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12100", "subtotal": "12100", "tax": "1936", "other_taxes": null, "total": "14036" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471005 - ANTICUERPO POLICLONAL PPAR GAMMA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10700", "subtotal": "10700", "tax": "1712", "other_taxes": null, "total": "12412" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471059 - FSL-1 (PAM2CGDPKHPKSF), LIPOPROTEÍNA DIACILADA SINTÉTICA; AGONISTA DE TLR2/TLR6", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9700", "subtotal": "9700", "tax": "1552", "other_taxes": null, "total": "11252" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471060 - HEK-BLUE™ SELECTION. ANTIBIÓTICOS PARA EL MANTENIMIENTO DE HEK-BLUE™ CELLS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5000", "subtotal": "5000", "tax": "800", "other_taxes": null, "total": "5800" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471062 - LPS-EK ESTÁNDAR (LPS DE E. COLI K12)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5500", "subtotal": "5500", "tax": "880", "other_taxes": null, "total": "6380" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471063 - NORMOCIN™ REACTIVO ANTIMICROBIANO (1 BOTELLA DE 20 ML (1 G) )", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8900", "subtotal": "8900", "tax": "1424", "other_taxes": null, "total": "10324" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471064 - PAM3CSK4 (PAM3CYSSERLYS4), LIPOPÉPTIDO TRIACILADO SINTÉTICO; AGONISTA DE TLR2/TLR1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5900", "subtotal": "5900", "tax": "944", "other_taxes": null, "total": "6844" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471067 - QUANTI-BLUE™ MEDIO DE DETECCIÓN DE FOSFATASA ALCALINA, FORMA LÍQUIDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21000", "subtotal": "21000", "tax": "3360", "other_taxes": null, "total": "24360" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471074 - TIRA DE PRUEBA AMIKACIN [AK] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471076 - TIRA DE PRUEBA CEFEPIME [FEP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471077 - TIRA DE PRUEBA CEFTAZIDIME [CAZ] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471078 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2990", "subtotal": "8970", "tax": "1435.2", "other_taxes": null, "total": "10405.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471079 - TIRA DE PRUEBA IMIPENEM - RELEBACTAM [I/R] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002/4-32/4 µG/ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2990", "subtotal": "11960", "tax": "1913.6", "other_taxes": null, "total": "13873.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471080 - TIRA DE PRUEBA MEROPENEM [MRP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471081 - TIRA DE PRUEBA AZTREONAM - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471082 - TIRA DE PRUEBA CEFIDEROCOL MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2990", "subtotal": "11960", "tax": "1913.6", "other_taxes": null, "total": "13873.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471083 - TIRA DE PRUEBA CEFTAZIDIME - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2990", "subtotal": "11960", "tax": "1913.6", "other_taxes": null, "total": "13873.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471085 - TIRA DE PRUEBA CIPROFLOXACIN [CIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471086 - TIRA DE PRUEBA COLISTIN [CS] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471089 - TIRA DE PRUEBA IMIPENEM [IMI] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471090 - TIRA DE PRUEBA MEROPENEM - VABORBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/8-256/8 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471094 - TIRA DE PRUEBA PIPERACILLIN [PIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471095 - TIRA DE PRUEBA PIPERACILLIN-TAZOBACTAM [TZP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471096 - TIRA DE PRUEBA TICARCILLIN-CLAVULANIC ACID [TTC] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/2-256/2 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471097 - TIRA DE PRUEBA TOBRAMYCIN [TOB] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2990", "subtotal": "5980", "tax": "956.8", "other_taxes": null, "total": "6936.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471114 - ALCOHOL, ANHIDRO, REACTIVO ACS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3300", "subtotal": "9900", "tax": "1584", "other_taxes": null, "total": "11484" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471119 - SALSA ® MLPA ® PROBEMIX P034 DMD-1. REGIÓN: DMD XP21.1-P21.2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "22000", "subtotal": "22000", "tax": "3520", "other_taxes": null, "total": "25520" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471227 - DESOXICOLATO DE SODIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1000", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471517 - MEDIO DE MONTAJE ANTIDECOLORACIÓN VECTASHIELD® CON DAPI", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6000", "subtotal": "6000", "tax": "960", "other_taxes": null, "total": "6960" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471518 - REACTIVO DE TRANSFECCIÓN TRANS IT®-LT1", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13200", "subtotal": "26400", "tax": "4224", "other_taxes": null, "total": "30624" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471568 - 10NM SILVER NANOPARTICLES", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5600", "subtotal": "16800", "tax": "2688", "other_taxes": null, "total": "19488" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471574 - ENSAYOS DE CALPROTECTINA FECAL EN HECES HUMANAS, BÜHLMANN FCAL® ELISA (RANGO:30-1800 µG/G)", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "23300", "subtotal": "233000", "tax": "37280", "other_taxes": null, "total": "270280" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471575 - DISPOSITIVO BÜHLMANN CALEX® CAP, CONTIENE 5 ML, TAMPÓN DE EXTRACCIÓN FECAL DE CALPROTECTINA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "21300", "subtotal": "106500", "tax": "17040", "other_taxes": null, "total": "123540" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471576 - POLYMYXIN B (UN INHIBIDOR DE LA ACTIVACIÓN DE TLR4 INDUCIDA POR LPS)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5300", "subtotal": "15900", "tax": "2544", "other_taxes": null, "total": "18444" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471587 - ZEOCIN® (ANTIBIÓTICO SELECTIVO PARA EL GEN SH BLE; CULTIVO CELULAR PROBADO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7100", "subtotal": "7100", "tax": "1136", "other_taxes": null, "total": "8236" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471588 - BLASTICIDINA (SOLUCIÓN)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8900", "subtotal": "8900", "tax": "1424", "other_taxes": null, "total": "10324" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471589 - G418 (GENETICINA), SOLUCIÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3200", "subtotal": "3200", "tax": "512", "other_taxes": null, "total": "3712" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471591 - FLA-ST ULTRAPURE ( FAGELINA PURIFICADA DE S. TYPHIMURIUM; LIGANDO TLR5)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20000", "subtotal": "20000", "tax": "3200", "other_taxes": null, "total": "23200" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471620 - PROTEÍNA SAG1 DE TOXOPLASMA GONDII RECOMBINANTE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23100", "subtotal": "23100", "tax": "3696", "other_taxes": null, "total": "26796" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471631 - MINI KIT I DE ADN PLASMÍDICO EZNA® (V-SPIN)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "5200", "subtotal": "31200", "tax": "4992", "other_taxes": null, "total": "36192" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471636 - TINCIÓN EOSINA NIGROSINA DE ESPERMATOZOIDES 30 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1500", "subtotal": "1500", "tax": "240", "other_taxes": null, "total": "1740" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471639 - SALSA ® MLPA ® PROBEMIX P035 DMD-1. REGIÓN: DMD XP21.1-P21.2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "22000", "subtotal": "22000", "tax": "3520", "other_taxes": null, "total": "25520" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471642 - PE-CYANINE7 ANTI-HUMAN CD45RA (HI100)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5800", "subtotal": "5800", "tax": "928", "other_taxes": null, "total": "6728" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471643 - APC-CIANINA7 CD45RO ANTIHUMANO (UCHL1)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9500", "subtotal": "9500", "tax": "1520", "other_taxes": null, "total": "11020" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471644 - ANTICUERPO MONOCLONAL CD185 (CXCR5) (MU5UBEE), BRILLIANT VIOLET™ 421, EBIOSCIENCE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4500", "subtotal": "4500", "tax": "720", "other_taxes": null, "total": "5220" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471645 - ANTICUERPO MONOCLONAL CD69 (FN50), BRILLIANT VIOLET™ 650, EBIOSCIENCE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4500", "subtotal": "4500", "tax": "720", "other_taxes": null, "total": "5220" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471648 - PROTEÍNA DE FUSIÓN CD40 (HUMANA)-MUIG (R-PE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19900", "subtotal": "19900", "tax": "3184", "other_taxes": null, "total": "23084" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471670 - DISCOS DE SUSCEPTIBILIDAD ANTIMICROBIANA DE CEFTAROLINA OXOID™, 30 µG. CPT30", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1200", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471671 - DISCOS PARA ANTIBIOGRAMAS CON TEICOPLANINA OXOID™, 30 µG", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1200", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471678 - DISCOS PARA ANTIBIOGRAMAS CON TRIMETOPRIMA/SULFAMETOXAZOL 1:19 OXOID™, 25 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1200", "subtotal": "4800", "tax": "768", "other_taxes": null, "total": "5568" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471723 - ANTICUERPO TAU (CONEJO, POLICLONAL, IGG)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10700", "subtotal": "10700", "tax": "1712", "other_taxes": null, "total": "12412" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471741 - (±)11(12)-EET", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12100", "subtotal": "12100", "tax": "1936", "other_taxes": null, "total": "14036" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471743 - KIT DE ENSAYO ELISA 11,12 EET DHET", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12100", "subtotal": "12100", "tax": "1936", "other_taxes": null, "total": "14036" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471744 - KIT DE ENSAYO ELISA 14,15 DHET", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12100", "subtotal": "12100", "tax": "1936", "other_taxes": null, "total": "14036" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471747 - 17- ÁCIDO OCTADECINOICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "22100", "subtotal": "22100", "tax": "3536", "other_taxes": null, "total": "25636" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471749 - PROTEÍNA RECOMBINANTE CYP2C9", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14500", "subtotal": "14500", "tax": "2320", "other_taxes": null, "total": "16820" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471767 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2990", "subtotal": "2990", "tax": "478.4", "other_taxes": null, "total": "3468.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471773 - KIT DE SECUENCIACIÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "61900", "subtotal": "61900", "tax": "9904", "other_taxes": null, "total": "71804" } ] }, { "id": "C-2024-00023174", "internal_reference": "AD-515/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "MAYIMEX SA DE CV", "normalized_name": "MAYIMEX", "rfc_type": null, "slug": "mayimex" }, "contract_period": { "published_at": "2024-03-02T00:21:21.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "209900", "tax": "33584", "total": "243484", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1463952 - SUERO FETAL BOVINO", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "10800", "subtotal": "108000", "tax": "17280", "other_taxes": null, "total": "125280" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463961 - FETAL BOVINE SERUM (MÉXICO, USDA APPROVED)", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "9200", "subtotal": "92000", "tax": "14720", "other_taxes": null, "total": "106720" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469732 - SUERO DE CABALLO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1980", "subtotal": "9900", "tax": "1584", "other_taxes": null, "total": "11484" } ] }, { "id": "C-2024-00023180", "internal_reference": "AD-516/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "QUIMILAB SA DE CV", "normalized_name": "QUIMILAB", "rfc_type": null, "slug": "quimilab" }, "contract_period": { "published_at": "2024-03-02T00:22:22.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "451522.37", "tax": "72243.58", "total": "523765.95", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1469795 - GOAT ANTI-MOUSE IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY, BIOTIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2907.88", "subtotal": "2907.88", "tax": "465.26", "other_taxes": null, "total": "3373.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470861 - SONDA VYSIS LSI D7S486 SPECTRUMORANGE/CEP 7 SPECTRUMGREEN SE HIBRIDAN CON LA BANDA 7Q31 (SPECTRUMORANGE LSI D7S486)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "25000", "subtotal": "50000", "tax": "8000", "other_taxes": null, "total": "58000" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470994 - SONDA EN BAC PARA EL CROMOSOMA XP MARCADA EN VERDE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "46875", "subtotal": "93750", "tax": "15000", "other_taxes": null, "total": "108750" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470996 - SONDA EN BAC PARA EL CROMOSOMA XQ MARCADA EN NARANJA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "46875", "subtotal": "93750", "tax": "15000", "other_taxes": null, "total": "108750" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471505 - TARJETAS DE IDENTIFICACIÓN VITEK®2 AST-N403", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "5250", "subtotal": "36750", "tax": "5880", "other_taxes": null, "total": "42630" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471509 - ANEUVYSION MULTICOLOR DNA. KIT CON 5 DIFERENTES SONDAS DE DNA PARA DETECCIÓN DE LOS CROMOSOMAS X,Y, 18 Y 13, 21. PARA 30 ENSAYOS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "122275", "subtotal": "122275", "tax": "19564", "other_taxes": null, "total": "141839" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471510 - SONDA DE DNA PARA LA DETECCIÓN DE LA MICRODELECIÓN LSI 1P36 CON SONDAS PARA 1PTEL Y 1Q25", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19922", "subtotal": "19922", "tax": "3187.52", "other_taxes": null, "total": "23109.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471619 - KIT PARA DETERMINAR OH PROGESTERONA (17-OHP) EN SUERO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7347.49", "subtotal": "7347.49", "tax": "1175.6", "other_taxes": null, "total": "8523.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471732 - SULFATO DE ZINC HEPTAHIDRATADO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "6205", "subtotal": "24820", "tax": "3971.2", "other_taxes": null, "total": "28791.2" } ] }, { "id": "C-2024-00023998", "internal_reference": "AD-517/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "PERKIN-ELMER DE MEXICO SA", "normalized_name": "PERKIN ELMER DE MEXICO", "rfc_type": null, "slug": "perkin-elmer-de-mexico" }, "contract_period": { "published_at": "2024-03-04T21:45:38.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "389861.1", "tax": "62377.78", "total": "452238.88", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1464845 - KIT NO DERIVATIZADO PARA CUANTIFICACIÓN DE AMINOÁCIDOS, ACILCARNITINAS Y SUCCINILACETONA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "129953.7", "subtotal": "389861.1", "tax": "62377.78", "other_taxes": null, "total": "452238.88" } ] }, { "id": "C-2024-00023216", "internal_reference": "AD-518/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "BIOADVANCED SYSTEMS SA DE CV", "normalized_name": "BIOADVANCED SYSTEMS", "rfc_type": null, "slug": "bioadvanced-systems" }, "contract_period": { "published_at": "2024-03-02T00:33:26.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "451113.68", "tax": "72178.19", "total": "523291.87", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1459666 - TRIZOL™ REAGENT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6149.02", "subtotal": "6149.02", "tax": "983.84", "other_taxes": null, "total": "7132.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1461996 - FAST SYBR® GREEN MASTER MIX", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "2143.15", "subtotal": "15002.05", "tax": "2400.33", "other_taxes": null, "total": "17402.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468717 - MULTISCRIBE™ REVERSE TRANSCRIPTASE ( 50 UNITS / µL)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2618.1", "subtotal": "13090.5", "tax": "2094.48", "other_taxes": null, "total": "15184.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469217 - MICROAMP™ OPTICAL ADHESIVE FILM (96-WELL, STANDARD PLATE)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1417.69", "subtotal": "2835.38", "tax": "453.66", "other_taxes": null, "total": "3289.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471330 - HOSTZERO™ MICROBIAL DNA KIT", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "10063.14", "subtotal": "40252.56", "tax": "6440.41", "other_taxes": null, "total": "46692.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471334 - ZYMOTAQ™ PREMIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5056.34", "subtotal": "5056.34", "tax": "809.01", "other_taxes": null, "total": "5865.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471511 - SALIVA DNA COLLECTION AND PRESERVATION DEVICES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12461.01", "subtotal": "12461.01", "tax": "1993.76", "other_taxes": null, "total": "14454.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471512 - SALIVA DNA ISOLATION KIT,", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3101.49", "subtotal": "3101.49", "tax": "496.24", "other_taxes": null, "total": "3597.73" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471656 - KIT MAGMAX™ ADN MULTIMUESTRA ULTRA 2.0", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9765.1", "subtotal": "9765.1", "tax": "1562.42", "other_taxes": null, "total": "11327.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471657 - DYNABEADS® DNA DIRECT™ UNIVERSAL KIT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10377.32", "subtotal": "10377.32", "tax": "1660.37", "other_taxes": null, "total": "12037.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471726 - SUERO BOVINO FETAL, DESPOJADO DE CARBÓN VEGETAL, REGIONES APROBADAS POR EE.UU", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17959.63", "subtotal": "17959.63", "tax": "2873.54", "other_taxes": null, "total": "20833.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471774 - CLARIOM™ D ARRAY, HUMANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "76618.13", "subtotal": "76618.13", "tax": "12258.9", "other_taxes": null, "total": "88877.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471775 - ENSAYO GENECHIP™ GENOMA HUMANO U133 PLUS 2.0", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "231147.29", "subtotal": "231147.29", "tax": "36983.57", "other_taxes": null, "total": "268130.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471778 - KIT QUICK -DNA/RNA MAGBEAD", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7297.86", "subtotal": "7297.86", "tax": "1167.66", "other_taxes": null, "total": "8465.52" } ] }, { "id": "C-2024-00023182", "internal_reference": "AD-519/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "normalized_name": "SILVERA CIENCIA E INGENIERIA", "rfc_type": null, "slug": "silvera-ciencia-e-ingenieria" }, "contract_period": { "published_at": "2024-03-02T00:23:15.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "903884", "tax": "144621.44", "total": "1048505.44", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1463898 - ANTICUERPO ß-ACTIN ANTICUERPO (C4) ES UN MONOCLONAL DE RATÓN IGG1 (200 µG/ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7142", "subtotal": "14284", "tax": "2285.44", "other_taxes": null, "total": "16569.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463976 - CATALASE FLUOROMETRIC DETECTION KIT", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "10152", "subtotal": "60912", "tax": "9745.92", "other_taxes": null, "total": "70657.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463980 - SOD ACTIVITY KIT (5 X 96 WELLS)", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "16351", "subtotal": "114457", "tax": "18313.12", "other_taxes": null, "total": "132770.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464720 - PROTEIN CARBONYL ELISA KIT", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "19591", "subtotal": "97955", "tax": "15672.8", "other_taxes": null, "total": "113627.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464816 - ACIDO TIOBARBITÚRICO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5757", "subtotal": "11514", "tax": "1842.24", "other_taxes": null, "total": "13356.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466853 - KIT ELISA DE CORTICOSTERONA DE ALTA SENSIBILIDAD", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9482", "subtotal": "9482", "tax": "1517.12", "other_taxes": null, "total": "10999.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466929 - ANTICUERPO ANT CRF (2B11)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467977 - PROTEÍNA A/G PLUS-AGAROSA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1428", "subtotal": "1428", "tax": "228.48", "other_taxes": null, "total": "1656.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468830 - ANTIMOUSE IGG ESPECÍFICO PARA FCGAMMA SUBLASE 2C PEROXIDASE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6885", "subtotal": "6885", "tax": "1101.6", "other_taxes": null, "total": "7986.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468903 - NURR1 ANTIBODY (F-5)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7142", "subtotal": "14284", "tax": "2285.44", "other_taxes": null, "total": "16569.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469504 - INICIADORES PARA PCR (SECUENCIA DE 30 BASES:ATCAAG TACAGTTAGTCTTTATTAGATCAA), LIBRE DE SAL", "unit": "PIEZA", "requested_quantity": "174", "awarded_quantity": null, "unit_price": "313", "subtotal": "54462", "tax": "8713.92", "other_taxes": null, "total": "63175.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469515 - MTT FORMAZAN (CAS 57360-69-7)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2880", "subtotal": "5760", "tax": "921.6", "other_taxes": null, "total": "6681.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469800 - SUERO DE BURRO NORMAL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1728", "subtotal": "3456", "tax": "552.96", "other_taxes": null, "total": "4008.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469827 - ACETYL COENZYME A TRILITHIUM SALT TRIHYDRATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "18099", "subtotal": "18099", "tax": "2895.84", "other_taxes": null, "total": "20994.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469828 - ALBUMINA SÉRICA BÓVINA FRACCIÓN V", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "24769", "subtotal": "49538", "tax": "7926.08", "other_taxes": null, "total": "57464.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470602 - CATALASE, >=2000 U/MG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1286", "subtotal": "1286", "tax": "205.76", "other_taxes": null, "total": "1491.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469877 - TRA1/A2 ANTICUERPO (2103)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469883 - NADP, DISODIUM SALT (CAS 24292-60-2)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "6912", "subtotal": "27648", "tax": "4423.68", "other_taxes": null, "total": "32071.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469890 - ANTI-IBA1 ANTIBODY (1022-5)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470999 - KIT ELISA DE DAÑO RÁPIDO DEL ADN PARA CÁNCER, APOPTOSIS Y ESTRÉS OXIDATIVO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "20693", "subtotal": "41386", "tax": "6621.76", "other_taxes": null, "total": "48007.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471069 - PEROXIDASA AFFINIPURE CABRA ANTI-RATÓN IGG (H+L). (MIN X HU, BOV, HRS SR PROT)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3942", "subtotal": "3942", "tax": "630.72", "other_taxes": null, "total": "4572.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471169 - CASPASE-1 ANTICUERPO (14F468)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7142", "subtotal": "14284", "tax": "2285.44", "other_taxes": null, "total": "16569.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471171 - COENZIMA A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9216", "subtotal": "9216", "tax": "1474.56", "other_taxes": null, "total": "10690.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471180 - KV1.3 ANTICUERPO (G-9)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471184 - PERMETRINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "33156", "subtotal": "66312", "tax": "10609.92", "other_taxes": null, "total": "76921.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471523 - ANTICUERPO GFAP (2E1)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471524 - ANTICUERPO SOX-2 (E-4)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471525 - EF-CAB1 ANTICUERPO (B-2)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471557 - KIT DE GLUTATIÓN REDUCTASA (GR) ENZYCHROM™", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "7752", "subtotal": "31008", "tax": "4961.28", "other_taxes": null, "total": "35969.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471558 - KIT DE ENSAYO ENZYCHROM™ GSH/GSSG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "8481", "subtotal": "33924", "tax": "5427.84", "other_taxes": null, "total": "39351.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471579 - TIM ANTICUERPO (H-11) ALEXA FLUOR® 680", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8064", "subtotal": "16128", "tax": "2580.48", "other_taxes": null, "total": "18708.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471593 - INTEGRIN AV/ß3/CD51/CD61 ANTICUERPO (23C6) ALEXA FLUOR® 405", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8064", "subtotal": "8064", "tax": "1290.24", "other_taxes": null, "total": "9354.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471596 - CDK2 ANTICUERPO (D-12) ALEXA FLUOR® 488", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8064", "subtotal": "8064", "tax": "1290.24", "other_taxes": null, "total": "9354.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471597 - COFILIN ANTICUERPO (E-8) ALEXA FLUOR® 594", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8064", "subtotal": "8064", "tax": "1290.24", "other_taxes": null, "total": "9354.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471598 - SORORIN ANTICUERPO (B-9) ALEXA FLUOR® 790", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8064", "subtotal": "8064", "tax": "1290.24", "other_taxes": null, "total": "9354.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471622 - PEROXIDASA AFFINIPURE GOAT ANTI-MOUSE IGM, ESPECÍFICO DE CADENA µ", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5643", "subtotal": "5643", "tax": "902.88", "other_taxes": null, "total": "6545.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471629 - CYTOKERATIN 19 ANTIBODY (BA17)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471630 - HISTONE H3 ANTICUERPO (1G1)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471633 - (-)-GALATO DE EPIGALOCATEQUINA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5161", "subtotal": "20644", "tax": "3303.04", "other_taxes": null, "total": "23947.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471638 - ANTICUERPO POLICLONAL RECEPTOR DE ESTRÓGENO ß (BETA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17582", "subtotal": "17582", "tax": "2813.12", "other_taxes": null, "total": "20395.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471654 - IGG 1 DE RATÓN NORMAL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "691", "subtotal": "691", "tax": "110.56", "other_taxes": null, "total": "801.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471706 - CLORURO DE SODIO (NACI), REACTIVO DE CULTIVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3129", "subtotal": "3129", "tax": "500.64", "other_taxes": null, "total": "3629.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471727 - CASPASE-3 ANTICUERPO (31A1067)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471728 - BML-275, INHIBIDOR DE AMPK", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10174", "subtotal": "10174", "tax": "1627.84", "other_taxes": null, "total": "11801.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471731 - 5-BROMO-2'-DEOXYURIDINE (5-BRDU)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10647", "subtotal": "10647", "tax": "1703.52", "other_taxes": null, "total": "12350.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471760 - SOMATOSTATIN ANTICUERPO (H-11)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7142", "subtotal": "7142", "tax": "1142.72", "other_taxes": null, "total": "8284.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471762 - AGAR PARA BACTERIOLOGIA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16906", "subtotal": "16906", "tax": "2704.96", "other_taxes": null, "total": "19610.96" } ] }, { "id": "C-2024-00023205", "internal_reference": "AD-520/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "normalized_name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS", "rfc_type": null, "slug": "comercializadora-e-importadora-de-productos-quimicos" }, "contract_period": { "published_at": "2024-03-02T00:28:25.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "1200812", "tax": "192129.92", "total": "1392941.92", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1463983 - GLUTATHIONE REDUCTASE ACTIVITY KIT", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "20336", "subtotal": "101680", "tax": "16268.8", "other_taxes": null, "total": "117948.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464717 - KIT PARA MEDICIÓN DE T3 EN SUERO DE RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16610", "subtotal": "16610", "tax": "2657.6", "other_taxes": null, "total": "19267.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464718 - KIT PARA MEDICIÓN DE T4 EN SUERO DE RATA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "16610", "subtotal": "33220", "tax": "5315.2", "other_taxes": null, "total": "38535.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1465512 - DAB (3,3’-DIAMINOBENZIDINE ) CHROMOGEN SYSTEM. KIT DE 100 ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11673", "subtotal": "23346", "tax": "3735.36", "other_taxes": null, "total": "27081.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468876 - ANTICUERPO PRIMARIO BDNF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11758", "subtotal": "11758", "tax": "1881.28", "other_taxes": null, "total": "13639.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470497 - ALEXA FLUOR® 647 ANTI-HUMAN CD127 (IL-7R?) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8987", "subtotal": "8987", "tax": "1437.92", "other_taxes": null, "total": "10424.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469733 - 20-HETE (20-HYDROXY ARACHIDONIC ACID)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15970", "subtotal": "15970", "tax": "2555.2", "other_taxes": null, "total": "18525.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469740 - KIT DETERMINACIÓN TESTOSTERONA 96 POZOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5229", "subtotal": "10458", "tax": "1673.28", "other_taxes": null, "total": "12131.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470731 - RESORUFIN ETHYL ETER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "44937", "subtotal": "44937", "tax": "7189.92", "other_taxes": null, "total": "52126.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470938 - BD BBL™ SENSI-DISC™ LINEZOLID, 30 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2619", "subtotal": "10476", "tax": "1676.16", "other_taxes": null, "total": "12152.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470965 - APC/CYANINE7 ANTI-HUMAN CD196 (CCR6) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9765", "subtotal": "9765", "tax": "1562.4", "other_taxes": null, "total": "11327.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470970 - PE ANTI-HUMAN CD183 (CXCR3) ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10623", "subtotal": "10623", "tax": "1699.68", "other_taxes": null, "total": "12322.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470980 - SUCCINIL-COA SINTETASA ( E. COLI )", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26564", "subtotal": "26564", "tax": "4250.24", "other_taxes": null, "total": "30814.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471506 - DETECCIÓN UNIVERSAL DE POLÍMERO HRP MACH 1™", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "58294", "subtotal": "174882", "tax": "27981.12", "other_taxes": null, "total": "202863.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471513 - KIT ELISA DEL FACTOR NEUROTRÓFICO DERIVADO DEL CEREBRO DE RATA. (BDNF): BRAIN DERIVED NEUROTROPHIC FACTOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15825", "subtotal": "15825", "tax": "2532", "other_taxes": null, "total": "18357" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471514 - KIT ST ELISA, SEROTONINA DE RATA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11737", "subtotal": "11737", "tax": "1877.92", "other_taxes": null, "total": "13614.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471515 - HIDRATO DE SULFURO DE SODIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2585", "subtotal": "2585", "tax": "413.6", "other_taxes": null, "total": "2998.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471533 - 2-AMINOBENZOXAZOLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1838", "subtotal": "1838", "tax": "294.08", "other_taxes": null, "total": "2132.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471569 - NANOCOMPOSIX SILVER NANOSPHERES, 10 NM (BIOPURE, 1 MG/ML, BARE (CITRATE), 1 ML, AQUEOUS 2 MM SODIUM CITRATE)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10707", "subtotal": "21414", "tax": "3426.24", "other_taxes": null, "total": "24840.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471580 - Z -FR-AMC FLUOROGENIC PEPTIDE SUBSTRATE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7499", "subtotal": "14998", "tax": "2399.68", "other_taxes": null, "total": "17397.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471584 - KIT DE ENSAYO DE MICROPLACAS DE HEXOQUINASA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11857", "subtotal": "11857", "tax": "1897.12", "other_taxes": null, "total": "13754.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471585 - KIT DE ENSAYO DE ACTIVIDAD DE 6-FOSFOFRUCTOQUINASA (PFK)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6446", "subtotal": "6446", "tax": "1031.36", "other_taxes": null, "total": "7477.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471586 - KIT DE ENSAYO COLORIMÉTRICO DE PIRUVATO QUINASA (PK)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5484", "subtotal": "5484", "tax": "877.44", "other_taxes": null, "total": "6361.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471590 - CÉLULAS HEK-BLUE™-HTLR5 (CÉLULAS SEAP REPORTER 293 QUE EXPRESAN EL GEN TLR5 HUMANO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "45538", "subtotal": "45538", "tax": "7286.08", "other_taxes": null, "total": "52824.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471594 - INTEGRINA ALFAV, BETA3, PROTEÍNA ACTIVA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24411", "subtotal": "24411", "tax": "3905.76", "other_taxes": null, "total": "28316.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471595 - COFILINA 1, NO MUSCULAR (CFL1), PROTEÍNA ACTIVA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9212", "subtotal": "9212", "tax": "1473.92", "other_taxes": null, "total": "10685.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471612 - AGAROSA LE, EEO BAJO, GRADO DE BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16215", "subtotal": "16215", "tax": "2594.4", "other_taxes": null, "total": "18809.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471624 - ANTICUERPO CD34 ANTI-RATÓN PURIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7860", "subtotal": "7860", "tax": "1257.6", "other_taxes": null, "total": "9117.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471625 - ANTICUERPO RECOMBINANTE ANTI-CD45 DE RATÓN PURIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5848", "subtotal": "5848", "tax": "935.68", "other_taxes": null, "total": "6783.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471626 - ANTICUERPO CD54 O ICAM-1, ANTI-RATÓN PURIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3649", "subtotal": "3649", "tax": "583.84", "other_taxes": null, "total": "4232.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471627 - ANTICUERPO ANTI-RATÓN CD284 (TLR4) PURIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4266", "subtotal": "4266", "tax": "682.56", "other_taxes": null, "total": "4948.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471628 - ANTICUERPO DE GALECTINA-3 (MAC-2) ANTI-RATÓN/HUMANO PURIFICADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6921", "subtotal": "6921", "tax": "1107.36", "other_taxes": null, "total": "8028.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471634 - DETECCIÓN RATÓN HRP-POLÍMERO MACH 2™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26751", "subtotal": "26751", "tax": "4280.16", "other_taxes": null, "total": "31031.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471640 - PROTEÍNA IL-12 HUMANA RECOMBINANTE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "10323", "subtotal": "30969", "tax": "4955.04", "other_taxes": null, "total": "35924.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471641 - PROTEÍNA IL-23 HUMANA RECOMBINANTE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11604", "subtotal": "23208", "tax": "3713.28", "other_taxes": null, "total": "26921.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471646 - ANTICUERPO ANTI-CD25 HUMANO PACIFIC BLUE™", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3461", "subtotal": "3461", "tax": "553.76", "other_taxes": null, "total": "4014.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471649 - ANTIHUMAN CD4 PERCP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8987", "subtotal": "8987", "tax": "1437.92", "other_taxes": null, "total": "10424.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471650 - ANTICUERPO ANTI-CD45RA HUMANO FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1771", "subtotal": "1771", "tax": "283.36", "other_taxes": null, "total": "2054.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471651 - ANTICUERPO BIOTINILADO DE IFN-GAMMA HUMANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15206", "subtotal": "15206", "tax": "2432.96", "other_taxes": null, "total": "17638.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471652 - ANTICUERPO BIOTINILADO IL-6 HUMANO/PRIMATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15473", "subtotal": "15473", "tax": "2475.68", "other_taxes": null, "total": "17948.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471653 - ANTICUERPO BIOTINILADO IL-17/IL-17A HUMANO/PRIMATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15473", "subtotal": "15473", "tax": "2475.68", "other_taxes": null, "total": "17948.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471660 - ÁCIDO DL- P -HIDROXIFENILLÁCTICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11365", "subtotal": "11365", "tax": "1818.4", "other_taxes": null, "total": "13183.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471663 - ÁCIDO 3-HIDROXIPROPIÓNICO, SOLUCIÓN AL 30% EN AGUA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2078", "subtotal": "2078", "tax": "332.48", "other_taxes": null, "total": "2410.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471667 - KIT PARA DETERMINACIÓN TNF-ALFA HUMANO DUOSET® ELISA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12431", "subtotal": "12431", "tax": "1988.96", "other_taxes": null, "total": "14419.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471668 - KIT PARA DETERMINACIÓN IL-10 HUMANA DUOSET® ELISA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12431", "subtotal": "12431", "tax": "1988.96", "other_taxes": null, "total": "14419.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471675 - MENADIONA (K3)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1278", "subtotal": "5112", "tax": "817.92", "other_taxes": null, "total": "5929.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471697 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU , AP", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "17793", "subtotal": "35586", "tax": "5693.76", "other_taxes": null, "total": "41279.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471703 - ANTICUERPO ANTI-COLINA ACETILTRANSFERASA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16498", "subtotal": "16498", "tax": "2639.68", "other_taxes": null, "total": "19137.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471707 - KIT DE ELISA ULTRA SENSIBLE PARA DETECTAR INSULINA DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12904", "subtotal": "12904", "tax": "2064.64", "other_taxes": null, "total": "14968.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471730 - PANEL DE INFLAMACIÓN DE RATAS LEGENDPLEX™ (13-PLEX) CON FP V02", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "47239", "subtotal": "47239", "tax": "7558.24", "other_taxes": null, "total": "54797.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471733 - ANTICUERPO DE CABRA ANTI-IGG HUMANA, EL CONJUGADO HRP DETECTA EL NIVEL DE IGG HUMANA Y HA SIDO PUBLICADO Y VALIDADO PARA SU USO EN ELISA Y WB.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13349", "subtotal": "26698", "tax": "4271.68", "other_taxes": null, "total": "30969.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471734 - KIT DE TINCIÓN DE MITOCONDRIAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15510", "subtotal": "15510", "tax": "2481.6", "other_taxes": null, "total": "17991.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471742 - (±)14(15)-EET", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13221", "subtotal": "13221", "tax": "2115.36", "other_taxes": null, "total": "15336.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471745 - ARREGLO DE INFLAMACIÓN HUMANA C3", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16340", "subtotal": "16340", "tax": "2614.4", "other_taxes": null, "total": "18954.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471746 - MATRIZ C2 DE NF-¿B HUMANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16340", "subtotal": "16340", "tax": "2614.4", "other_taxes": null, "total": "18954.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471748 - PROTEÍNA RECOMBINANTE CYP2J2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19000", "subtotal": "19000", "tax": "3040", "other_taxes": null, "total": "22040" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471761 - KIT PARA MEDICIÓN DE LONGITUD DE TELOMEROS POR CITOMETRÍA DE FLUJO PNA KIT/FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36337", "subtotal": "36337", "tax": "5813.92", "other_taxes": null, "total": "42150.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471764 - SULFATO DE CEFTOLOZANO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4133", "subtotal": "8266", "tax": "1322.56", "other_taxes": null, "total": "9588.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471769 - ANTICUERPO BIOTINA ANTI-IGE HUMANA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5526", "subtotal": "5526", "tax": "884.16", "other_taxes": null, "total": "6410.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471770 - ANEXINA V FITC", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5205", "subtotal": "5205", "tax": "832.8", "other_taxes": null, "total": "6037.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471771 - AGENCOURT® RNACLEAN® XP, 40ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26046", "subtotal": "26046", "tax": "4167.36", "other_taxes": null, "total": "30213.36" } ] }, { "id": "C-2024-00023190", "internal_reference": "AD-521/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "normalized_name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE", "rfc_type": null, "slug": "distribucion-y-mantenimiento-del-noroeste" }, "contract_period": { "published_at": "2024-03-02T00:24:56.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "1321693.51", "tax": "211470.96", "total": "1533164.47", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1451016 - FOSFATO DE SODIO, DIBÁSICO, ANHIDRO, REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "559.21", "subtotal": "1118.42", "tax": "178.95", "other_taxes": null, "total": "1297.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463996 - ETHANOL ABSOLUTO PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "480.48", "subtotal": "8648.64", "tax": "1383.78", "other_taxes": null, "total": "10032.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464015 - ETHANOL ABSOLUTE FOR ANALYSIS EMSURE AC", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "910.91", "subtotal": "7287.28", "tax": "1165.96", "other_taxes": null, "total": "8453.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464018 - EXTRAN® MA 02 SUPELCO®, LÍQUIDO, NEUTRO, CONCENTRADO", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "765", "subtotal": "11475", "tax": "1836", "other_taxes": null, "total": "13311" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464103 - 2-PROPANOL (ISOPROPANOL GRADO BIOLOGÍA MOLECULAR )", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1688.05", "subtotal": "8440.25", "tax": "1350.44", "other_taxes": null, "total": "9790.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464120 - D-GLUCOSE 6 PHOSPHATE DISODIUM SALT HYDRATE", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1936", "subtotal": "7744", "tax": "1239.04", "other_taxes": null, "total": "8983.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464128 - ETANOL ABSOLUTO GRADO BIOL. MOL", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1430.52", "subtotal": "5722.08", "tax": "915.53", "other_taxes": null, "total": "6637.61" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464157 - PHENOL-CLOROFORMO-ISOAMILICO (25:24:1)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2983.89", "subtotal": "17903.34", "tax": "2864.53", "other_taxes": null, "total": "20767.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464177 - TWEEN 20 VISCOUS LIQUID", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "748.93", "subtotal": "748.93", "tax": "119.83", "other_taxes": null, "total": "868.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464762 - METANOL SUPELCO® PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2511.6", "subtotal": "2511.6", "tax": "401.86", "other_taxes": null, "total": "2913.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466198 - COMPLETE™ PROTEASE INHIBITOR COCKTAIL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9595.95", "subtotal": "9595.95", "tax": "1535.35", "other_taxes": null, "total": "11131.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466209 - DNASE I RECOMBINANT, RNASE-FREE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5172.44", "subtotal": "15517.32", "tax": "2482.77", "other_taxes": null, "total": "18000.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466296 - TRIPTONA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3104.92", "subtotal": "3104.92", "tax": "496.79", "other_taxes": null, "total": "3601.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466877 - CLORURO DE SODIO, CRISTAL, BAKER ANALYZED™ A.C.S. REACTIVO,", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "209", "subtotal": "209", "tax": "33.44", "other_taxes": null, "total": "242.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466967 - O-PHENYLENEDIAMINE DIHYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9851.67", "subtotal": "9851.67", "tax": "1576.27", "other_taxes": null, "total": "11427.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467895 - HIDRÓGENO PERÓXIDO 30%", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "789.88", "subtotal": "1579.76", "tax": "252.76", "other_taxes": null, "total": "1832.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468013 - BRDU", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2758.21", "subtotal": "16549.26", "tax": "2647.88", "other_taxes": null, "total": "19197.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468047 - GLYCEROL", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3394.3", "subtotal": "13577.2", "tax": "2172.35", "other_taxes": null, "total": "15749.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468734 - AZUL TRIPÁN SOLUCIÓN DE 0.4%, LÍQUIDO, FILTRADO ESTÉRIL, ADECUADO PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "849", "subtotal": "3396", "tax": "543.36", "other_taxes": null, "total": "3939.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468746 - BACTO™ AGAR SOLDIFYING AGENT, BD DIAGNOSTICS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2891", "subtotal": "2891", "tax": "462.56", "other_taxes": null, "total": "3353.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468841 - ÁCIDO ORTO-FOSFÓRICO 85% (EMSURE® ACS, ISO, REAG.)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1838.2", "subtotal": "1838.2", "tax": "294.11", "other_taxes": null, "total": "2132.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468842 - ACEITE DE INMERSIÓN PARA MICROSCOPIA (INMERSION OIL FOR MICROSCOPY)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "626.08", "subtotal": "1878.24", "tax": "300.52", "other_taxes": null, "total": "2178.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468877 - CELL PROLIFERATION KIT II (XTT)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "12604.41", "subtotal": "75626.46", "tax": "12100.23", "other_taxes": null, "total": "87726.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468898 - DTT 1,4-DITHIOTHREITOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10663.38", "subtotal": "10663.38", "tax": "1706.14", "other_taxes": null, "total": "12369.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468899 - COMPLETE™, MINI, EDTA-FREE PROTEASE INHIBITOR COCKTAIL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5342.61", "subtotal": "5342.61", "tax": "854.82", "other_taxes": null, "total": "6197.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468916 - CHLORAMPHENICOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1373.19", "subtotal": "1373.19", "tax": "219.71", "other_taxes": null, "total": "1592.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468938 - QUERCETINA (QUERCETIN) 95% (HPLC), SÓLIDO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1239.42", "subtotal": "1239.42", "tax": "198.31", "other_taxes": null, "total": "1437.73" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468949 - AGAROSA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "34752.3", "subtotal": "104256.9", "tax": "16681.1", "other_taxes": null, "total": "120938" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468958 - AURANOFIN ?98% (HPLC)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10583.3", "subtotal": "10583.3", "tax": "1693.33", "other_taxes": null, "total": "12276.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468977 - HEMATOXYLIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3101.28", "subtotal": "3101.28", "tax": "496.2", "other_taxes": null, "total": "3597.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468993 - AMERSHAM™ PROTRAN® WESTERN BLOTTING MEMBRANES, NITROCELLULOSE ( 0.45 ?M, SHEET W × L 100 MM × 100 MM)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3809.3", "subtotal": "7618.6", "tax": "1218.98", "other_taxes": null, "total": "8837.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468997 - PROTEINASE K FROM TRITIRACHIUM ALBUM", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4172.35", "subtotal": "12517.05", "tax": "2002.73", "other_taxes": null, "total": "14519.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469001 - RESVERATROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3786.51", "subtotal": "3786.51", "tax": "605.84", "other_taxes": null, "total": "4392.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469307 - HUMAN ADIPONECTIN ELISA KIT 96 PZOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "15629.25", "subtotal": "31258.5", "tax": "5001.36", "other_taxes": null, "total": "36259.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469376 - CITOCROMO C DE CORAZÓN BOVINO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5587.4", "subtotal": "5587.4", "tax": "893.98", "other_taxes": null, "total": "6481.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469392 - ISOPROPANOL GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "836.29", "subtotal": "6690.32", "tax": "1070.45", "other_taxes": null, "total": "7760.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469394 - LB BROTH, MILLER, MEDIO DE CULTIVO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "4025.84", "subtotal": "16103.36", "tax": "2576.54", "other_taxes": null, "total": "18679.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469414 - SULFATO DE MAGNESIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2264.99", "subtotal": "2264.99", "tax": "362.4", "other_taxes": null, "total": "2627.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469423 - CLORHIDRATO DE CISTEAMINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2000.18", "subtotal": "2000.18", "tax": "320.03", "other_taxes": null, "total": "2320.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470488 - CALDO SOYA TRIPTICASEÍNA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1813", "subtotal": "3626", "tax": "580.16", "other_taxes": null, "total": "4206.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469823 - ANTI-NEUN ANTIBODY, CLONE A60 CHEMICON® DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7677.67", "subtotal": "7677.67", "tax": "1228.43", "other_taxes": null, "total": "8906.1" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469894 - LECTIN FORMO PHASEOLUS VULGARIS (RED KIDNEY BEAN)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1829.1", "subtotal": "1829.1", "tax": "292.66", "other_taxes": null, "total": "2121.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469906 - ETANOL GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7382.83", "subtotal": "7382.83", "tax": "1181.25", "other_taxes": null, "total": "8564.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469915 - N,O-BIS(TRIMETHYLSILYL)TRIFLUOROACETAMIDE WITH TRIMETHYLCHLOROSILANE FOR GC DERIVATIZATION, LICHROPUR™, CONTAINS 1% TMCS, 99% (EXCLUDING TMCS)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4181.45", "subtotal": "4181.45", "tax": "669.03", "other_taxes": null, "total": "4850.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470690 - MALTOSA (D-(+)-MALTOSA MONOHIDRATO)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5993.9", "subtotal": "11987.8", "tax": "1918.05", "other_taxes": null, "total": "13905.85" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470702 - BUTYRYL COENZYME A LITHIUM SALT HYDRATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8513.05", "subtotal": "8513.05", "tax": "1362.09", "other_taxes": null, "total": "9875.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470718 - KAEMPFEROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3449.81", "subtotal": "3449.81", "tax": "551.97", "other_taxes": null, "total": "4001.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470722 - MINIMUM ESSENTIAL MEDIUM EAGLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1011.01", "subtotal": "1011.01", "tax": "161.76", "other_taxes": null, "total": "1172.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470724 - MYRICETIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3399.76", "subtotal": "3399.76", "tax": "543.96", "other_taxes": null, "total": "3943.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470732 - S-(5?-ADENOSYL)-L-METHIONINE CHLORIDE DIHYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5122.39", "subtotal": "5122.39", "tax": "819.58", "other_taxes": null, "total": "5941.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469969 - TARTRATO DE POTASIO Y SODIO TETRAHIDRATADO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1797.25", "subtotal": "1797.25", "tax": "287.56", "other_taxes": null, "total": "2084.81" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469971 - TRICINE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11757.2", "subtotal": "23514.4", "tax": "3762.3", "other_taxes": null, "total": "27276.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469977 - CELL PROLIFERATION REAGENT WST-1", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13408.85", "subtotal": "26817.7", "tax": "4290.83", "other_taxes": null, "total": "31108.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469982 - ADENOSINE 5´-TRIPHOSPHATE DISODIUM SALT HYDRATE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1579.76", "subtotal": "4739.28", "tax": "758.28", "other_taxes": null, "total": "5497.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470945 - SOBRES DE SISTEMA DE RECIPIENTES DE CO2 GASPAK™ EZ", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2066", "subtotal": "2066", "tax": "330.56", "other_taxes": null, "total": "2396.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471103 - TAMPÓN DE LISIS RIPA, 10X, PARA INMUNOPRECIPITACIÓN Y TRANSFERENCIA WESTERN.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2319.59", "subtotal": "2319.59", "tax": "371.13", "other_taxes": null, "total": "2690.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471105 - ACETONITRILO HIPERGRADO PARA LC-MS LICHROSOLV®", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4608.24", "subtotal": "4608.24", "tax": "737.32", "other_taxes": null, "total": "5345.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471106 - METANOL PARA CROMATOGRAFÍA LÍQUIDA LICHROSOLV®", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1809.08", "subtotal": "9045.4", "tax": "1447.26", "other_taxes": null, "total": "10492.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471156 - GLUCOSA-6-FOSFATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2654.47", "subtotal": "2654.47", "tax": "424.72", "other_taxes": null, "total": "3079.19" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471195 - 5,5'-DITHIOBIS(2-NITROBENZOIC ACID): (DTNB).BIOREAGENT®", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2793.7", "subtotal": "5587.4", "tax": "893.98", "other_taxes": null, "total": "6481.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471200 - ÁCIDO BÓRICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2480.66", "subtotal": "2480.66", "tax": "396.91", "other_taxes": null, "total": "2877.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471207 - ALCOHOL ETÍLICO PURO (ETANOL), PARA 200 PRUEBAS BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1939.21", "subtotal": "1939.21", "tax": "310.27", "other_taxes": null, "total": "2249.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471220 - CLORHIDRATO DE VITAMINA B12A", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7928.83", "subtotal": "7928.83", "tax": "1268.61", "other_taxes": null, "total": "9197.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471224 - COENZIMA A HIDRATO (COA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2584.4", "subtotal": "2584.4", "tax": "413.5", "other_taxes": null, "total": "2997.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471240 - GUANOSINE 5'-DIPHOSPHATE SODIUM SALT (GDP)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1947.4", "subtotal": "1947.4", "tax": "311.58", "other_taxes": null, "total": "2258.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471257 - METILMALONIL COENZIMA A TETRALITIO SAL HIDRATADA (MM-COA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13013", "subtotal": "13013", "tax": "2082.08", "other_taxes": null, "total": "15095.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471265 - PHOSPHATE BUFFERED SALINE. PH 7.4, PHAST PACK™, POWDER", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2302.3", "subtotal": "2302.3", "tax": "368.37", "other_taxes": null, "total": "2670.67" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471271 - RPMI-1640 MEDIO (CON L-GLUTAMINA Y BICARBONATO DE SODIO, LÍQUIDO, ESTERILIZADO POR FILTRACIÓN, APTO PARA CULTIVO CELULAR)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1114.75", "subtotal": "5573.75", "tax": "891.8", "other_taxes": null, "total": "6465.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471282 - SOLUCIÓN DE ROJO FENOL", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "711.62", "subtotal": "2846.48", "tax": "455.44", "other_taxes": null, "total": "3301.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471294 - ß-NAPHTHOFLAVONE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1285.83", "subtotal": "1285.83", "tax": "205.73", "other_taxes": null, "total": "1491.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471504 - GLICEROL PARA BIOLOGÍA MOLECULAR, =99,0%", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2851.03", "subtotal": "14255.15", "tax": "2280.82", "other_taxes": null, "total": "16535.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471507 - METRONIDAZOL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3142.23", "subtotal": "6284.46", "tax": "1005.51", "other_taxes": null, "total": "7289.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471508 - ALBENDAZOL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2040.22", "subtotal": "4080.44", "tax": "652.87", "other_taxes": null, "total": "4733.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471516 - CITRATO DE SODIO TRIBÁSICO DIHYDRATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1155.7", "subtotal": "1155.7", "tax": "184.91", "other_taxes": null, "total": "1340.61" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471526 - TEMOZOLOMIDA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3025.75", "subtotal": "6051.5", "tax": "968.24", "other_taxes": null, "total": "7019.74" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471527 - 2-AMINO-5-NITROTHIAZOLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "823.55", "subtotal": "823.55", "tax": "131.77", "other_taxes": null, "total": "955.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471528 - CLOROQUINA SAL DE DIFOSFATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1910.09", "subtotal": "1910.09", "tax": "305.61", "other_taxes": null, "total": "2215.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471529 - SULFATO DE HIDROXICLOROQUINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6036.03", "subtotal": "6036.03", "tax": "965.76", "other_taxes": null, "total": "7001.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471530 - NITAZOXANIDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4841.1", "subtotal": "4841.1", "tax": "774.58", "other_taxes": null, "total": "5615.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471531 - 2-AMINOTHIAZOLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "841.75", "subtotal": "841.75", "tax": "134.68", "other_taxes": null, "total": "976.43" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471532 - 2-AMINOBENZOTHIAZOLE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1383.2", "subtotal": "1383.2", "tax": "221.31", "other_taxes": null, "total": "1604.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471534 - 2-AMINO-6-NITROBENZOTIAZOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "897.26", "subtotal": "897.26", "tax": "143.56", "other_taxes": null, "total": "1040.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471535 - 2-AMINO-6-METILBENZOTIAZOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1067.43", "subtotal": "1067.43", "tax": "170.79", "other_taxes": null, "total": "1238.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471537 - ISPF (A-ISONITROSOPROPIOPHENONE)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1013.74", "subtotal": "1013.74", "tax": "162.2", "other_taxes": null, "total": "1175.94" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471538 - GLUTAMATO DESHIDROGENASA (GLDH) DE HÍGADO DE RES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2356.9", "subtotal": "2356.9", "tax": "377.1", "other_taxes": null, "total": "2734" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471539 - UREASA DE CANAVALIA ENSIFORMIS (JUDÍA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1956.5", "subtotal": "1956.5", "tax": "313.04", "other_taxes": null, "total": "2269.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471541 - POLYVINYLPYRROLIDONE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4296.11", "subtotal": "4296.11", "tax": "687.38", "other_taxes": null, "total": "4983.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471542 - TETRACICLINA CLORHIDRATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2237.69", "subtotal": "2237.69", "tax": "358.03", "other_taxes": null, "total": "2595.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471544 - GENTAMICINA SULFATE SALT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3302.39", "subtotal": "3302.39", "tax": "528.38", "other_taxes": null, "total": "3830.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471545 - TAURINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2130.31", "subtotal": "2130.31", "tax": "340.85", "other_taxes": null, "total": "2471.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471546 - ANFOTERICINA B SOLUTION", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2649.01", "subtotal": "2649.01", "tax": "423.84", "other_taxes": null, "total": "3072.85" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471547 - PIRUVATO SÓDICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3640", "subtotal": "3640", "tax": "582.4", "other_taxes": null, "total": "4222.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471548 - SAL TRISÓDICA DE INOSINA 5'-TRIFOSFATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2181.27", "subtotal": "2181.27", "tax": "349", "other_taxes": null, "total": "2530.27" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471549 - ZIDOVUDINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2422.42", "subtotal": "2422.42", "tax": "387.59", "other_taxes": null, "total": "2810.01" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471550 - SULFATO DE COBRE (II)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4897.62", "subtotal": "4897.62", "tax": "783.62", "other_taxes": null, "total": "5681.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471551 - UREA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1759.94", "subtotal": "1759.94", "tax": "281.59", "other_taxes": null, "total": "2041.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471552 - CITRATO DE HIERRO Y AMONIO (III)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1415.96", "subtotal": "1415.96", "tax": "226.55", "other_taxes": null, "total": "1642.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471553 - CEFALOTINA SAL SÓDICA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3566.29", "subtotal": "3566.29", "tax": "570.61", "other_taxes": null, "total": "4136.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471555 - ACETONITRILO, GRADO HPLC, 99.9% DE PUREZA", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "1295", "subtotal": "25900", "tax": "4144", "other_taxes": null, "total": "30044" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471556 - EXTRAN® MA 05 (LÍQUIDO, ALCALINO, CONCENTRADO SIN FOSFATOS)", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "940", "subtotal": "7520", "tax": "1203.2", "other_taxes": null, "total": "8723.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471560 - KAEMPFEROL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36588.37", "subtotal": "36588.37", "tax": "5854.14", "other_taxes": null, "total": "42442.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471567 - ANTIBIOTIC ANTIMICOTIC SOLUTION (100X), STIBILIZED", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1119.3", "subtotal": "4477.2", "tax": "716.35", "other_taxes": null, "total": "5193.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471570 - AGAR CETRIMIDA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2794.61", "subtotal": "5589.22", "tax": "894.28", "other_taxes": null, "total": "6483.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471571 - COLLAGEN FROM HUMAN PLACENTA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7603.96", "subtotal": "7603.96", "tax": "1216.63", "other_taxes": null, "total": "8820.59" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471572 - ASPARAGINE PROLINE BROTH", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6029.66", "subtotal": "6029.66", "tax": "964.75", "other_taxes": null, "total": "6994.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471573 - NESSLER'S REAGENT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "611.52", "subtotal": "611.52", "tax": "97.84", "other_taxes": null, "total": "709.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471577 - SUCCINATO DE SOLIFENACINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1238.51", "subtotal": "2477.02", "tax": "396.32", "other_taxes": null, "total": "2873.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471578 - BROMHIDRATO DE DARIFENACINA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1689.87", "subtotal": "3379.74", "tax": "540.76", "other_taxes": null, "total": "3920.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471582 - SODIO CARBONATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1092.91", "subtotal": "1092.91", "tax": "174.87", "other_taxes": null, "total": "1267.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471583 - L-CARNOSINE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3222.31", "subtotal": "3222.31", "tax": "515.57", "other_taxes": null, "total": "3737.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471592 - SOLUCIÓN DE D-GLICERALDEHÍDO 3-FOSFATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7387.38", "subtotal": "7387.38", "tax": "1181.98", "other_taxes": null, "total": "8569.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471599 - FENOL, PARA BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1408.68", "subtotal": "1408.68", "tax": "225.39", "other_taxes": null, "total": "1634.07" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471600 - DODECILSULFATO DE SODIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2649.01", "subtotal": "2649.01", "tax": "423.84", "other_taxes": null, "total": "3072.85" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471601 - CLORURO DE GUANIDINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "990.99", "subtotal": "990.99", "tax": "158.56", "other_taxes": null, "total": "1149.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471602 - ACETATO DE POTASIO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "744.38", "subtotal": "744.38", "tax": "119.1", "other_taxes": null, "total": "863.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471603 - CITRATO DE SODIO TRIBÁSICO DIHIDRATO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "600.6", "subtotal": "600.6", "tax": "96.1", "other_taxes": null, "total": "696.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471604 - ACETATO DE SODIO TRIHYDRATE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1093.82", "subtotal": "1093.82", "tax": "175.01", "other_taxes": null, "total": "1268.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471605 - KIT DE TRADUCCIÓN DE NICK", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7007", "subtotal": "7007", "tax": "1121.12", "other_taxes": null, "total": "8128.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471606 - FLUORESCEÍNA-12-DUTP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7999.2", "subtotal": "7999.2", "tax": "1279.87", "other_taxes": null, "total": "9279.07" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471608 - TETRAMETIL-RODAMINA-5-DUTP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7748.4", "subtotal": "7748.4", "tax": "1239.74", "other_taxes": null, "total": "8988.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471611 - TIMIDINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1047.41", "subtotal": "1047.41", "tax": "167.59", "other_taxes": null, "total": "1215" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471621 - EVANS BLUE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1632.54", "subtotal": "1632.54", "tax": "261.21", "other_taxes": null, "total": "1893.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471623 - PROTEÍNA A-SEPHAROSE ® DE STAPHYLOCOCCUS AUREUS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6861.4", "subtotal": "6861.4", "tax": "1097.82", "other_taxes": null, "total": "7959.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471635 - ACETATO DE LEUPRORELINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10134.67", "subtotal": "10134.67", "tax": "1621.55", "other_taxes": null, "total": "11756.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471637 - PROGESTERONA (POLVO, BIOREAGENT, APTO PARA CULTIVO CELULAR)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5069.61", "subtotal": "5069.61", "tax": "811.14", "other_taxes": null, "total": "5880.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471658 - AGUA GRADO UHPLC, PARA USO EN ESPECTROMETRÍA DE MASAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14128.66", "subtotal": "14128.66", "tax": "2260.59", "other_taxes": null, "total": "16389.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471659 - ÁCIDO 4-HIDROXI-FENILPIRÚVICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1896.44", "subtotal": "1896.44", "tax": "303.43", "other_taxes": null, "total": "2199.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471661 - ÁCIDO 4-HIDROXI-FENIL-ACÉTICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "644.28", "subtotal": "644.28", "tax": "103.08", "other_taxes": null, "total": "747.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471662 - ÁCIDO METILMALÓNICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1582.49", "subtotal": "1582.49", "tax": "253.2", "other_taxes": null, "total": "1835.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471664 - ÁCIDO ß-HIDROXIISOVALÉRICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10848.11", "subtotal": "10848.11", "tax": "1735.7", "other_taxes": null, "total": "12583.81" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471665 - ÁCIDO 4-METIL-2-OXOVALÉRICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1708.07", "subtotal": "1708.07", "tax": "273.29", "other_taxes": null, "total": "1981.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471669 - AGAR SOYA BD BBL™ TRYPTICASE™ (MEDIO DE AGAR DIGERIDO DE SOJA Y CASEÍNA)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2435", "subtotal": "14610", "tax": "2337.6", "other_taxes": null, "total": "16947.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471674 - DISCOS DE FACTOR X", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1301.3", "subtotal": "5205.2", "tax": "832.83", "other_taxes": null, "total": "6038.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471680 - SOLUCIÓN DE HEMINA (0.5 G/L)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2682.9", "subtotal": "8048.7", "tax": "1287.79", "other_taxes": null, "total": "9336.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471681 - TIMIDINA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3627.26", "subtotal": "10881.78", "tax": "1741.08", "other_taxes": null, "total": "12622.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471686 - BD DIFCO ™ CALDO MUELLER HINTON 500G", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2440", "subtotal": "4880", "tax": "780.8", "other_taxes": null, "total": "5660.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471687 - GENTAMICINA SAL DE SULFATO DE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2263.17", "subtotal": "2263.17", "tax": "362.11", "other_taxes": null, "total": "2625.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471689 - DALVABANCINA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9694.8", "subtotal": "9694.8", "tax": "1551.17", "other_taxes": null, "total": "11245.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471690 - DAPTOMICINA (ANTIBIÓTICO LIPOPÉPTIDO CÍCLICO)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9504.04", "subtotal": "9504.04", "tax": "1520.65", "other_taxes": null, "total": "11024.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471691 - SAL DE MESILATO DE DEFEROXAMINA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3105.83", "subtotal": "15529.15", "tax": "2484.66", "other_taxes": null, "total": "18013.81" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471692 - 1,1,3,3-TETRAETOXIPROPANO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7899.71", "subtotal": "7899.71", "tax": "1263.95", "other_taxes": null, "total": "9163.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471693 - QUERCETIN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6341.79", "subtotal": "6341.79", "tax": "1014.69", "other_taxes": null, "total": "7356.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471694 - REACTIVO DE FENOL DE FOLIN & CIOCALTEU", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4580.94", "subtotal": "4580.94", "tax": "732.95", "other_taxes": null, "total": "5313.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471699 - HEXAHIDRATO DE CLORURO DE COBALTO (II). REACTIVO ACS, 98%", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1805.44", "subtotal": "1805.44", "tax": "288.87", "other_taxes": null, "total": "2094.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471700 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, LENTO), MONOCLONAL DE RATÓN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10618.79", "subtotal": "10618.79", "tax": "1699.01", "other_taxes": null, "total": "12317.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471724 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, TMR ROJO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12871.04", "subtotal": "12871.04", "tax": "2059.37", "other_taxes": null, "total": "14930.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471725 - ELTROMBOPAG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8461.18", "subtotal": "8461.18", "tax": "1353.79", "other_taxes": null, "total": "9814.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471736 - POLIVINILPIRROLIDONA (PESO MOLAR PROMEDIO 40,000)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1250.34", "subtotal": "1250.34", "tax": "200.05", "other_taxes": null, "total": "1450.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471740 - ÁCIDO GÁLICO ANHIDRO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "612.43", "subtotal": "612.43", "tax": "97.99", "other_taxes": null, "total": "710.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471756 - CH-223191", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10963.68", "subtotal": "10963.68", "tax": "1754.19", "other_taxes": null, "total": "12717.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471757 - CLOTETRACICLINA (CTC)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1573.39", "subtotal": "3146.78", "tax": "503.48", "other_taxes": null, "total": "3650.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471758 - LECTINA DE ARACHIS HIPOGAEA (MANÍ)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9428.51", "subtotal": "18857.02", "tax": "3017.12", "other_taxes": null, "total": "21874.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471759 - HIALURONIDASA DE TESTÍCULOS BOVINOS. TIPO IV-S, POLVO LIOFILIZADO (ESENCIALMENTE SIN SAL), 750-3000 UNIDADES/MG DE SÓLIDO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4283.4", "subtotal": "4283.4", "tax": "685.34", "other_taxes": null, "total": "4968.74" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471766 - AVIBACTAM SÓDICO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9383.92", "subtotal": "9383.92", "tax": "1501.43", "other_taxes": null, "total": "10885.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471768 - SOLUCIÓN PREPARADA DE FLEOMICINA (0,2 µM FILTRADO, 20 MG/ML EN HEPES DE 20 MM)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1960.14", "subtotal": "3920.28", "tax": "627.24", "other_taxes": null, "total": "4547.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471780 - MEZCLA ESTÁNDAR DE ÉSTERES METÍLICOS DE ÁCIDOS GRASOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6025.8", "subtotal": "12051.6", "tax": "1928.26", "other_taxes": null, "total": "13979.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471782 - IONÓFORO DE CALCIO A23187. =98% (TLC), POLVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14710.15", "subtotal": "14710.15", "tax": "2353.62", "other_taxes": null, "total": "17063.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471783 - M16 MEDIUM", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1314.95", "subtotal": "6574.75", "tax": "1051.96", "other_taxes": null, "total": "7626.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466955 - ESTROPTOZOCINA, >=75 % EN BASE A ANÓMERO ALFA, >=98 % (HPLC), POLVO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "36156.12", "subtotal": "180780.6", "tax": "28924.9", "other_taxes": null, "total": "209705.5" } ] }, { "id": "C-2024-00023748", "internal_reference": "AD-522/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "LAB TECH INSTRUMENTACION SA DE CV", "normalized_name": "LAB TECH INSTRUMENTACION", "rfc_type": null, "slug": "lab-tech-instrumentacion" }, "contract_period": { "published_at": "2024-03-04T22:58:08.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "52791", "tax": "8446.56", "total": "61237.56", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1460497 - SULFATO DE ALUMINIO Y POTASIO, 12 HIDRATOS, CRISTAL, GRADO REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "991", "subtotal": "3964", "tax": "634.24", "other_taxes": null, "total": "4598.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1462752 - BILIS DE BUEY. ELABORADA BAJO PROCESO DE BAJAS TEMPERATURAS Y DESHIDRATACIÓN", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1590", "subtotal": "3180", "tax": "508.8", "other_taxes": null, "total": "3688.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1463447 - METANOL <=99.9% (POR GC, CORREGIDO POR CONTENIDO DE AGUA), BAKER ANALYZED ™ HPLC PARA CROMATOGRAFÍA LÍQUIDA, PARA HPLC / UHPLC", "unit": "PIEZA", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "671", "subtotal": "10736", "tax": "1717.76", "other_taxes": null, "total": "12453.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1466303 - XILENOS, GRADO REACTIVO BAKER ANALYZED™ ACS", "unit": "PIEZA", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "2144", "subtotal": "19296", "tax": "3087.36", "other_taxes": null, "total": "22383.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469495 - ALCOHOL ETILICO (ETANOL) AL 96 %", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3586", "subtotal": "10758", "tax": "1721.28", "other_taxes": null, "total": "12479.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469500 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 10, COLOR AZUL", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "126", "subtotal": "252", "tax": "40.32", "other_taxes": null, "total": "292.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469501 - AMORTIGUADOR (BUFFER)DE REFERENCIA PH 4.0, COLOR ROSA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "110", "subtotal": "220", "tax": "35.2", "other_taxes": null, "total": "255.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469502 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 7, COLOR AMARILLO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "110", "subtotal": "220", "tax": "35.2", "other_taxes": null, "total": "255.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470571 - 2-PROPANOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4165", "subtotal": "4165", "tax": "666.4", "other_taxes": null, "total": "4831.4" } ] }, { "id": "C-2024-00023212", "internal_reference": "AD-523/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "QUIMICA VIRMEL SA DE CV", "normalized_name": "QUIMICA VIRMEL", "rfc_type": null, "slug": "quimica-virmel" }, "contract_period": { "published_at": "2024-03-02T00:30:50.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "81500.65", "tax": "13040.1", "total": "94540.75", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1467902 - HUMAN LEPTIN DUAL RANGE ELISA KIT/96 POZOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13625.52", "subtotal": "27251.04", "tax": "4360.17", "other_taxes": null, "total": "31611.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471248 - KIT ELISA DE IL18 HUMANA/INTERLEUCINA-18", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16055.15", "subtotal": "16055.15", "tax": "2568.82", "other_taxes": null, "total": "18623.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471564 - HIDROXIDO DE AMONIO SOLUCIÓN. REACTIVO ACS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1676.7", "subtotal": "1676.7", "tax": "268.27", "other_taxes": null, "total": "1944.97" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471673 - DISCOS DE FACTOR X + V", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1008.79", "subtotal": "4035.16", "tax": "645.63", "other_taxes": null, "total": "4680.79" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471676 - BD BBL ™ SENSI-DISC ™ AZTREONAM ATM-30 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2643.85", "subtotal": "10575.4", "tax": "1692.06", "other_taxes": null, "total": "12267.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471679 - DISCO NITROFURANTOÍNA F/M-300 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2454.6", "subtotal": "9818.4", "tax": "1570.94", "other_taxes": null, "total": "11389.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471695 - ÓXIDO DE 1,2-PROPILENO", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1865.3", "subtotal": "11191.8", "tax": "1790.69", "other_taxes": null, "total": "12982.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471754 - A (ALPHA)-NAFTOFLAVONA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "897", "subtotal": "897", "tax": "143.52", "other_taxes": null, "total": "1040.52" } ] }, { "id": "C-2024-00023709", "internal_reference": "AD-525/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "INSUMOS Y ACCESORIOS CIENTIFICOS SA DE CV", "normalized_name": "INSUMOS Y ACCESORIOS CIENTIFICOS", "rfc_type": null, "slug": "insumos-y-accesorios-cientificos" }, "contract_period": { "published_at": "2024-03-04T23:02:14.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "14326.2", "tax": "2292.19", "total": "16618.39", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1466249 - TETROXIDO DE OSMIO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1176", "subtotal": "3528", "tax": "564.48", "other_taxes": null, "total": "4092.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469742 - GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 25%", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1041.6", "subtotal": "2083.2", "tax": "333.31", "other_taxes": null, "total": "2416.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470991 - SOLUCIÓN DE ACEITE ROJO O-ISOPROPANOL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "785.4", "subtotal": "785.4", "tax": "125.66", "other_taxes": null, "total": "911.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471696 - GLUTARALDEHÍDO GRADO PARA MICROSCOPÍA ELECTRÓNICA. SOLUCIÓN ACUOSA AL 70%", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2452.8", "subtotal": "4905.6", "tax": "784.9", "other_taxes": null, "total": "5690.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471698 - KIT EMBED 812 PARA INCLUSIÓN EN MICROSCOPÍA ELECTRÓNICA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3024", "subtotal": "3024", "tax": "483.84", "other_taxes": null, "total": "3507.84" } ] }, { "id": "C-2024-00023287", "internal_reference": "AD-526/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV", "normalized_name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL", "rfc_type": null, "slug": "distribuidora-quimica-y-hospitalaria-aravel" }, "contract_period": { "published_at": "2024-03-02T00:34:39.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-03-31T06:00:00.000Z" }, "value": { "subtotal": "153845.78", "tax": "24615.32", "total": "178461.1", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1464621 - BD BBL™ AGAR SAL Y MANITOL, 500 G", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1809.08", "subtotal": "18090.8", "tax": "2894.53", "other_taxes": null, "total": "20985.33" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470924 - BD BBL™ BASE DE AGAR SANGRE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2828.79", "subtotal": "8486.37", "tax": "1357.82", "other_taxes": null, "total": "9844.19" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470957 - SENSIDISCOS DE AMPICILINA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2279", "subtotal": "6837", "tax": "1093.92", "other_taxes": null, "total": "7930.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470958 - SENSIDISCOS DE VANCOMICINA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2401.44", "subtotal": "7204.32", "tax": "1152.69", "other_taxes": null, "total": "8357.01" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471502 - AGAROSA D1 BAJA EEO", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "12127.5", "subtotal": "48510", "tax": "7761.6", "other_taxes": null, "total": "56271.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471655 - LYSE/FIX BUFFER 5X", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10272", "subtotal": "10272", "tax": "1643.52", "other_taxes": null, "total": "11915.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471677 - DISCO DE PRUEBA DE SUSCEPTIBILIDAD ANTIMICROBIANA SENSI-DISC™ CEFAZOLINA 30 µG", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2250.19", "subtotal": "9000.76", "tax": "1440.12", "other_taxes": null, "total": "10440.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471682 - BD SENSI-DISC ™ PENICILINA P-10 UNIDADES", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2304.92", "subtotal": "6914.76", "tax": "1106.36", "other_taxes": null, "total": "8021.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471683 - BBL™ SENSI-DISC™ TETRACICLINA 30 µG", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2320.78", "subtotal": "6962.34", "tax": "1113.97", "other_taxes": null, "total": "8076.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471684 - DISCO OXACILINA OX-1 µG", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2304.92", "subtotal": "6914.76", "tax": "1106.36", "other_taxes": null, "total": "8021.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471685 - BD SENSI-DISC™ TOBRAMICINA 10 µG", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2381.27", "subtotal": "7143.81", "tax": "1143.01", "other_taxes": null, "total": "8286.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471688 - SENSIDISCOS DE GENTAMICINA ALTA CARGA\nBD SENSI-DISC™ GENTAMICINA 120 µG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "439.36", "subtotal": "439.36", "tax": "70.3", "other_taxes": null, "total": "509.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471765 - AGAROSA D5", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17069.5", "subtotal": "17069.5", "tax": "2731.12", "other_taxes": null, "total": "19800.62" } ] }, { "id": "C-2024-00023791", "internal_reference": "AD-527/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "QUIMICA VALANER SA DE CV", "normalized_name": "QUIMICA VALANER", "rfc_type": null, "slug": "quimica-valaner" }, "contract_period": { "published_at": "2024-03-04T22:52:06.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "444095", "tax": "71055.2", "total": "515150.2", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1463839 - ANTI-RABBIT IGG, HRP-LINKED ANTIBODY", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4759", "subtotal": "9518", "tax": "1522.88", "other_taxes": null, "total": "11040.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464093 - KIT PARA CUANTIFICACIÓN NEONATAL HTSH FEIA PLUS, EN MICROPLACA DE LA HORMONA ESTIMULANTE DE LA TIROIDES TIROTROFINA (TSH) EN SANGRE TOTAL DE NEONATOS COLECTADA EN PAPEL FILTRO CON CALIBRADORES Y CONTROLES INTERNOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "35568", "subtotal": "71136", "tax": "11381.76", "other_taxes": null, "total": "82517.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464689 - ANTI-MOUSE IGG HRP- LINKED ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4759", "subtotal": "4759", "tax": "761.44", "other_taxes": null, "total": "5520.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464713 - MARCADOR DE PROTEÍNA AZUL PRETEÑIDO, RANGO AMPLIO (11-250 KDA)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2746", "subtotal": "8238", "tax": "1318.08", "other_taxes": null, "total": "9556.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1467736 - KIT PARA CUANTIFICACIÓN NEONATAL G6PD (GLUCOSA 6-FOSFATO DESHIDROGENASA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "30096", "subtotal": "30096", "tax": "4815.36", "other_taxes": null, "total": "34911.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469314 - ENZIMA DE RESTRICCION APAI", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "8662", "subtotal": "43310", "tax": "6929.6", "other_taxes": null, "total": "50239.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469316 - ENZIMA DE RESTRICCIÓN MSPA1I KIT (10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8662", "subtotal": "8662", "tax": "1385.92", "other_taxes": null, "total": "10047.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470619 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13799", "subtotal": "13799", "tax": "2207.84", "other_taxes": null, "total": "16006.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469022 - PHUSION® HIGH-FIDELITY DNA POLYMERASE (2,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3279", "subtotal": "6558", "tax": "1049.28", "other_taxes": null, "total": "7607.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471122 - ENZIMA DE RESTRICCION ALWI (CONCENTRACIÓN: 10,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2050", "subtotal": "2050", "tax": "328", "other_taxes": null, "total": "2378" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471123 - ENZIMA DE RESTRICCION NLAIII. CONCENTRACIÓN:10.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8416", "subtotal": "8416", "tax": "1346.56", "other_taxes": null, "total": "9762.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471124 - ENZIMA DE RESTRICCION SMAI (PEQUEÑO, RECOMBINANTE). CONCENTRACIÓN: 20.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1913", "subtotal": "3826", "tax": "612.16", "other_taxes": null, "total": "4438.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471130 - KIT DE MUTAGÉNESIS DIRIGIDA AL SITIO Q5 ® (SIN CÉLULAS COMPETENTES)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4044", "subtotal": "4044", "tax": "647.04", "other_taxes": null, "total": "4691.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471503 - ENZIMA XBAI (20.000 UNIDADES/ML)", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "2104", "subtotal": "25248", "tax": "4039.68", "other_taxes": null, "total": "29287.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471519 - ANTICUERPO MTOR (7C10) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471520 - ANTICUERPO ATG7 (D12B11) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471521 - ANTICUERPO FOSFO-ULK1 (SER555) (D1H4) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9595", "subtotal": "9595", "tax": "1535.2", "other_taxes": null, "total": "11130.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471522 - ANTICUERPOS ATG14 (D1A1N) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471609 - CVIQI, ENZIMAS DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2104", "subtotal": "2104", "tax": "336.64", "other_taxes": null, "total": "2440.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471610 - ALUI (ALUMINIO), ENZIMA DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2050", "subtotal": "2050", "tax": "328", "other_taxes": null, "total": "2378" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471647 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7597", "subtotal": "7597", "tax": "1215.52", "other_taxes": null, "total": "8812.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471672 - ENZIMA SPEI, RECOMBINANTE (10,000 U/ML)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2050", "subtotal": "8200", "tax": "1312", "other_taxes": null, "total": "9512" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471708 - BECLIN-1 ANTIBODY", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7739", "subtotal": "7739", "tax": "1238.24", "other_taxes": null, "total": "8977.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471709 - ANTICUERPO FOSFO-ULK1 (SER757) (D7O6U) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9595", "subtotal": "9595", "tax": "1535.2", "other_taxes": null, "total": "11130.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471710 - ANTICUERPO ULK1 (D8H5) RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471711 - ANTICUERPO PROTEÍNA RIBOSOMAL FOSFO-S6 (SER240/244) (D68F8) XP ® RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10641", "subtotal": "10641", "tax": "1702.56", "other_taxes": null, "total": "12343.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471712 - ANTICUERPO PROTEÍNA RIBOSOMAL S6 (5G10) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471713 - ANTICUERPO FOSFO-4E-BP1 (THR37/46) (236B4) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9595", "subtotal": "9595", "tax": "1535.2", "other_taxes": null, "total": "11130.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471714 - ANTICUERPOS 4E-BP1 (53H11) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8184", "subtotal": "8184", "tax": "1309.44", "other_taxes": null, "total": "9493.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471715 - ANTICUERPO LC3B (E7X4S) XP® RABBIT MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9203", "subtotal": "9203", "tax": "1472.48", "other_taxes": null, "total": "10675.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471716 - ANTICUERPO MTOR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7739", "subtotal": "7739", "tax": "1238.24", "other_taxes": null, "total": "8977.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471717 - ANTICUERPO FOSFO-MTOR (SER2448)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9020", "subtotal": "9020", "tax": "1443.2", "other_taxes": null, "total": "10463.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471718 - ANTICUERPO PHOSPHO-ATG14 (SER29) (D4B8M) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10399", "subtotal": "10399", "tax": "1663.84", "other_taxes": null, "total": "12062.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471719 - ANTICUERPO FOSFO-BECLIN-1 (SER30) (E1C4X) CONEJO MAB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10399", "subtotal": "10399", "tax": "1663.84", "other_taxes": null, "total": "12062.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471720 - BAFILOMYCIN A1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2822", "subtotal": "2822", "tax": "451.52", "other_taxes": null, "total": "3273.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471721 - A-769662", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3520", "subtotal": "3520", "tax": "563.2", "other_taxes": null, "total": "4083.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471737 - ENDONUCLEASAS DE RESTRICCIÓN HAEIII (10.000 UNIDADES/ML)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7815", "subtotal": "7815", "tax": "1250.4", "other_taxes": null, "total": "9065.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471763 - ENZIMAS DE RESTRICCIÓN DE ALTA FIDELIDAD (SPEI-HF ®). (20.000 UNIDADES/ML)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "8416", "subtotal": "25248", "tax": "4039.68", "other_taxes": null, "total": "29287.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471781 - ENZIMAS DE RESTRICCIÓN HPY188I, CONCENTRACIÓN: 10.000 UNIDADES/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2050", "subtotal": "2050", "tax": "328", "other_taxes": null, "total": "2378" } ] }, { "id": "C-2024-00023089", "internal_reference": "AD-528/2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "PUBLICADO", "contractor": { "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "normalized_name": "APPLIED BIOSYSTEMS DE MEXICO", "rfc_type": null, "slug": "applied-biosystems-de-mexico" }, "contract_period": { "published_at": "2024-03-04T22:44:23.000Z", "starts_at": "2024-03-01T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "528171.07", "tax": "84507.36", "total": "612678.43", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "R1463628 - TAQMAN™ TAMRA PROBE", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8530.27", "subtotal": "17060.54", "tax": "2729.69", "other_taxes": null, "total": "19790.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464603 - TAQMAN™ CYP4A11. ENSAYOS DE EXPRESIÓN GÉNICA HS04194779_G1 FAM-MGB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1464604 - TAQMAN™ CYP4F2. ENSAYOS DE EXPRESIÓN GÉNICA HS00426608_M1 FAM-MGB", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1465346 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "52358.31", "subtotal": "52358.31", "tax": "8377.33", "other_taxes": null, "total": "60735.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468730 - TAQMAN™ CYP4F3 TAQMAN GENE EXPRESSION ASSAYS HS01587860_MH", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7856.47", "subtotal": "7856.47", "tax": "1257.04", "other_taxes": null, "total": "9113.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469225 - TAQMAN GENE EXPRESSION MASTER MIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10936.66", "subtotal": "10936.66", "tax": "1749.87", "other_taxes": null, "total": "12686.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469441 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "11383.05", "subtotal": "34149.15", "tax": "5463.86", "other_taxes": null, "total": "39613.01" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469673 - TAQMAN™ GENOTYPING MASTER MIX", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "2210.91", "subtotal": "26530.92", "tax": "4244.95", "other_taxes": null, "total": "30775.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470371 - TAQMAN™ MGB PROBE (LABEL 5\" ,FAM™, VIC™, TET™, Y NED™ , 6-FAM™)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21191.79", "subtotal": "21191.79", "tax": "3390.69", "other_taxes": null, "total": "24582.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1469676 - TAQMAN™ MGB PROBE (6-FAM™)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7306.19", "subtotal": "14612.38", "tax": "2337.98", "other_taxes": null, "total": "16950.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1468719 - TAQMAN™ MICRORNA REVERSE TRANSCRIPTION KIT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9083.17", "subtotal": "18166.34", "tax": "2906.61", "other_taxes": null, "total": "21072.95" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470887 - TAQMAN™ ARRAY, HUMAN CYP450 & OTHER OXYGENASES, FAST 96-WELL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5240.92", "subtotal": "15722.76", "tax": "2515.64", "other_taxes": null, "total": "18238.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470892 - TAQMAN™ FAST ADVANCED, MEZCLA MAESTRA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11235", "subtotal": "22470", "tax": "3595.2", "other_taxes": null, "total": "26065.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470894 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHR. ASSAY ID: HS00169233_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470895 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHRR. ASSAY ID: HS01005075_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470896 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: ARNT. ASSAY ID: HS01121918_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470897 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: CYP2J2. ASSAY ID: HS00356035_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470898 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: EPHX2. ASSAY ID: HS00932316_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2093.53", "subtotal": "2093.53", "tax": "334.96", "other_taxes": null, "total": "2428.49" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470899 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: KEAP1. ASSAY ID: HS00202227_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470901 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFE2L2. ASSAY ID: HS00975961_G1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470902 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARA. ASSAY ID: HS00947536_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470903 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARG. ASSAY ID: HS01115513_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470904 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1804538. GENE: TOP2A. ASSAY ID: C___7477997_20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470905 - TAQMAN™ GENOTYPING ASSAY SNP ID:RS2236168. GENE: XDH. ASSAY ID: C__26435993_20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470906 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS373455425. GENE: XDH. ASSAY ID: C_365253619_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470908 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS487121. GENE: MIR924HG. ASSAY ID: C___2313112_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470909 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS4987121. GENE: CBR3 ASSAY ID: C__43955396_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470910 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1800566. GENE: NQO1. ASSAY ID: C___2091255_30", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9407.44", "subtotal": "9407.44", "tax": "1505.19", "other_taxes": null, "total": "10912.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470911 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS2835286. GENE: CBR3-AS1. ASSAY ID: C__16075424_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470912 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS3014216. GENE: AKR1A1. ASSAY ID: C__11869471_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470913 - TAQMAN™ MATRIZ, NFKB HUMANA,", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5286.89", "subtotal": "21147.56", "tax": "3383.61", "other_taxes": null, "total": "24531.17" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1470914 - TAQMAN™ MATRIZ, TRANSPORTADORES HUMANOS DE FÁRMACOS, RÁPIDO DE 96 POCILLOS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5286.89", "subtotal": "10573.78", "tax": "1691.8", "other_taxes": null, "total": "12265.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471561 - TAQMAN™ GTXPRESS™ MASTER MIX", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19126.16", "subtotal": "19126.16", "tax": "3060.19", "other_taxes": null, "total": "22186.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471562 - TAQMAN™ GENOTYPING ASSAY SNP RS1065411, GENE: GSTM1  ASSAY ID: C__44202997_20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9407.44", "subtotal": "9407.44", "tax": "1505.19", "other_taxes": null, "total": "10912.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471563 - TAQMAN™ SNP GENOTYPING ASSAY, HUMAN. SNP ID:RS1056806. GENE GSTM1, ASSAY ID: C_175674977_10.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471565 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP: RS749174, GENE: GSTP1. ASSAY ID:C___3237199_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471566 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP:RS762803, GENE: GSTP1, ASSAY ID: C___3237197_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8203.19", "subtotal": "8203.19", "tax": "1312.51", "other_taxes": null, "total": "9515.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471613 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS4132601 GENE IKZF1. ASSAY ID: C__26019772_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15353.57", "subtotal": "15353.57", "tax": "2456.57", "other_taxes": null, "total": "17810.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471614 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP RS2836371 GENE ERG. ASSAY ID: C__2439755_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15353.57", "subtotal": "15353.57", "tax": "2456.57", "other_taxes": null, "total": "17810.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471615 - TAQMAN™PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS3731249. GENE CDKN2A . ASSAY ID: C__25611114_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15353.57", "subtotal": "15353.57", "tax": "2456.57", "other_taxes": null, "total": "17810.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471618 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS7090445 GENE ARID5B. ASSAY ID: C__30203240_10", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15353.57", "subtotal": "15353.57", "tax": "2456.57", "other_taxes": null, "total": "17810.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471750 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELA. ASSAY ID: HS01042014_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471751 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELB. ASSAY ID: HS00232399_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471752 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFKB1. ASSAY ID: HS00765730_M1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "R1471755 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: RAT. GENE: AIF1. ASSAY ID: RN03993468_G1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5136.69", "subtotal": "5136.69", "tax": "821.87", "other_taxes": null, "total": "5958.56" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "JUST_REACTIVOS.pdf", "availability": "available", "size_bytes": "580091", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:20.951Z", "updated_at": "2025-12-09T20:55:20.952Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "AT REACTIVOS.pdf", "availability": "available", "size_bytes": "445703", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:22.691Z", "updated_at": "2025-12-09T20:55:22.693Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "APPLIED.pdf", "availability": "available", "size_bytes": "742815", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:24.938Z", "updated_at": "2025-12-09T20:55:24.939Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT508.pdf", "availability": "available", "size_bytes": "1098193", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:26.937Z", "updated_at": "2025-12-09T20:55:26.938Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT511.pdf", "availability": "available", "size_bytes": "195246", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:28.413Z", "updated_at": "2025-12-09T20:55:28.414Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT513.pdf", "availability": "available", "size_bytes": "325028", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:31.456Z", "updated_at": "2025-12-09T20:55:31.458Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "EQUIVER.pdf", "availability": "available", "size_bytes": "334328", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:32.937Z", "updated_at": "2025-12-09T20:55:32.938Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_MARIA_SOCORRO.pdf", "availability": "available", "size_bytes": "411023", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:34.704Z", "updated_at": "2025-12-09T20:55:34.705Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "MAYIMEX.pdf", "availability": "available", "size_bytes": "223562", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:36.356Z", "updated_at": "2025-12-09T20:55:36.357Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "QUIMILAB.pdf", "availability": "available", "size_bytes": "322976", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:38.008Z", "updated_at": "2025-12-09T20:55:38.009Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "SILVERA.pdf", "availability": "available", "size_bytes": "437605", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:41.806Z", "updated_at": "2025-12-09T20:55:41.807Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOROESTE.pdf", "availability": "available", "size_bytes": "1409047", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:45.103Z", "updated_at": "2025-12-09T20:55:45.105Z" }, { "id": null, "annex_number": 14, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "ACCESORIOS .pdf", "availability": "available", "size_bytes": "355296", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:46.808Z", "updated_at": "2025-12-09T20:55:46.809Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "COMERCIALIZADORA.pdf", "availability": "available", "size_bytes": "579411", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:48.754Z", "updated_at": "2025-12-09T20:55:48.755Z" }, { "id": null, "annex_number": 16, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "VIRMEL.pdf", "availability": "available", "size_bytes": "214147", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:50.423Z", "updated_at": "2025-12-09T20:55:50.425Z" }, { "id": null, "annex_number": 17, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "UNIPARTS.pdf", "availability": "available", "size_bytes": "149911", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:52.014Z", "updated_at": "2025-12-09T20:55:52.015Z" }, { "id": null, "annex_number": 18, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "BIOADVANCED.pdf", "availability": "available", "size_bytes": "304396", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:54.286Z", "updated_at": "2025-12-09T20:55:54.287Z" }, { "id": null, "annex_number": 19, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "ARAVEL.pdf", "availability": "available", "size_bytes": "325237", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:55.950Z", "updated_at": "2025-12-09T20:55:55.951Z" }, { "id": null, "annex_number": 20, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "INSUMOS Y ACCESORIOS.pdf", "availability": "available", "size_bytes": "216088", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:57.575Z", "updated_at": "2025-12-09T20:55:57.576Z" }, { "id": null, "annex_number": 21, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "LAB-TECH.pdf", "availability": "available", "size_bytes": "205896", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:55:59.825Z", "updated_at": "2025-12-09T20:55:59.826Z" }, { "id": null, "annex_number": 22, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "VALANER.pdf", "availability": "available", "size_bytes": "476855", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:56:04.478Z", "updated_at": "2025-12-09T20:56:04.480Z" }, { "id": null, "annex_number": 23, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_PERKIN.pdf", "availability": "available", "size_bytes": "202395", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-09T20:56:06.980Z", "updated_at": "2025-12-09T20:56:06.982Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "aa-12-ncz-012ncz001-n-104-2023", "nombre_procedimiento": "PRODUCTOS QUIMICOS BASICOS", "dependencia": "INSTITUTO NACIONAL DE PEDIATRÍA", "siglas": "INP", "score": 0.035133333061138305 }, { "numero_procedimiento": "aa-12-ncz-012ncz001-n-37-2025", "nombre_procedimiento": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACIÓN", "dependencia": "INP", "siglas": "INP", "score": 0.04548868672515971 }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-46-2024", "nombre_procedimiento": "MATERIALES Y REACTIVOS PARA SER UTILIZADOS EN LOS PROTOCOLOS DE INVESTIGACION", "dependencia": "INER", "siglas": "INER", "score": 0.12356154235257544 }, { "numero_procedimiento": "aa-12-ncd-012ncd001-n-294-2025", "nombre_procedimiento": "ATTUNE WASH SOLUTION 250 ML", "dependencia": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "siglas": "INER", "score": 0.14424619508523295 }, { "numero_procedimiento": "aa-12-ndf-012ndf999-n-360-2024", "nombre_procedimiento": "PEDIDO MAYOR 520", "dependencia": "INR", "siglas": "INR", "score": 0.15353700976184004 }, { "numero_procedimiento": "aa-12-ndf-012ndf999-n-562-2023", "nombre_procedimiento": "INR/2023/607 ACCESOLAB", "dependencia": "INR", "siglas": "INR", "score": 0.16017851710851505 } ] }