{ "ocid": "ocds-x-licitia-aa-12-ncz-012ncz001-n-97-2024", "id": "AA-12-NCZ-012NCZ001-N-97-2024", "date": "2024-03-02T00:15:14.000Z", "language": "es", "initiationType": "tender", "tag": [ "tender", "award", "contract" ], "parties": [ { "id": "INP", "name": "INP", "roles": [ "buyer" ] }, { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV", "roles": [ "supplier" ] }, { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV", "roles": [ "supplier" ] }, { "id": "EQUIVER SA DE CV", "name": "EQUIVER SA DE CV", "roles": [ "supplier" ] }, { "id": "BIOSYSTEMS LIFESCIENCE SA DE CV", "name": "BIOSYSTEMS LIFESCIENCE SA DE CV", "roles": [ "supplier" ] }, { "id": "ACCESORIOS PARA LABORATORIOS SA DE CV", "name": "ACCESORIOS PARA LABORATORIOS SA DE CV", "roles": [ "supplier" ] }, { "id": "HIROSTECNOLOGIAS SA DE CV", "name": "HIROSTECNOLOGIAS SA DE CV", "roles": [ "supplier" ] }, { "id": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "roles": [ "supplier" ] }, { "id": "MAYIMEX SA DE CV", "name": "MAYIMEX SA DE CV", "roles": [ "supplier" ] }, { "id": "QUIMILAB SA DE CV", "name": "QUIMILAB SA DE CV", "roles": [ "supplier" ] }, { "id": "PERKIN-ELMER DE MEXICO SA", "name": "PERKIN-ELMER DE MEXICO SA", "roles": [ "supplier" ] }, { "id": "BIOADVANCED SYSTEMS SA DE CV", "name": "BIOADVANCED SYSTEMS SA DE CV", "roles": [ "supplier" ] }, { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "roles": [ "supplier" ] }, { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "roles": [ "supplier" ] }, { "id": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "roles": [ "supplier" ] }, { "id": "LAB TECH INSTRUMENTACION SA DE CV", "name": "LAB TECH INSTRUMENTACION SA DE CV", "roles": [ "supplier" ] }, { "id": "QUIMICA VIRMEL SA DE CV", "name": "QUIMICA VIRMEL SA DE CV", "roles": [ "supplier" ] }, { "id": "INSUMOS Y ACCESORIOS CIENTIFICOS SA DE CV", "name": "INSUMOS Y ACCESORIOS CIENTIFICOS SA DE CV", "roles": [ "supplier" ] }, { "id": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV", "name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV", "roles": [ "supplier" ] }, { "id": "QUIMICA VALANER SA DE CV", "name": "QUIMICA VALANER SA DE CV", "roles": [ "supplier" ] }, { "id": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "roles": [ "supplier" ] } ], "buyer": { "id": "INP", "name": "INP" }, "tender": { "id": "AA-12-NCZ-012NCZ001-N-97-2024", "title": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "description": "ADQUISICION DE DIVERSOS REACTIVOS PARA PROYECTOS DE INVESTIGACION", "status": "complete", "procurementMethod": "direct", "procurementMethodDetails": "ADJUDICACIÓN DIRECTA", "mainProcurementCategory": "goods", "tenderPeriod": { "startDate": "2024-03-02T00:15:14.000Z" }, "awardPeriod": {}, "items": [ { "id": "0", "description": "R1451276 - ANTIBIÓTICO-ANTIMICÓTICO (100X)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 853, "currency": "MXN" } } }, { "id": "0", "description": "R1461389 - KIT PARA RT-PCR (TAQMAN REVERSE TRANSCRIPTION), MULTISCRIBE REVERSE TRANSCRIPTASE, RNASE INHIBITOR, DNTP MIXTURE, OLIGO D(T)16, RANDOM HEXAMERS, 10X RT BUFFER, MGCL2 SOLUTION.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 12885, "currency": "MXN" } } }, { "id": "0", "description": "R1461453 - KIT DE PURIFICACIÓN QIAQUICK PCR, PARA LA PURIFICACIÓN DE 250 REACCIONES PCR: 250 QIAQUICK SPIN COLUMNS, BUFFERS, COLLECTION TUBES (2 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 14146, "currency": "MXN" } } }, { "id": "0", "description": "R1461455 - MINI KIT DE ADN QIAAMP®. PARA EL AISLAMIENTO DE ADN GENÓMICO, MITOCONDRIAL, BACTERIANO, PARASITARIO O VIRAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13547, "currency": "MXN" } } }, { "id": "0", "description": "R1462525 - RNASE A (17,500 U). VIAL CON 2.5 ML (100 MG/ML; 7000 UNIDADES/ML, SOLUCIÓN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7210, "currency": "MXN" } } }, { "id": "0", "description": "R1462927 - KIT 1 KB PLUS DNA LADDER (1 KB PLUS DNA LADDERT (1 µG/µL) IN 10 MM TRIS-HCL (PH 7.5), 50 MM NACL, AND 1 MM EDTA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3224, "currency": "MXN" } } }, { "id": "0", "description": "R1463636 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12, POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1444, "currency": "MXN" } } }, { "id": "0", "description": "R1463802 - HIBRIDOMA-SFM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1965, "currency": "MXN" } } }, { "id": "0", "description": "R1463854 - CLONEJET PCR CLONING KIT 20 REACT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3039, "currency": "MXN" } } }, { "id": "0", "description": "R1463856 - GENERULER 100 BP DNA LADDER (MARCADOR DE PESO MOLECULAR, ESCALERA DE 100 BP TO 1000 BP )", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4517, "currency": "MXN" } } }, { "id": "0", "description": "R1463857 - MARCADOR DE PESO MOLECULAR PARA DNA 50 BP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2082, "currency": "MXN" } } }, { "id": "0", "description": "R1464642 - PBS (SOLUCIÓN SALINA TAMPONADA CON FOSFATO), PH 7.4", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4198, "currency": "MXN" } } }, { "id": "0", "description": "R1464665 - PIRUVATO DE SODIO (100 MM)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 244, "currency": "MXN" } } }, { "id": "0", "description": "R1464730 - DNTP MIX CONTIENE: 10 MM DE CADA UNO DE DATP, DTTP, DCTP Y DGTP.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2401, "currency": "MXN" } } }, { "id": "0", "description": "R1464733 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER, DE 10 A 180 KDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2603, "currency": "MXN" } } }, { "id": "0", "description": "R1464737 - SPECTRA MULTICOLOR HIGH RANGE PROTEIN LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3560, "currency": "MXN" } } }, { "id": "0", "description": "R1465465 - SOLUCIÓN DE AMINOÁCIDOS NO ESENCIALES MEM (100X)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 429, "currency": "MXN" } } }, { "id": "0", "description": "R1466179 - AMNIOMAX- II COMPLETE MEDIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2082, "currency": "MXN" } } }, { "id": "0", "description": "R1466245 - BD PHARMINGEN FITC ANNEXIN V APOPTOSIS DETECTION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6163, "currency": "MXN" } } }, { "id": "0", "description": "R1466855 - MAXIMA PROBE/ROX QPCR MASTER MIX (200 X 25 µL RXNS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4466, "currency": "MXN" } } }, { "id": "0", "description": "R1466871 - MEDIO RPMI (L-GLUTAMINA Y ROJO FENOL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4718, "currency": "MXN" } } }, { "id": "0", "description": "R1466873 - PLATINUM TAQ DNA POLIMERASE HIGH FIDELITY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20584, "currency": "MXN" } } }, { "id": "0", "description": "R1466875 - SUPLEMENTO B-27 (50X), SIN SUERO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 21356, "currency": "MXN" } } }, { "id": "0", "description": "R1467860 - CTS GLUTAMAX-I SUPPLEMENT (100X)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1134, "currency": "MXN" } } }, { "id": "0", "description": "R1467877 - TAQ DNA POLYMERASE, RECOMBINANT 100RX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1109, "currency": "MXN" } } }, { "id": "0", "description": "R1467929 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE 3000", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1415, "currency": "MXN" } } }, { "id": "0", "description": "R1468160 - FASTDIGEST BAMHI", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1100, "currency": "MXN" } } }, { "id": "0", "description": "R1468757 - BD PERCP MOUSE ANTI-HUMAN CD3 (20 µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14387, "currency": "MXN" } } }, { "id": "0", "description": "R1468812 - AGUA LIBRE DE NUCLEASAS (NO TRATADA CON DEPC)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2552, "currency": "MXN" } } }, { "id": "0", "description": "R1468820 - MEDIO DMEM/F-12, GLUTAMAX SUPPLEMENT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 18, "unit": { "name": "PIEZA", "value": { "amount": 1037, "currency": "MXN" } } }, { "id": "0", "description": "R1468826 - ULTRAPURE DITHIOTHREITOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3006, "currency": "MXN" } } }, { "id": "0", "description": "R1468894 - BUFFER ATL (4X50ML) GPR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3224, "currency": "MXN" } } }, { "id": "0", "description": "R1469020 - MAXIMA SYBR GREEN/ROX QPCR MASTER MIX (2X)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 17864, "currency": "MXN" } } }, { "id": "0", "description": "R1469022 - PHUSION HIGH-FIDELITY DNA POLYMERASE (2 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2217, "currency": "MXN" } } }, { "id": "0", "description": "R1469023 - 2-NBDG (2-(N-(7-NITROBENZ-2-OXA-1,3-DIAZOL-4-YL)AMINO)-2-DEOXYGLUCOSE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4970, "currency": "MXN" } } }, { "id": "0", "description": "R1469025 - DMEM, ALTO CONTENIDO EN GLUCOSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 19, "unit": { "name": "PIEZA", "value": { "amount": 545, "currency": "MXN" } } }, { "id": "0", "description": "R1469026 - ENZIMA DE RESTRICCIÓN DPNI (10 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 839, "currency": "MXN" } } }, { "id": "0", "description": "R1469029 - ULTRAPURE AGAROSE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3711, "currency": "MXN" } } }, { "id": "0", "description": "R1469033 - DEPC-TREATED WATER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2468, "currency": "MXN" } } }, { "id": "0", "description": "R1469301 - PET151 DIRECTIONAL TOPO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26023, "currency": "MXN" } } }, { "id": "0", "description": "R1469431 - TRIPSINA-EDTA (0.05 %), ROJO FENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 932, "currency": "MXN" } } }, { "id": "0", "description": "R1469432 - XTT (2,3-BIS-(2-METOXI-4-NITRO-5-SULFOFENIL)-2H-TETRAZOLIO-5-CARBOXANILIDA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3963, "currency": "MXN" } } }, { "id": "0", "description": "R1469433 - AMPLITAQ GOLD DNA POLYMERASE, WITH BUFFER II AND MGCL2, 3000 UNITS (12 TUBES X 50 UL, 250 UNITS PER TUBE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 49359, "currency": "MXN" } } }, { "id": "0", "description": "R1469509 - PROTEASA ACTEV", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6498, "currency": "MXN" } } }, { "id": "0", "description": "R1469517 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7085, "currency": "MXN" } } }, { "id": "0", "description": "R1469529 - HUMAN EGF (EPIDERMAL GROWTH FACTOR) RECOMBINANT PROTEIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2334, "currency": "MXN" } } }, { "id": "0", "description": "R1469643 - AMPLITAQ GOLD 360 MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 44743, "currency": "MXN" } } }, { "id": "0", "description": "R1470345 - GENECHIP® HYBRIDIZATION WASH AND STAIN KIT FOR 30 RXNS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12189, "currency": "MXN" } } }, { "id": "0", "description": "R1469651 - SEQUENCE DETECTION PRIMER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2401, "currency": "MXN" } } }, { "id": "0", "description": "R1470483 - BD CYTOFIX/CYTOPERM. FIXATION/PERMEABLIZATION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6892, "currency": "MXN" } } }, { "id": "0", "description": "R1469697 - BD PHARMINGEN FITC MOUSE ANTI-HUMAN CD69 (20 µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4938, "currency": "MXN" } } }, { "id": "0", "description": "R1469759 - GIBCO 2-MERCAPTOETHANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 903, "currency": "MXN" } } }, { "id": "0", "description": "R1469045 - OPTI-MEM I REDUCED SERUM MEDIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1138, "currency": "MXN" } } }, { "id": "0", "description": "R1469763 - SOLUCIÓN SALINA EQUILIBRADA DE HANK´S (HBSS, SIN CALCIO, SIN MAGNESIO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 247, "currency": "MXN" } } }, { "id": "0", "description": "R1469768 - 100 BP DNA LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5893, "currency": "MXN" } } }, { "id": "0", "description": "R1469781 - INDICADOR ROJO DE SUPERÓXIDO MITOCONDRIAL MITOSOX, PARA IMÁGENES DE CÉLULAS VIVAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6934, "currency": "MXN" } } }, { "id": "0", "description": "R1470396 - SUPERMIX DE SÍNTESIS DE PRIMERA CADENA SUPERSCRIPT III", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10712, "currency": "MXN" } } }, { "id": "0", "description": "R1469793 - ANTICUERPO RECEPTOR A ANDROGENOS POLICLONAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8059, "currency": "MXN" } } }, { "id": "0", "description": "R1469869 - MINI KIT DE SANGRE DE ADN QIAAMP (250)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 12419, "currency": "MXN" } } }, { "id": "0", "description": "R1470762 - CYP1A2 BACULOSOMES PLUS REAGENT, RHUMAN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4785, "currency": "MXN" } } }, { "id": "0", "description": "R1470404 - ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS PAGERULER PLUS, DE 10 A 250 KDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3106, "currency": "MXN" } } }, { "id": "0", "description": "R1470762 - LIGADURA RÁPIDA DE ADN KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3090, "currency": "MXN" } } }, { "id": "0", "description": "R1470954 - CD4 FITC/CD8 PE/CD3 PERCP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10691, "currency": "MXN" } } }, { "id": "0", "description": "R1471010 - MEDIO RPMI 1640 (MEDIO ROSWELL PARK MEMORIAL INSTITUTE 1640), SIN GLUCOSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 790, "currency": "MXN" } } }, { "id": "0", "description": "R1471014 - TRIPSINA-EDTA (0,25%), ROJO DE FENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 936, "currency": "MXN" } } }, { "id": "0", "description": "R1471025 - ANTICUERPO POLICLONAL CYP2C11 CONEJO ANTI-FELINO, HUMANO, RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7555, "currency": "MXN" } } }, { "id": "0", "description": "R1471027 - ANTICUERPO POLICLONAL FCGRT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7320, "currency": "MXN" } } }, { "id": "0", "description": "R1471032 - CYP2J2 CONEJO ANTIHUMANO, RATÓN, RATA, POLICLONAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7320, "currency": "MXN" } } }, { "id": "0", "description": "R1471040 - KIT DE ELISA PARA INSULINA HUMANA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9671, "currency": "MXN" } } }, { "id": "0", "description": "R1471044 - KIT ELISA HUMANO PARA ADIPONECTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9537, "currency": "MXN" } } }, { "id": "0", "description": "R1471057 - KIT DE ELISA PARA LEPTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9772, "currency": "MXN" } } }, { "id": "0", "description": "R1471142 - KIT DE ADN QIAAMP POWERFECAL PRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 8942, "currency": "MXN" } } }, { "id": "0", "description": "R1471146 - KIT DE SANGRE Y TEJIDO DNEASY (50). MINICOLUMNAS, PROTEINASA K, TAMPONES, TUBOS DE RECOGIDA (2 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3201, "currency": "MXN" } } }, { "id": "0", "description": "R1471152 - PUREGENE® SOLUCIÓN DE PRECIPITACIÓN DE PROTEÍNAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 11382, "currency": "MXN" } } }, { "id": "0", "description": "R1471316 - GLUCÓGENO, GRADO DE BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1444, "currency": "MXN" } } }, { "id": "0", "description": "R1471324 - SUSTRATO DE MÁXIMA SENSIBILIDAD SUPERSIGNAL WEST FEMTO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11585, "currency": "MXN" } } }, { "id": "0", "description": "R1471455 - ENZIMAS DE RESTRICCIÓN NDEI (10 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2821, "currency": "MXN" } } }, { "id": "0", "description": "R1471456 - MEDIO DE CARIOTIPADO PB-MAX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4852, "currency": "MXN" } } }, { "id": "0", "description": "R1471457 - BUFFER TE LOW", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1763, "currency": "MXN" } } }, { "id": "0", "description": "R1471458 - ENZIMA DE RESTRICCIÓN BAMHI (10 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 636, "currency": "MXN" } } }, { "id": "0", "description": "R1471459 - ENZIMA DE RESTRICCIÓN FASTDIGEST XHOI", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1041, "currency": "MXN" } } }, { "id": "0", "description": "R1471460 - LIGASA DE ADN T4 (5 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4416, "currency": "MXN" } } }, { "id": "0", "description": "R1471461 - TRANSCRIPCIÓN INVERSA SUPERSCRIPT III (200 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2082, "currency": "MXN" } } }, { "id": "0", "description": "R1471462 - MINIPASTILLAS INHIBIDORAS DE FOSFATASAS PIERCE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3795, "currency": "MXN" } } }, { "id": "0", "description": "R1471463 - TRUEGUIDE MODIFIED SGRNA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1763, "currency": "MXN" } } }, { "id": "0", "description": "R1471464 - PROTEÍNA CAS9 V2 TRUECUT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3711, "currency": "MXN" } } }, { "id": "0", "description": "R1471465 - REACTIVO DE TRANSFECCIÓN LIPOFECTAMINE CRISPRMAX CAS9", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1780, "currency": "MXN" } } }, { "id": "0", "description": "R1471466 - KIT DE DETECCIÓN DE DISOCIACIÓN GENÓMICA GENEART", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4181, "currency": "MXN" } } }, { "id": "0", "description": "R1471467 - TRUEGUIDE SGRNA CONTROL NEGATIVO, NO DIRIGIDO 1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3627, "currency": "MXN" } } }, { "id": "0", "description": "R1471468 - TRUEGUIDE SGRNA POSITIVE CONTROL, AAVS1 (HUMANO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3627, "currency": "MXN" } } }, { "id": "0", "description": "R1471469 - MINI KIT DE PLÁSMIDOS (25)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5627, "currency": "MXN" } } }, { "id": "0", "description": "R1471470 - GLUCÓGENO (5 MG/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3946, "currency": "MXN" } } }, { "id": "0", "description": "R1471471 - SOLUCIÓN DE LISIS CELULAR PUREGENE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 14142, "currency": "MXN" } } }, { "id": "0", "description": "R1471472 - DMEM (MEDIO EAGLE MODIFICADO DE DULBECCO), POLVO, ALTO CONTENIDO EN GLUCOSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1041, "currency": "MXN" } } }, { "id": "0", "description": "R1471473 - SOLUCIÓN DE HIDRATACIÓN DE ADN PUREGENE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8819, "currency": "MXN" } } }, { "id": "0", "description": "R1471474 - ANTICUERPO POLICLONAL CD42B", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7488, "currency": "MXN" } } }, { "id": "0", "description": "R1471475 - ANTICUERPO POLICLONAL DE FIBRINÓGENO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7388, "currency": "MXN" } } }, { "id": "0", "description": "R1471476 - ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA IGG (H+L) ANTI-RATÓN DE CABRA, BIOTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3291, "currency": "MXN" } } }, { "id": "0", "description": "R1471477 - SULFO-NHS-LC-BIOTINA EZ-LINK", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6011, "currency": "MXN" } } }, { "id": "0", "description": "R1471478 - ESTREPTAVIDINA, CONJUGADO ALEXA FLUOR 488", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6061, "currency": "MXN" } } }, { "id": "0", "description": "R1471479 - ESCALERA DE ADN DE 1 KB GENERULER PLUS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2888, "currency": "MXN" } } }, { "id": "0", "description": "R1471480 - IONOMICINA, SAL DE CALCIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3660, "currency": "MXN" } } }, { "id": "0", "description": "R1471481 - ANTIHUMANO CD154 DE RATÓN PE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6913, "currency": "MXN" } } }, { "id": "0", "description": "R1471482 - ANTI-PERFORINA HUMANA, PE MOUSE IGG2B, KIT CON CONTROL DE ISOTIPO ¿ (ANTI-DANSYL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9044, "currency": "MXN" } } }, { "id": "0", "description": "R1471483 - ESTREPTAVIDINA PE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3558, "currency": "MXN" } } }, { "id": "0", "description": "R1471484 - ANTICUERPO POLICLONAL ANTI-CONEJO DE CABRA CONJUGADO CON FITC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5223, "currency": "MXN" } } }, { "id": "0", "description": "R1471485 - RATÓN ALEXA FLUOR 647 ANTI-FOXP3 HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8263, "currency": "MXN" } } }, { "id": "0", "description": "R1471486 - BD BBL SENSI-DISC AMPICILINA CON SULBACTAM SAM-20 (10 µG)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2285, "currency": "MXN" } } }, { "id": "0", "description": "R1471487 - BD BBL SENSI-DISC AMOXICILINA CON ÁCIDO CLAVULÁNICO AMC-30 (20/10 MICROGRAMOS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2335, "currency": "MXN" } } }, { "id": "0", "description": "R1471488 - MEDIO NEUROBASAL SIN ROJO FENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 1713, "currency": "MXN" } } }, { "id": "0", "description": "R1471489 - SOLUCIÓN DE DETERGENTE NP-40 SURFACT-AMPS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3039, "currency": "MXN" } } }, { "id": "0", "description": "R1471490 - SUSTRATO DE SENSIBILIDAD QUIMIOLUMINISCENTE PARA IDENTIFICAR DE PROTEÍNAS DE ALTO ATTOGRAMO SUPERSIGNAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11921, "currency": "MXN" } } }, { "id": "0", "description": "R1471491 - ANTICUERPO POLICLONAL ANTI-EPXH2", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7320, "currency": "MXN" } } }, { "id": "0", "description": "R1471492 - ANTICUERPO NFKB P50 MONOCLONAL (2J10D7)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9335, "currency": "MXN" } } }, { "id": "0", "description": "R1471493 - ANTICUERPO POLICLONAL C-REL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6632, "currency": "MXN" } } }, { "id": "0", "description": "R1471494 - ANTICUERPO POLICLONAL RELB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7488, "currency": "MXN" } } }, { "id": "0", "description": "R1471495 - ANTICUERPO MONOCLONAL IBA1 (GT10312)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8328, "currency": "MXN" } } }, { "id": "0", "description": "R1471496 - KIT DE ENSAYO DE PROTEÍNAS PIERCE COOMASSIE (BRADFORD)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2485, "currency": "MXN" } } }, { "id": "0", "description": "R1471497 - ANTICUERPO MONOCLONAL DE CONEJO RECOMBINANTE GLUT2 (JJ20-21)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9167, "currency": "MXN" } } }, { "id": "0", "description": "R1471498 - RNEASY MINI KIT (50)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7206, "currency": "MXN" } } }, { "id": "0", "description": "R1471499 - QIAAMP DNA FFPE TISSUE KIT (50)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5314, "currency": "MXN" } } }, { "id": "0", "description": "R1471500 - KIT RNEASY DSP FFPE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12522, "currency": "MXN" } } }, { "id": "0", "description": "R1471501 - MINIGELES DE PROTEÍNAS NUPAGE, BIS-TRIS DEL 4 AL 12 %, 1,0–1,5 MM. X 10 POCILLOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2720, "currency": "MXN" } } }, { "id": "0", "description": "R1464191 - KIT DE PURIFICACIÓN DE ADN GENÓMICO WIZARD®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4189.12, "currency": "MXN" } } }, { "id": "0", "description": "R1466364 - GOTAQ® GREEN MASTER MIX. MEZCLA MASTERMIX PARA LA ACTIVIDAD DE DNA POLIMERASA GO TAQ ( DNA POLIMERASA, DNTPS, MGCL2 Y BUFFERS DE REACCIÓN ÓPTIMOS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1247.54, "currency": "MXN" } } }, { "id": "0", "description": "R1468857 - MS COLUMNS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4383, "currency": "MXN" } } }, { "id": "0", "description": "R1468892 - PROMEGA ROS-GLO™ H2O2 ASSAY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11287.9, "currency": "MXN" } } }, { "id": "0", "description": "R1471581 - CD3 MICROBEADS, HUMANO - LIOFILIZADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11904.75, "currency": "MXN" } } }, { "id": "0", "description": "R1456677 - PROFINITY™ IMAC RESIN, NI-CHARGED 25 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5855.25, "currency": "MXN" } } }, { "id": "0", "description": "R1461235 - 30% ACRYLAMIDE/BIS SOLUTION", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1190.7, "currency": "MXN" } } }, { "id": "0", "description": "R1467793 - SOLUCIÓN BLOQUEADORA (BLOTTING-GRADE BLOCKER)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1013.42, "currency": "MXN" } } }, { "id": "0", "description": "R1469262 - DITHIOTHREITOL (DTT)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1631.88, "currency": "MXN" } } }, { "id": "0", "description": "R1469498 - PRECISION PLUS PROTEIN™ KALEIDOSCOPE™ PRESTAINED PROTEIN STANDARDS (500 µL, MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES (10–250 KD))", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 2786.24, "currency": "MXN" } } }, { "id": "0", "description": "R1469499 - PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS (MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES TEÑIDAS DE AZUL (10–250 KD), INCLUIDAS TRES BANDAS DE REFERENCIA (25, 50, 75 KD), 50 APLICACIONES)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2001.96, "currency": "MXN" } } }, { "id": "0", "description": "R1469726 - MINI-PROTEAN® TGX™ 4–15% PRECAST PROTEIN GELS, 10-WELL, 30 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2193.71, "currency": "MXN" } } }, { "id": "0", "description": "R1469730 - TEMED (TETRAMETHYLETHYLENEDIAMINE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 362.15, "currency": "MXN" } } }, { "id": "0", "description": "R1469731 - 30% ACRYLAMIDE/BIS SOLUTION, 29:1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1190.7, "currency": "MXN" } } }, { "id": "0", "description": "R1470973 - IMMUNO-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M (1 ROLL, 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7779.24, "currency": "MXN" } } }, { "id": "0", "description": "R1471607 - COLUMNAS DE GEL MICRO BIO-SPIN™ P-30, TAMPÓN TRIS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3748.5, "currency": "MXN" } } }, { "id": "0", "description": "R1471722 - ESTÁNDARES DE TRANSFERENCIA PRECISION PLUS PROTEIN™ WESTERNC™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3199.01, "currency": "MXN" } } }, { "id": "0", "description": "R1471776 - KIT DE CODIFICACIÓN DE BARRAS PCR-CDNA 24", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19348.98, "currency": "MXN" } } }, { "id": "0", "description": "R1471777 - KIT DE LAVADO DE CELDA DE FLUJO (MINION™ Y PROMETHION™)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2543.1, "currency": "MXN" } } }, { "id": "0", "description": "R1471779 - VIALES AUXILIARES DE SECUENCIACIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2543.1, "currency": "MXN" } } }, { "id": "0", "description": "R1461624 - SUERO FETAL BOVINO, CERTIFICADO DE EE.UU", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 13080.95, "currency": "MXN" } } }, { "id": "0", "description": "R1464112 - AMPICILINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 6172.41, "currency": "MXN" } } }, { "id": "0", "description": "R1464809 - ETHANOL FOR MOLECULAR BIOLOGY FCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 13, "unit": { "name": "PIEZA", "value": { "amount": 775.62, "currency": "MXN" } } }, { "id": "0", "description": "R1467876 - DNTP MIX (10 MM EA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2141.3, "currency": "MXN" } } }, { "id": "0", "description": "R1467893 - ETANOL ABSOLUTO PARA ANÁLISIS EMPARTA® ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 4434.24, "currency": "MXN" } } }, { "id": "0", "description": "R1468827 - MARROWMAX™ MEDIO PARA MÉDULA ÓSEA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3776.79, "currency": "MXN" } } }, { "id": "0", "description": "R1468888 - THERMO SCIENTIFIC™ PIERCE™ SUPERSIGNAL™ SUPERSIGNAL MOLECULAR WEIGHT PROTEIN LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6575.54, "currency": "MXN" } } }, { "id": "0", "description": "R1468926 - HIDROQUINONA (HYDROQUINONE REAGENTPLUS®, >=99%)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 663.09, "currency": "MXN" } } }, { "id": "0", "description": "R1469309 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, POD (IN SITU CELL DEATH DETECTION)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 13690.53, "currency": "MXN" } } }, { "id": "0", "description": "R1469511 - AGAROSA ULTRAPURE™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 11565.96, "currency": "MXN" } } }, { "id": "0", "description": "R1470589 - ACETONITRILO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2345.46, "currency": "MXN" } } }, { "id": "0", "description": "R1470591 - KAPA SYBR® FAST ONE-STEP. QRT-PCR KITS - 100 X 20 µL REACTIONS (UNIVERSAL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 3331.26, "currency": "MXN" } } }, { "id": "0", "description": "R1469932 - ANTI-MOUSE IGG (FC SPECIFIC)–PEROXIDASE ANTIBODY PRODUCED IN GOAT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6356.55, "currency": "MXN" } } }, { "id": "0", "description": "R1470711 - FISETIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8759.67, "currency": "MXN" } } }, { "id": "0", "description": "R1471157 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, FLUORESCEÍNA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 12760.53, "currency": "MXN" } } }, { "id": "0", "description": "R1471238 - FLUORURO DE SODIO (NAF)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 983.01, "currency": "MXN" } } }, { "id": "0", "description": "R1471536 - TIZOXANIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8308.62, "currency": "MXN" } } }, { "id": "0", "description": "R1471540 - NADPH", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3414.03, "currency": "MXN" } } }, { "id": "0", "description": "R1471554 - KAPA HIFI HOTSTART+DNTPS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2628.18, "currency": "MXN" } } }, { "id": "0", "description": "R1471559 - 3- O -METILQUERCETINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16679.55, "currency": "MXN" } } }, { "id": "0", "description": "R1471616 - KIT CYTOSCAN™ 750K PLUS 24", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 178088.08, "currency": "MXN" } } }, { "id": "0", "description": "R1471617 - KIT CYTOSCAN™ 750K SUITE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 145842.46, "currency": "MXN" } } }, { "id": "0", "description": "R1471632 - KIT DE EXTRACCIÓN DE GEL EZNA® (V-SPIN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 5075.95, "currency": "MXN" } } }, { "id": "0", "description": "R1471666 - KIT PARA DETERMINACIÓN IL-6 HUMANA DUOSET® ELISA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1745.61, "currency": "MXN" } } }, { "id": "0", "description": "R1471701 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, RÁPIDO), MONOCLONAL DE RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15742.11, "currency": "MXN" } } }, { "id": "0", "description": "R1471702 - ANTICUERPO MONOCLONAL ANTI-DNA/RNA DAÑO PRODUCIDO EN RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12365.28, "currency": "MXN" } } }, { "id": "0", "description": "R1471704 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, LENTO) PRODUCIDO EN RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15671.43, "currency": "MXN" } } }, { "id": "0", "description": "R1471705 - ANTICUERPO MONOCLONAL ANTI-MIOSINA (ESQUELÉTICO, RÁPIDO)-FOSFATASA ALCALINA PRODUCIDO EN RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12271.35, "currency": "MXN" } } }, { "id": "0", "description": "R1471729 - 2-METILBUTANO, PARA ESPECTROSCOPIA UVASOL®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4619.31, "currency": "MXN" } } }, { "id": "0", "description": "R1471735 - DAPI, DICLORHIDRATO (TINTE DE UNIÓN AL ADN PERMEABLE A LAS CÉLULAS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3807.42, "currency": "MXN" } } }, { "id": "0", "description": "R1471772 - ANTICUERPO ANTI-BRAF (V600E), MONOCLONAL DE CONEJO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10691.28, "currency": "MXN" } } }, { "id": "0", "description": "R1468791 - DNA LADDER 100 BP, 100-3000BP (54µG/500µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 799.2, "currency": "MXN" } } }, { "id": "0", "description": "R1469276 - DNA LADDER  50BP , 50-1500BP, 1X500UL VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 1498.5, "currency": "MXN" } } }, { "id": "0", "description": "R1469277 - DNA LADDER 100 BP, 100-1500 BP (50µG/500µL )", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1132.2, "currency": "MXN" } } }, { "id": "0", "description": "R1469641 - TAQ DNA POLYMERASE (500 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1365.3, "currency": "MXN" } } }, { "id": "0", "description": "R1469852 - MIDORI GREEN ADVANCE (TINCIÓN DE ADN/ARN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1964.7, "currency": "MXN" } } }, { "id": "0", "description": "R1470871 - DNTP MIX 10 MM (2,5 MM CADA UNO)- ATP, DCTP, DGTP Y DCTP MEZCLADOS EN UN TUBO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 732.6, "currency": "MXN" } } }, { "id": "0", "description": "R1470872 - TAQ DNA POLYMERASE (5000 UNITS) 5 UNITS/µL. CON 10X AMMONIUM BUFFER (15 MM MGCL2)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 9274.05, "currency": "MXN" } } }, { "id": "0", "description": "R1471543 - RESINA DE NÍQUEL PARA UNA ALTA RECUPERACIÓN DE PROTEÍNAS MARCADAS CON HISTIDINA. NI SEPHAROSE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9525.65, "currency": "MXN" } } }, { "id": "0", "description": "R1471738 - HYCLONE™ DULBECCO'S MODIFIED EAGLE MEDIUM (DMEM) CON GLUCOSA ALTA: POLVO. CON: L-GLUTAMINA, GLUCOSA SIN: PIRUVATO DE SODIO, BICARBONATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1301.29, "currency": "MXN" } } }, { "id": "0", "description": "R1471739 - RPMI 1640, CON L-GLUTAMINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1350.46, "currency": "MXN" } } }, { "id": "0", "description": "R1471753 - MEDIOS DE CRIOCONSERVACIÓN HYCLONE HYCRYO-STEM 2X PARA CÉLULAS MADRE; FILTRADO ESTÉRIL DE 0,2 UM.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1726.22, "currency": "MXN" } } }, { "id": "0", "description": "R1462615 - CLOROFORMO GRADO BIOLOGIA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2500, "currency": "MXN" } } }, { "id": "0", "description": "R1464589 - LYMPHOPREP™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7200, "currency": "MXN" } } }, { "id": "0", "description": "R1464686 - GELRED® NUCLEIC ACID GEL STAIN, 10,000X IN WATER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3700, "currency": "MXN" } } }, { "id": "0", "description": "R1464802 - DAB PEROXIDASE (HRP) SUBSTRATE KIT (WITH NICKEL), 3,3’-DIAMINOBENZIDINE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "R1464806 - VECTASHIELD® ANTIFADE MOUNTING MEDIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5600, "currency": "MXN" } } }, { "id": "0", "description": "R1466828 - BUFFER DE CITRATOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6600, "currency": "MXN" } } }, { "id": "0", "description": "R1468880 - RAT IL-6 ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 14900, "currency": "MXN" } } }, { "id": "0", "description": "R1469198 - LIOFILCHEM™ MTS™ AMOXICILLIN [AML] 0.016-256 µG/ML. MIC TEST STRIP 30 TIRAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1469199 - LIOFILCHEM™ MTS™ CLARITHROMYCIN [CLR] 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1469200 - LIOFILCHEM™ MTS™ LEVOFLOXACIN [LEV] 0.002-32 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1469201 - LIOFILCHEM™ MTS™ METRONIDAZOLE [MTZ] 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1470534 - POLY-L-LYSINE SOLUTION 0.1% DE SOLUCIÓN ACUOSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5900, "currency": "MXN" } } }, { "id": "0", "description": "R1469765 - XILENO, A.C.S.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 5600, "currency": "MXN" } } }, { "id": "0", "description": "R1469842 - ß-NICOTINAMIDE ADENINE DINUCLEOTIDE REDUCED DISODIUM SALT =98%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 3500, "currency": "MXN" } } }, { "id": "0", "description": "R1469843 - SALSA® MLPA® EK1 REAGENT KIT 100 REACTIONS (6 VIALS) - FAM: ABI-PRISM 3100, ABI-PRISM 3100 AVANT , ABI-3130, ABI-3130XL, ABI-3730, ABI-3730XL, ABI-3500", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13800, "currency": "MXN" } } }, { "id": "0", "description": "R1470018 - GOAT ANTI-RABBIT IGG ANTIBODY (H+L), BIOTINYLATED", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "R1470019 - HORSE ANTI-GOAT IGG ANTIBODY (H+L), BIOTINYLATED", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "R1470020 - HORSE ANTI-MOUSE IGG ANTIBODY (H+L), BIOTINYLATED", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "R1470022 - M.O.M.® (MOUSE ON MOUSE) IMMUNODETECTION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9900, "currency": "MXN" } } }, { "id": "0", "description": "R1470975 - REACTIVO DE TINCIÓN FLUORO-JADE® C RTDTM®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 17300, "currency": "MXN" } } }, { "id": "0", "description": "R1470976 - ÁCIDO ARAQUIDÓNICO (AA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6000, "currency": "MXN" } } }, { "id": "0", "description": "R1470990 - KIT DE ENSAYO ELISA 20-HETE (ÁCIDO 20-HIDROXIEICOSATETRAENOICO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12100, "currency": "MXN" } } }, { "id": "0", "description": "R1471005 - ANTICUERPO POLICLONAL PPAR GAMMA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10700, "currency": "MXN" } } }, { "id": "0", "description": "R1471059 - FSL-1 (PAM2CGDPKHPKSF), LIPOPROTEÍNA DIACILADA SINTÉTICA; AGONISTA DE TLR2/TLR6", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9700, "currency": "MXN" } } }, { "id": "0", "description": "R1471060 - HEK-BLUE™ SELECTION. ANTIBIÓTICOS PARA EL MANTENIMIENTO DE HEK-BLUE™ CELLS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5000, "currency": "MXN" } } }, { "id": "0", "description": "R1471062 - LPS-EK ESTÁNDAR (LPS DE E. COLI K12)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5500, "currency": "MXN" } } }, { "id": "0", "description": "R1471063 - NORMOCIN™ REACTIVO ANTIMICROBIANO (1 BOTELLA DE 20 ML (1 G) )", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8900, "currency": "MXN" } } }, { "id": "0", "description": "R1471064 - PAM3CSK4 (PAM3CYSSERLYS4), LIPOPÉPTIDO TRIACILADO SINTÉTICO; AGONISTA DE TLR2/TLR1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5900, "currency": "MXN" } } }, { "id": "0", "description": "R1471067 - QUANTI-BLUE™ MEDIO DE DETECCIÓN DE FOSFATASA ALCALINA, FORMA LÍQUIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 21000, "currency": "MXN" } } }, { "id": "0", "description": "R1471074 - TIRA DE PRUEBA AMIKACIN [AK] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471076 - TIRA DE PRUEBA CEFEPIME [FEP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471077 - TIRA DE PRUEBA CEFTAZIDIME [CAZ] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471078 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471079 - TIRA DE PRUEBA IMIPENEM - RELEBACTAM [I/R] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002/4-32/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471080 - TIRA DE PRUEBA MEROPENEM [MRP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471081 - TIRA DE PRUEBA AZTREONAM - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471082 - TIRA DE PRUEBA CEFIDEROCOL MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471083 - TIRA DE PRUEBA CEFTAZIDIME - AVIBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471085 - TIRA DE PRUEBA CIPROFLOXACIN [CIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471086 - TIRA DE PRUEBA COLISTIN [CS] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.064-1024 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471089 - TIRA DE PRUEBA IMIPENEM [IMI] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.002-32 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471090 - TIRA DE PRUEBA MEROPENEM - VABORBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/8-256/8 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471094 - TIRA DE PRUEBA PIPERACILLIN [PIP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471095 - TIRA DE PRUEBA PIPERACILLIN-TAZOBACTAM [TZP] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471096 - TIRA DE PRUEBA TICARCILLIN-CLAVULANIC ACID [TTC] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/2-256/2 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471097 - TIRA DE PRUEBA TOBRAMYCIN [TOB] MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016-256 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471114 - ALCOHOL, ANHIDRO, REACTIVO ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3300, "currency": "MXN" } } }, { "id": "0", "description": "R1471119 - SALSA ® MLPA ® PROBEMIX P034 DMD-1. REGIÓN: DMD XP21.1-P21.2", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 22000, "currency": "MXN" } } }, { "id": "0", "description": "R1471227 - DESOXICOLATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "R1471517 - MEDIO DE MONTAJE ANTIDECOLORACIÓN VECTASHIELD® CON DAPI", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6000, "currency": "MXN" } } }, { "id": "0", "description": "R1471518 - REACTIVO DE TRANSFECCIÓN TRANS IT®-LT1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 13200, "currency": "MXN" } } }, { "id": "0", "description": "R1471568 - 10NM SILVER NANOPARTICLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5600, "currency": "MXN" } } }, { "id": "0", "description": "R1471574 - ENSAYOS DE CALPROTECTINA FECAL EN HECES HUMANAS, BÜHLMANN FCAL® ELISA (RANGO:30-1800 µG/G)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 23300, "currency": "MXN" } } }, { "id": "0", "description": "R1471575 - DISPOSITIVO BÜHLMANN CALEX® CAP, CONTIENE 5 ML, TAMPÓN DE EXTRACCIÓN FECAL DE CALPROTECTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 21300, "currency": "MXN" } } }, { "id": "0", "description": "R1471576 - POLYMYXIN B (UN INHIBIDOR DE LA ACTIVACIÓN DE TLR4 INDUCIDA POR LPS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5300, "currency": "MXN" } } }, { "id": "0", "description": "R1471587 - ZEOCIN® (ANTIBIÓTICO SELECTIVO PARA EL GEN SH BLE; CULTIVO CELULAR PROBADO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7100, "currency": "MXN" } } }, { "id": "0", "description": "R1471588 - BLASTICIDINA (SOLUCIÓN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8900, "currency": "MXN" } } }, { "id": "0", "description": "R1471589 - G418 (GENETICINA), SOLUCIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3200, "currency": "MXN" } } }, { "id": "0", "description": "R1471591 - FLA-ST ULTRAPURE ( FAGELINA PURIFICADA DE S. TYPHIMURIUM; LIGANDO TLR5)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20000, "currency": "MXN" } } }, { "id": "0", "description": "R1471620 - PROTEÍNA SAG1 DE TOXOPLASMA GONDII RECOMBINANTE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 23100, "currency": "MXN" } } }, { "id": "0", "description": "R1471631 - MINI KIT I DE ADN PLASMÍDICO EZNA® (V-SPIN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 5200, "currency": "MXN" } } }, { "id": "0", "description": "R1471636 - TINCIÓN EOSINA NIGROSINA DE ESPERMATOZOIDES 30 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1500, "currency": "MXN" } } }, { "id": "0", "description": "R1471639 - SALSA ® MLPA ® PROBEMIX P035 DMD-1. REGIÓN: DMD XP21.1-P21.2", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 22000, "currency": "MXN" } } }, { "id": "0", "description": "R1471642 - PE-CYANINE7 ANTI-HUMAN CD45RA (HI100)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "R1471643 - APC-CIANINA7 CD45RO ANTIHUMANO (UCHL1)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9500, "currency": "MXN" } } }, { "id": "0", "description": "R1471644 - ANTICUERPO MONOCLONAL CD185 (CXCR5) (MU5UBEE), BRILLIANT VIOLET™ 421, EBIOSCIENCE™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "R1471645 - ANTICUERPO MONOCLONAL CD69 (FN50), BRILLIANT VIOLET™ 650, EBIOSCIENCE™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "R1471648 - PROTEÍNA DE FUSIÓN CD40 (HUMANA)-MUIG (R-PE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19900, "currency": "MXN" } } }, { "id": "0", "description": "R1471670 - DISCOS DE SUSCEPTIBILIDAD ANTIMICROBIANA DE CEFTAROLINA OXOID™, 30 µG. CPT30", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "R1471671 - DISCOS PARA ANTIBIOGRAMAS CON TEICOPLANINA OXOID™, 30 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "R1471678 - DISCOS PARA ANTIBIOGRAMAS CON TRIMETOPRIMA/SULFAMETOXAZOL 1:19 OXOID™, 25 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "R1471723 - ANTICUERPO TAU (CONEJO, POLICLONAL, IGG)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10700, "currency": "MXN" } } }, { "id": "0", "description": "R1471741 - (±)11(12)-EET", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12100, "currency": "MXN" } } }, { "id": "0", "description": "R1471743 - KIT DE ENSAYO ELISA 11,12 EET DHET", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12100, "currency": "MXN" } } }, { "id": "0", "description": "R1471744 - KIT DE ENSAYO ELISA 14,15 DHET", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12100, "currency": "MXN" } } }, { "id": "0", "description": "R1471747 - 17- ÁCIDO OCTADECINOICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 22100, "currency": "MXN" } } }, { "id": "0", "description": "R1471749 - PROTEÍNA RECOMBINANTE CYP2C9", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14500, "currency": "MXN" } } }, { "id": "0", "description": "R1471767 - TIRA DE PRUEBA CEFTOLOZANE -TAZOBACTAM MIC (CONCENTRACIÓN INHIBITORIA MÍNIMA), RANGO: 0.016/4-256/4 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2990, "currency": "MXN" } } }, { "id": "0", "description": "R1471773 - KIT DE SECUENCIACIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 61900, "currency": "MXN" } } }, { "id": "0", "description": "R1463952 - SUERO FETAL BOVINO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 10800, "currency": "MXN" } } }, { "id": "0", "description": "R1463961 - FETAL BOVINE SERUM (MÉXICO, USDA APPROVED)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 9200, "currency": "MXN" } } }, { "id": "0", "description": "R1469732 - SUERO DE CABALLO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1980, "currency": "MXN" } } }, { "id": "0", "description": "R1469795 - GOAT ANTI-MOUSE IGG (H+L) CROSS-ADSORBED SECONDARY ANTIBODY, BIOTIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2907.88, "currency": "MXN" } } }, { "id": "0", "description": "R1470861 - SONDA VYSIS LSI D7S486 SPECTRUMORANGE/CEP 7 SPECTRUMGREEN SE HIBRIDAN CON LA BANDA 7Q31 (SPECTRUMORANGE LSI D7S486)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 25000, "currency": "MXN" } } }, { "id": "0", "description": "R1470994 - SONDA EN BAC PARA EL CROMOSOMA XP MARCADA EN VERDE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 46875, "currency": "MXN" } } }, { "id": "0", "description": "R1470996 - SONDA EN BAC PARA EL CROMOSOMA XQ MARCADA EN NARANJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 46875, "currency": "MXN" } } }, { "id": "0", "description": "R1471505 - TARJETAS DE IDENTIFICACIÓN VITEK®2 AST-N403", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 5250, "currency": "MXN" } } }, { "id": "0", "description": "R1471509 - ANEUVYSION MULTICOLOR DNA. KIT CON 5 DIFERENTES SONDAS DE DNA PARA DETECCIÓN DE LOS CROMOSOMAS X,Y, 18 Y 13, 21. PARA 30 ENSAYOS.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 122275, "currency": "MXN" } } }, { "id": "0", "description": "R1471510 - SONDA DE DNA PARA LA DETECCIÓN DE LA MICRODELECIÓN LSI 1P36 CON SONDAS PARA 1PTEL Y 1Q25", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19922, "currency": "MXN" } } }, { "id": "0", "description": "R1471619 - KIT PARA DETERMINAR OH PROGESTERONA (17-OHP) EN SUERO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7347.49, "currency": "MXN" } } }, { "id": "0", "description": "R1471732 - SULFATO DE ZINC HEPTAHIDRATADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 6205, "currency": "MXN" } } }, { "id": "0", "description": "R1464845 - KIT NO DERIVATIZADO PARA CUANTIFICACIÓN DE AMINOÁCIDOS, ACILCARNITINAS Y SUCCINILACETONA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 129953.7, "currency": "MXN" } } }, { "id": "0", "description": "R1459666 - TRIZOL™ REAGENT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6149.02, "currency": "MXN" } } }, { "id": "0", "description": "R1461996 - FAST SYBR® GREEN MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 2143.15, "currency": "MXN" } } }, { "id": "0", "description": "R1468717 - MULTISCRIBE™ REVERSE TRANSCRIPTASE ( 50 UNITS / µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2618.1, "currency": "MXN" } } }, { "id": "0", "description": "R1469217 - MICROAMP™ OPTICAL ADHESIVE FILM (96-WELL, STANDARD PLATE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1417.69, "currency": "MXN" } } }, { "id": "0", "description": "R1471330 - HOSTZERO™ MICROBIAL DNA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 10063.14, "currency": "MXN" } } }, { "id": "0", "description": "R1471334 - ZYMOTAQ™ PREMIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5056.34, "currency": "MXN" } } }, { "id": "0", "description": "R1471511 - SALIVA DNA COLLECTION AND PRESERVATION DEVICES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12461.01, "currency": "MXN" } } }, { "id": "0", "description": "R1471512 - SALIVA DNA ISOLATION KIT,", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3101.49, "currency": "MXN" } } }, { "id": "0", "description": "R1471656 - KIT MAGMAX™ ADN MULTIMUESTRA ULTRA 2.0", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9765.1, "currency": "MXN" } } }, { "id": "0", "description": "R1471657 - DYNABEADS® DNA DIRECT™ UNIVERSAL KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10377.32, "currency": "MXN" } } }, { "id": "0", "description": "R1471726 - SUERO BOVINO FETAL, DESPOJADO DE CARBÓN VEGETAL, REGIONES APROBADAS POR EE.UU", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 17959.63, "currency": "MXN" } } }, { "id": "0", "description": "R1471774 - CLARIOM™ D ARRAY, HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 76618.13, "currency": "MXN" } } }, { "id": "0", "description": "R1471775 - ENSAYO GENECHIP™ GENOMA HUMANO U133 PLUS 2.0", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 231147.29, "currency": "MXN" } } }, { "id": "0", "description": "R1471778 - KIT QUICK -DNA/RNA MAGBEAD", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7297.86, "currency": "MXN" } } }, { "id": "0", "description": "R1463898 - ANTICUERPO ß-ACTIN ANTICUERPO (C4) ES UN MONOCLONAL DE RATÓN IGG1 (200 µG/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1463976 - CATALASE FLUOROMETRIC DETECTION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 10152, "currency": "MXN" } } }, { "id": "0", "description": "R1463980 - SOD ACTIVITY KIT (5 X 96 WELLS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 16351, "currency": "MXN" } } }, { "id": "0", "description": "R1464720 - PROTEIN CARBONYL ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 19591, "currency": "MXN" } } }, { "id": "0", "description": "R1464816 - ACIDO TIOBARBITÚRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5757, "currency": "MXN" } } }, { "id": "0", "description": "R1466853 - KIT ELISA DE CORTICOSTERONA DE ALTA SENSIBILIDAD", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9482, "currency": "MXN" } } }, { "id": "0", "description": "R1466929 - ANTICUERPO ANT CRF (2B11)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1467977 - PROTEÍNA A/G PLUS-AGAROSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1428, "currency": "MXN" } } }, { "id": "0", "description": "R1468830 - ANTIMOUSE IGG ESPECÍFICO PARA FCGAMMA SUBLASE 2C PEROXIDASE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6885, "currency": "MXN" } } }, { "id": "0", "description": "R1468903 - NURR1 ANTIBODY (F-5)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1469504 - INICIADORES PARA PCR (SECUENCIA DE 30 BASES:ATCAAG TACAGTTAGTCTTTATTAGATCAA), LIBRE DE SAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 174, "unit": { "name": "PIEZA", "value": { "amount": 313, "currency": "MXN" } } }, { "id": "0", "description": "R1469515 - MTT FORMAZAN (CAS 57360-69-7)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2880, "currency": "MXN" } } }, { "id": "0", "description": "R1469800 - SUERO DE BURRO NORMAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1728, "currency": "MXN" } } }, { "id": "0", "description": "R1469827 - ACETYL COENZYME A TRILITHIUM SALT TRIHYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18099, "currency": "MXN" } } }, { "id": "0", "description": "R1469828 - ALBUMINA SÉRICA BÓVINA FRACCIÓN V", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 24769, "currency": "MXN" } } }, { "id": "0", "description": "R1470602 - CATALASE, >=2000 U/MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1286, "currency": "MXN" } } }, { "id": "0", "description": "R1469877 - TRA1/A2 ANTICUERPO (2103)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1469883 - NADP, DISODIUM SALT (CAS 24292-60-2)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 6912, "currency": "MXN" } } }, { "id": "0", "description": "R1469890 - ANTI-IBA1 ANTIBODY (1022-5)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1470999 - KIT ELISA DE DAÑO RÁPIDO DEL ADN PARA CÁNCER, APOPTOSIS Y ESTRÉS OXIDATIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 20693, "currency": "MXN" } } }, { "id": "0", "description": "R1471069 - PEROXIDASA AFFINIPURE CABRA ANTI-RATÓN IGG (H+L). (MIN X HU, BOV, HRS SR PROT)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3942, "currency": "MXN" } } }, { "id": "0", "description": "R1471169 - CASPASE-1 ANTICUERPO (14F468)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471171 - COENZIMA A", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9216, "currency": "MXN" } } }, { "id": "0", "description": "R1471180 - KV1.3 ANTICUERPO (G-9)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471184 - PERMETRINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 33156, "currency": "MXN" } } }, { "id": "0", "description": "R1471523 - ANTICUERPO GFAP (2E1)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471524 - ANTICUERPO SOX-2 (E-4)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471525 - EF-CAB1 ANTICUERPO (B-2)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471557 - KIT DE GLUTATIÓN REDUCTASA (GR) ENZYCHROM™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 7752, "currency": "MXN" } } }, { "id": "0", "description": "R1471558 - KIT DE ENSAYO ENZYCHROM™ GSH/GSSG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 8481, "currency": "MXN" } } }, { "id": "0", "description": "R1471579 - TIM ANTICUERPO (H-11) ALEXA FLUOR® 680", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "R1471593 - INTEGRIN AV/ß3/CD51/CD61 ANTICUERPO (23C6) ALEXA FLUOR® 405", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "R1471596 - CDK2 ANTICUERPO (D-12) ALEXA FLUOR® 488", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "R1471597 - COFILIN ANTICUERPO (E-8) ALEXA FLUOR® 594", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "R1471598 - SORORIN ANTICUERPO (B-9) ALEXA FLUOR® 790", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "R1471622 - PEROXIDASA AFFINIPURE GOAT ANTI-MOUSE IGM, ESPECÍFICO DE CADENA µ", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5643, "currency": "MXN" } } }, { "id": "0", "description": "R1471629 - CYTOKERATIN 19 ANTIBODY (BA17)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471630 - HISTONE H3 ANTICUERPO (1G1)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471633 - (-)-GALATO DE EPIGALOCATEQUINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 5161, "currency": "MXN" } } }, { "id": "0", "description": "R1471638 - ANTICUERPO POLICLONAL RECEPTOR DE ESTRÓGENO ß (BETA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 17582, "currency": "MXN" } } }, { "id": "0", "description": "R1471654 - IGG 1 DE RATÓN NORMAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 691, "currency": "MXN" } } }, { "id": "0", "description": "R1471706 - CLORURO DE SODIO (NACI), REACTIVO DE CULTIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3129, "currency": "MXN" } } }, { "id": "0", "description": "R1471727 - CASPASE-3 ANTICUERPO (31A1067)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471728 - BML-275, INHIBIDOR DE AMPK", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10174, "currency": "MXN" } } }, { "id": "0", "description": "R1471731 - 5-BROMO-2'-DEOXYURIDINE (5-BRDU)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10647, "currency": "MXN" } } }, { "id": "0", "description": "R1471760 - SOMATOSTATIN ANTICUERPO (H-11)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7142, "currency": "MXN" } } }, { "id": "0", "description": "R1471762 - AGAR PARA BACTERIOLOGIA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16906, "currency": "MXN" } } }, { "id": "0", "description": "R1463983 - GLUTATHIONE REDUCTASE ACTIVITY KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 20336, "currency": "MXN" } } }, { "id": "0", "description": "R1464717 - KIT PARA MEDICIÓN DE T3 EN SUERO DE RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16610, "currency": "MXN" } } }, { "id": "0", "description": "R1464718 - KIT PARA MEDICIÓN DE T4 EN SUERO DE RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 16610, "currency": "MXN" } } }, { "id": "0", "description": "R1465512 - DAB (3,3’-DIAMINOBENZIDINE ) CHROMOGEN SYSTEM. KIT DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11673, "currency": "MXN" } } }, { "id": "0", "description": "R1468876 - ANTICUERPO PRIMARIO BDNF", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11758, "currency": "MXN" } } }, { "id": "0", "description": "R1470497 - ALEXA FLUOR® 647 ANTI-HUMAN CD127 (IL-7R?) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8987, "currency": "MXN" } } }, { "id": "0", "description": "R1469733 - 20-HETE (20-HYDROXY ARACHIDONIC ACID)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15970, "currency": "MXN" } } }, { "id": "0", "description": "R1469740 - KIT DETERMINACIÓN TESTOSTERONA 96 POZOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5229, "currency": "MXN" } } }, { "id": "0", "description": "R1470731 - RESORUFIN ETHYL ETER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 44937, "currency": "MXN" } } }, { "id": "0", "description": "R1470938 - BD BBL™ SENSI-DISC™ LINEZOLID, 30 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2619, "currency": "MXN" } } }, { "id": "0", "description": "R1470965 - APC/CYANINE7 ANTI-HUMAN CD196 (CCR6) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9765, "currency": "MXN" } } }, { "id": "0", "description": "R1470970 - PE ANTI-HUMAN CD183 (CXCR3) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10623, "currency": "MXN" } } }, { "id": "0", "description": "R1470980 - SUCCINIL-COA SINTETASA ( E. COLI )", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26564, "currency": "MXN" } } }, { "id": "0", "description": "R1471506 - DETECCIÓN UNIVERSAL DE POLÍMERO HRP MACH 1™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 58294, "currency": "MXN" } } }, { "id": "0", "description": "R1471513 - KIT ELISA DEL FACTOR NEUROTRÓFICO DERIVADO DEL CEREBRO DE RATA. (BDNF): BRAIN DERIVED NEUROTROPHIC FACTOR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15825, "currency": "MXN" } } }, { "id": "0", "description": "R1471514 - KIT ST ELISA, SEROTONINA DE RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11737, "currency": "MXN" } } }, { "id": "0", "description": "R1471515 - HIDRATO DE SULFURO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2585, "currency": "MXN" } } }, { "id": "0", "description": "R1471533 - 2-AMINOBENZOXAZOLE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1838, "currency": "MXN" } } }, { "id": "0", "description": "R1471569 - NANOCOMPOSIX SILVER NANOSPHERES, 10 NM (BIOPURE, 1 MG/ML, BARE (CITRATE), 1 ML, AQUEOUS 2 MM SODIUM CITRATE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 10707, "currency": "MXN" } } }, { "id": "0", "description": "R1471580 - Z -FR-AMC FLUOROGENIC PEPTIDE SUBSTRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7499, "currency": "MXN" } } }, { "id": "0", "description": "R1471584 - KIT DE ENSAYO DE MICROPLACAS DE HEXOQUINASA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11857, "currency": "MXN" } } }, { "id": "0", "description": "R1471585 - KIT DE ENSAYO DE ACTIVIDAD DE 6-FOSFOFRUCTOQUINASA (PFK)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6446, "currency": "MXN" } } }, { "id": "0", "description": "R1471586 - KIT DE ENSAYO COLORIMÉTRICO DE PIRUVATO QUINASA (PK)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5484, "currency": "MXN" } } }, { "id": "0", "description": "R1471590 - CÉLULAS HEK-BLUE™-HTLR5 (CÉLULAS SEAP REPORTER 293 QUE EXPRESAN EL GEN TLR5 HUMANO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 45538, "currency": "MXN" } } }, { "id": "0", "description": "R1471594 - INTEGRINA ALFAV, BETA3, PROTEÍNA ACTIVA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 24411, "currency": "MXN" } } }, { "id": "0", "description": "R1471595 - COFILINA 1, NO MUSCULAR (CFL1), PROTEÍNA ACTIVA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9212, "currency": "MXN" } } }, { "id": "0", "description": "R1471612 - AGAROSA LE, EEO BAJO, GRADO DE BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16215, "currency": "MXN" } } }, { "id": "0", "description": "R1471624 - ANTICUERPO CD34 ANTI-RATÓN PURIFICADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7860, "currency": "MXN" } } }, { "id": "0", "description": "R1471625 - ANTICUERPO RECOMBINANTE ANTI-CD45 DE RATÓN PURIFICADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5848, "currency": "MXN" } } }, { "id": "0", "description": "R1471626 - ANTICUERPO CD54 O ICAM-1, ANTI-RATÓN PURIFICADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3649, "currency": "MXN" } } }, { "id": "0", "description": "R1471627 - ANTICUERPO ANTI-RATÓN CD284 (TLR4) PURIFICADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4266, "currency": "MXN" } } }, { "id": "0", "description": "R1471628 - ANTICUERPO DE GALECTINA-3 (MAC-2) ANTI-RATÓN/HUMANO PURIFICADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6921, "currency": "MXN" } } }, { "id": "0", "description": "R1471634 - DETECCIÓN RATÓN HRP-POLÍMERO MACH 2™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26751, "currency": "MXN" } } }, { "id": "0", "description": "R1471640 - PROTEÍNA IL-12 HUMANA RECOMBINANTE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 10323, "currency": "MXN" } } }, { "id": "0", "description": "R1471641 - PROTEÍNA IL-23 HUMANA RECOMBINANTE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11604, "currency": "MXN" } } }, { "id": "0", "description": "R1471646 - ANTICUERPO ANTI-CD25 HUMANO PACIFIC BLUE™", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3461, "currency": "MXN" } } }, { "id": "0", "description": "R1471649 - ANTIHUMAN CD4 PERCP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8987, "currency": "MXN" } } }, { "id": "0", "description": "R1471650 - ANTICUERPO ANTI-CD45RA HUMANO FITC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1771, "currency": "MXN" } } }, { "id": "0", "description": "R1471651 - ANTICUERPO BIOTINILADO DE IFN-GAMMA HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15206, "currency": "MXN" } } }, { "id": "0", "description": "R1471652 - ANTICUERPO BIOTINILADO IL-6 HUMANO/PRIMATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15473, "currency": "MXN" } } }, { "id": "0", "description": "R1471653 - ANTICUERPO BIOTINILADO IL-17/IL-17A HUMANO/PRIMATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15473, "currency": "MXN" } } }, { "id": "0", "description": "R1471660 - ÁCIDO DL- P -HIDROXIFENILLÁCTICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11365, "currency": "MXN" } } }, { "id": "0", "description": "R1471663 - ÁCIDO 3-HIDROXIPROPIÓNICO, SOLUCIÓN AL 30% EN AGUA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2078, "currency": "MXN" } } }, { "id": "0", "description": "R1471667 - KIT PARA DETERMINACIÓN TNF-ALFA HUMANO DUOSET® ELISA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12431, "currency": "MXN" } } }, { "id": "0", "description": "R1471668 - KIT PARA DETERMINACIÓN IL-10 HUMANA DUOSET® ELISA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12431, "currency": "MXN" } } }, { "id": "0", "description": "R1471675 - MENADIONA (K3)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1278, "currency": "MXN" } } }, { "id": "0", "description": "R1471697 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU , AP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 17793, "currency": "MXN" } } }, { "id": "0", "description": "R1471703 - ANTICUERPO ANTI-COLINA ACETILTRANSFERASA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16498, "currency": "MXN" } } }, { "id": "0", "description": "R1471707 - KIT DE ELISA ULTRA SENSIBLE PARA DETECTAR INSULINA DE RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12904, "currency": "MXN" } } }, { "id": "0", "description": "R1471730 - PANEL DE INFLAMACIÓN DE RATAS LEGENDPLEX™ (13-PLEX) CON FP V02", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 47239, "currency": "MXN" } } }, { "id": "0", "description": "R1471733 - ANTICUERPO DE CABRA ANTI-IGG HUMANA, EL CONJUGADO HRP DETECTA EL NIVEL DE IGG HUMANA Y HA SIDO PUBLICADO Y VALIDADO PARA SU USO EN ELISA Y WB.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 13349, "currency": "MXN" } } }, { "id": "0", "description": "R1471734 - KIT DE TINCIÓN DE MITOCONDRIAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15510, "currency": "MXN" } } }, { "id": "0", "description": "R1471742 - (±)14(15)-EET", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13221, "currency": "MXN" } } }, { "id": "0", "description": "R1471745 - ARREGLO DE INFLAMACIÓN HUMANA C3", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16340, "currency": "MXN" } } }, { "id": "0", "description": "R1471746 - MATRIZ C2 DE NF-¿B HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16340, "currency": "MXN" } } }, { "id": "0", "description": "R1471748 - PROTEÍNA RECOMBINANTE CYP2J2", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19000, "currency": "MXN" } } }, { "id": "0", "description": "R1471761 - KIT PARA MEDICIÓN DE LONGITUD DE TELOMEROS POR CITOMETRÍA DE FLUJO PNA KIT/FITC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 36337, "currency": "MXN" } } }, { "id": "0", "description": "R1471764 - SULFATO DE CEFTOLOZANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4133, "currency": "MXN" } } }, { "id": "0", "description": "R1471769 - ANTICUERPO BIOTINA ANTI-IGE HUMANA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5526, "currency": "MXN" } } }, { "id": "0", "description": "R1471770 - ANEXINA V FITC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5205, "currency": "MXN" } } }, { "id": "0", "description": "R1471771 - AGENCOURT® RNACLEAN® XP, 40ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26046, "currency": "MXN" } } }, { "id": "0", "description": "R1451016 - FOSFATO DE SODIO, DIBÁSICO, ANHIDRO, REACTIVO BAKER ANALYZED™ ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 559.21, "currency": "MXN" } } }, { "id": "0", "description": "R1463996 - ETHANOL ABSOLUTO PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 18, "unit": { "name": "PIEZA", "value": { "amount": 480.48, "currency": "MXN" } } }, { "id": "0", "description": "R1464015 - ETHANOL ABSOLUTE FOR ANALYSIS EMSURE AC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 910.91, "currency": "MXN" } } }, { "id": "0", "description": "R1464018 - EXTRAN® MA 02 SUPELCO®, LÍQUIDO, NEUTRO, CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 765, "currency": "MXN" } } }, { "id": "0", "description": "R1464103 - 2-PROPANOL (ISOPROPANOL GRADO BIOLOGÍA MOLECULAR )", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1688.05, "currency": "MXN" } } }, { "id": "0", "description": "R1464120 - D-GLUCOSE 6 PHOSPHATE DISODIUM SALT HYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1936, "currency": "MXN" } } }, { "id": "0", "description": "R1464128 - ETANOL ABSOLUTO GRADO BIOL. MOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1430.52, "currency": "MXN" } } }, { "id": "0", "description": "R1464157 - PHENOL-CLOROFORMO-ISOAMILICO (25:24:1)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 2983.89, "currency": "MXN" } } }, { "id": "0", "description": "R1464177 - TWEEN 20 VISCOUS LIQUID", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 748.93, "currency": "MXN" } } }, { "id": "0", "description": "R1464762 - METANOL SUPELCO® PARA ANÁLISIS EMSURE® ACS,ISO,REAG. PH EUR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2511.6, "currency": "MXN" } } }, { "id": "0", "description": "R1466198 - COMPLETE™ PROTEASE INHIBITOR COCKTAIL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9595.95, "currency": "MXN" } } }, { "id": "0", "description": "R1466209 - DNASE I RECOMBINANT, RNASE-FREE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5172.44, "currency": "MXN" } } }, { "id": "0", "description": "R1466296 - TRIPTONA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3104.92, "currency": "MXN" } } }, { "id": "0", "description": "R1466877 - CLORURO DE SODIO, CRISTAL, BAKER ANALYZED™ A.C.S. REACTIVO,", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 209, "currency": "MXN" } } }, { "id": "0", "description": "R1466967 - O-PHENYLENEDIAMINE DIHYDROCHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9851.67, "currency": "MXN" } } }, { "id": "0", "description": "R1467895 - HIDRÓGENO PERÓXIDO 30%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 789.88, "currency": "MXN" } } }, { "id": "0", "description": "R1468013 - BRDU", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 2758.21, "currency": "MXN" } } }, { "id": "0", "description": "R1468047 - GLYCEROL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 3394.3, "currency": "MXN" } } }, { "id": "0", "description": "R1468734 - AZUL TRIPÁN SOLUCIÓN DE 0.4%, LÍQUIDO, FILTRADO ESTÉRIL, ADECUADO PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 849, "currency": "MXN" } } }, { "id": "0", "description": "R1468746 - BACTO™ AGAR SOLDIFYING AGENT, BD DIAGNOSTICS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2891, "currency": "MXN" } } }, { "id": "0", "description": "R1468841 - ÁCIDO ORTO-FOSFÓRICO 85% (EMSURE® ACS, ISO, REAG.)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1838.2, "currency": "MXN" } } }, { "id": "0", "description": "R1468842 - ACEITE DE INMERSIÓN PARA MICROSCOPIA (INMERSION OIL FOR MICROSCOPY)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 626.08, "currency": "MXN" } } }, { "id": "0", "description": "R1468877 - CELL PROLIFERATION KIT II (XTT)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 12604.41, "currency": "MXN" } } }, { "id": "0", "description": "R1468898 - DTT 1,4-DITHIOTHREITOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10663.38, "currency": "MXN" } } }, { "id": "0", "description": "R1468899 - COMPLETE™, MINI, EDTA-FREE PROTEASE INHIBITOR COCKTAIL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5342.61, "currency": "MXN" } } }, { "id": "0", "description": "R1468916 - CHLORAMPHENICOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1373.19, "currency": "MXN" } } }, { "id": "0", "description": "R1468938 - QUERCETINA (QUERCETIN) 95% (HPLC), SÓLIDO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1239.42, "currency": "MXN" } } }, { "id": "0", "description": "R1468949 - AGAROSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 34752.3, "currency": "MXN" } } }, { "id": "0", "description": "R1468958 - AURANOFIN ?98% (HPLC)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10583.3, "currency": "MXN" } } }, { "id": "0", "description": "R1468977 - HEMATOXYLIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3101.28, "currency": "MXN" } } }, { "id": "0", "description": "R1468993 - AMERSHAM™ PROTRAN® WESTERN BLOTTING MEMBRANES, NITROCELLULOSE ( 0.45 ?M, SHEET W × L 100 MM × 100 MM)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3809.3, "currency": "MXN" } } }, { "id": "0", "description": "R1468997 - PROTEINASE K FROM TRITIRACHIUM ALBUM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4172.35, "currency": "MXN" } } }, { "id": "0", "description": "R1469001 - RESVERATROL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3786.51, "currency": "MXN" } } }, { "id": "0", "description": "R1469307 - HUMAN ADIPONECTIN ELISA KIT 96 PZOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 15629.25, "currency": "MXN" } } }, { "id": "0", "description": "R1469376 - CITOCROMO C DE CORAZÓN BOVINO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5587.4, "currency": "MXN" } } }, { "id": "0", "description": "R1469392 - ISOPROPANOL GRADO BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 836.29, "currency": "MXN" } } }, { "id": "0", "description": "R1469394 - LB BROTH, MILLER, MEDIO DE CULTIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4025.84, "currency": "MXN" } } }, { "id": "0", "description": "R1469414 - SULFATO DE MAGNESIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2264.99, "currency": "MXN" } } }, { "id": "0", "description": "R1469423 - CLORHIDRATO DE CISTEAMINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2000.18, "currency": "MXN" } } }, { "id": "0", "description": "R1470488 - CALDO SOYA TRIPTICASEÍNA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1813, "currency": "MXN" } } }, { "id": "0", "description": "R1469823 - ANTI-NEUN ANTIBODY, CLONE A60 CHEMICON® DE RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7677.67, "currency": "MXN" } } }, { "id": "0", "description": "R1469894 - LECTIN FORMO PHASEOLUS VULGARIS (RED KIDNEY BEAN)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1829.1, "currency": "MXN" } } }, { "id": "0", "description": "R1469906 - ETANOL GRADO BIOLOGIA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7382.83, "currency": "MXN" } } }, { "id": "0", "description": "R1469915 - N,O-BIS(TRIMETHYLSILYL)TRIFLUOROACETAMIDE WITH TRIMETHYLCHLOROSILANE FOR GC DERIVATIZATION, LICHROPUR™, CONTAINS 1% TMCS, 99% (EXCLUDING TMCS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4181.45, "currency": "MXN" } } }, { "id": "0", "description": "R1470690 - MALTOSA (D-(+)-MALTOSA MONOHIDRATO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5993.9, "currency": "MXN" } } }, { "id": "0", "description": "R1470702 - BUTYRYL COENZYME A LITHIUM SALT HYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8513.05, "currency": "MXN" } } }, { "id": "0", "description": "R1470718 - KAEMPFEROL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3449.81, "currency": "MXN" } } }, { "id": "0", "description": "R1470722 - MINIMUM ESSENTIAL MEDIUM EAGLE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1011.01, "currency": "MXN" } } }, { "id": "0", "description": "R1470724 - MYRICETIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3399.76, "currency": "MXN" } } }, { "id": "0", "description": "R1470732 - S-(5?-ADENOSYL)-L-METHIONINE CHLORIDE DIHYDROCHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5122.39, "currency": "MXN" } } }, { "id": "0", "description": "R1469969 - TARTRATO DE POTASIO Y SODIO TETRAHIDRATADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1797.25, "currency": "MXN" } } }, { "id": "0", "description": "R1469971 - TRICINE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11757.2, "currency": "MXN" } } }, { "id": "0", "description": "R1469977 - CELL PROLIFERATION REAGENT WST-1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 13408.85, "currency": "MXN" } } }, { "id": "0", "description": "R1469982 - ADENOSINE 5´-TRIPHOSPHATE DISODIUM SALT HYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1579.76, "currency": "MXN" } } }, { "id": "0", "description": "R1470945 - SOBRES DE SISTEMA DE RECIPIENTES DE CO2 GASPAK™ EZ", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2066, "currency": "MXN" } } }, { "id": "0", "description": "R1471103 - TAMPÓN DE LISIS RIPA, 10X, PARA INMUNOPRECIPITACIÓN Y TRANSFERENCIA WESTERN.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2319.59, "currency": "MXN" } } }, { "id": "0", "description": "R1471105 - ACETONITRILO HIPERGRADO PARA LC-MS LICHROSOLV®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4608.24, "currency": "MXN" } } }, { "id": "0", "description": "R1471106 - METANOL PARA CROMATOGRAFÍA LÍQUIDA LICHROSOLV®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1809.08, "currency": "MXN" } } }, { "id": "0", "description": "R1471156 - GLUCOSA-6-FOSFATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2654.47, "currency": "MXN" } } }, { "id": "0", "description": "R1471195 - 5,5'-DITHIOBIS(2-NITROBENZOIC ACID): (DTNB).BIOREAGENT®", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2793.7, "currency": "MXN" } } }, { "id": "0", "description": "R1471200 - ÁCIDO BÓRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2480.66, "currency": "MXN" } } }, { "id": "0", "description": "R1471207 - ALCOHOL ETÍLICO PURO (ETANOL), PARA 200 PRUEBAS BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1939.21, "currency": "MXN" } } }, { "id": "0", "description": "R1471220 - CLORHIDRATO DE VITAMINA B12A", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7928.83, "currency": "MXN" } } }, { "id": "0", "description": "R1471224 - COENZIMA A HIDRATO (COA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2584.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471240 - GUANOSINE 5'-DIPHOSPHATE SODIUM SALT (GDP)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1947.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471257 - METILMALONIL COENZIMA A TETRALITIO SAL HIDRATADA (MM-COA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13013, "currency": "MXN" } } }, { "id": "0", "description": "R1471265 - PHOSPHATE BUFFERED SALINE. PH 7.4, PHAST PACK™, POWDER", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2302.3, "currency": "MXN" } } }, { "id": "0", "description": "R1471271 - RPMI-1640 MEDIO (CON L-GLUTAMINA Y BICARBONATO DE SODIO, LÍQUIDO, ESTERILIZADO POR FILTRACIÓN, APTO PARA CULTIVO CELULAR)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1114.75, "currency": "MXN" } } }, { "id": "0", "description": "R1471282 - SOLUCIÓN DE ROJO FENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 711.62, "currency": "MXN" } } }, { "id": "0", "description": "R1471294 - ß-NAPHTHOFLAVONE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1285.83, "currency": "MXN" } } }, { "id": "0", "description": "R1471504 - GLICEROL PARA BIOLOGÍA MOLECULAR, =99,0%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2851.03, "currency": "MXN" } } }, { "id": "0", "description": "R1471507 - METRONIDAZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3142.23, "currency": "MXN" } } }, { "id": "0", "description": "R1471508 - ALBENDAZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2040.22, "currency": "MXN" } } }, { "id": "0", "description": "R1471516 - CITRATO DE SODIO TRIBÁSICO DIHYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1155.7, "currency": "MXN" } } }, { "id": "0", "description": "R1471526 - TEMOZOLOMIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3025.75, "currency": "MXN" } } }, { "id": "0", "description": "R1471527 - 2-AMINO-5-NITROTHIAZOLE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 823.55, "currency": "MXN" } } }, { "id": "0", "description": "R1471528 - CLOROQUINA SAL DE DIFOSFATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1910.09, "currency": "MXN" } } }, { "id": "0", "description": "R1471529 - SULFATO DE HIDROXICLOROQUINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6036.03, "currency": "MXN" } } }, { "id": "0", "description": "R1471530 - NITAZOXANIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4841.1, "currency": "MXN" } } }, { "id": "0", "description": "R1471531 - 2-AMINOTHIAZOLE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 841.75, "currency": "MXN" } } }, { "id": "0", "description": "R1471532 - 2-AMINOBENZOTHIAZOLE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1383.2, "currency": "MXN" } } }, { "id": "0", "description": "R1471534 - 2-AMINO-6-NITROBENZOTIAZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 897.26, "currency": "MXN" } } }, { "id": "0", "description": "R1471535 - 2-AMINO-6-METILBENZOTIAZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1067.43, "currency": "MXN" } } }, { "id": "0", "description": "R1471537 - ISPF (A-ISONITROSOPROPIOPHENONE)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1013.74, "currency": "MXN" } } }, { "id": "0", "description": "R1471538 - GLUTAMATO DESHIDROGENASA (GLDH) DE HÍGADO DE RES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2356.9, "currency": "MXN" } } }, { "id": "0", "description": "R1471539 - UREASA DE CANAVALIA ENSIFORMIS (JUDÍA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1956.5, "currency": "MXN" } } }, { "id": "0", "description": "R1471541 - POLYVINYLPYRROLIDONE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4296.11, "currency": "MXN" } } }, { "id": "0", "description": "R1471542 - TETRACICLINA CLORHIDRATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2237.69, "currency": "MXN" } } }, { "id": "0", "description": "R1471544 - GENTAMICINA SULFATE SALT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3302.39, "currency": "MXN" } } }, { "id": "0", "description": "R1471545 - TAURINE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2130.31, "currency": "MXN" } } }, { "id": "0", "description": "R1471546 - ANFOTERICINA B SOLUTION", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2649.01, "currency": "MXN" } } }, { "id": "0", "description": "R1471547 - PIRUVATO SÓDICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3640, "currency": "MXN" } } }, { "id": "0", "description": "R1471548 - SAL TRISÓDICA DE INOSINA 5'-TRIFOSFATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2181.27, "currency": "MXN" } } }, { "id": "0", "description": "R1471549 - ZIDOVUDINE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2422.42, "currency": "MXN" } } }, { "id": "0", "description": "R1471550 - SULFATO DE COBRE (II)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4897.62, "currency": "MXN" } } }, { "id": "0", "description": "R1471551 - UREA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1759.94, "currency": "MXN" } } }, { "id": "0", "description": "R1471552 - CITRATO DE HIERRO Y AMONIO (III)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1415.96, "currency": "MXN" } } }, { "id": "0", "description": "R1471553 - CEFALOTINA SAL SÓDICA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3566.29, "currency": "MXN" } } }, { "id": "0", "description": "R1471555 - ACETONITRILO, GRADO HPLC, 99.9% DE PUREZA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 1295, "currency": "MXN" } } }, { "id": "0", "description": "R1471556 - EXTRAN® MA 05 (LÍQUIDO, ALCALINO, CONCENTRADO SIN FOSFATOS)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 940, "currency": "MXN" } } }, { "id": "0", "description": "R1471560 - KAEMPFEROL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 36588.37, "currency": "MXN" } } }, { "id": "0", "description": "R1471567 - ANTIBIOTIC ANTIMICOTIC SOLUTION (100X), STIBILIZED", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1119.3, "currency": "MXN" } } }, { "id": "0", "description": "R1471570 - AGAR CETRIMIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2794.61, "currency": "MXN" } } }, { "id": "0", "description": "R1471571 - COLLAGEN FROM HUMAN PLACENTA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7603.96, "currency": "MXN" } } }, { "id": "0", "description": "R1471572 - ASPARAGINE PROLINE BROTH", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6029.66, "currency": "MXN" } } }, { "id": "0", "description": "R1471573 - NESSLER'S REAGENT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 611.52, "currency": "MXN" } } }, { "id": "0", "description": "R1471577 - SUCCINATO DE SOLIFENACINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1238.51, "currency": "MXN" } } }, { "id": "0", "description": "R1471578 - BROMHIDRATO DE DARIFENACINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1689.87, "currency": "MXN" } } }, { "id": "0", "description": "R1471582 - SODIO CARBONATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1092.91, "currency": "MXN" } } }, { "id": "0", "description": "R1471583 - L-CARNOSINE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3222.31, "currency": "MXN" } } }, { "id": "0", "description": "R1471592 - SOLUCIÓN DE D-GLICERALDEHÍDO 3-FOSFATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7387.38, "currency": "MXN" } } }, { "id": "0", "description": "R1471599 - FENOL, PARA BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1408.68, "currency": "MXN" } } }, { "id": "0", "description": "R1471600 - DODECILSULFATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2649.01, "currency": "MXN" } } }, { "id": "0", "description": "R1471601 - CLORURO DE GUANIDINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 990.99, "currency": "MXN" } } }, { "id": "0", "description": "R1471602 - ACETATO DE POTASIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 744.38, "currency": "MXN" } } }, { "id": "0", "description": "R1471603 - CITRATO DE SODIO TRIBÁSICO DIHIDRATO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 600.6, "currency": "MXN" } } }, { "id": "0", "description": "R1471604 - ACETATO DE SODIO TRIHYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1093.82, "currency": "MXN" } } }, { "id": "0", "description": "R1471605 - KIT DE TRADUCCIÓN DE NICK", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7007, "currency": "MXN" } } }, { "id": "0", "description": "R1471606 - FLUORESCEÍNA-12-DUTP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7999.2, "currency": "MXN" } } }, { "id": "0", "description": "R1471608 - TETRAMETIL-RODAMINA-5-DUTP", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7748.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471611 - TIMIDINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1047.41, "currency": "MXN" } } }, { "id": "0", "description": "R1471621 - EVANS BLUE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1632.54, "currency": "MXN" } } }, { "id": "0", "description": "R1471623 - PROTEÍNA A-SEPHAROSE ® DE STAPHYLOCOCCUS AUREUS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6861.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471635 - ACETATO DE LEUPRORELINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10134.67, "currency": "MXN" } } }, { "id": "0", "description": "R1471637 - PROGESTERONA (POLVO, BIOREAGENT, APTO PARA CULTIVO CELULAR)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5069.61, "currency": "MXN" } } }, { "id": "0", "description": "R1471658 - AGUA GRADO UHPLC, PARA USO EN ESPECTROMETRÍA DE MASAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14128.66, "currency": "MXN" } } }, { "id": "0", "description": "R1471659 - ÁCIDO 4-HIDROXI-FENILPIRÚVICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1896.44, "currency": "MXN" } } }, { "id": "0", "description": "R1471661 - ÁCIDO 4-HIDROXI-FENIL-ACÉTICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 644.28, "currency": "MXN" } } }, { "id": "0", "description": "R1471662 - ÁCIDO METILMALÓNICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1582.49, "currency": "MXN" } } }, { "id": "0", "description": "R1471664 - ÁCIDO ß-HIDROXIISOVALÉRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10848.11, "currency": "MXN" } } }, { "id": "0", "description": "R1471665 - ÁCIDO 4-METIL-2-OXOVALÉRICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1708.07, "currency": "MXN" } } }, { "id": "0", "description": "R1471669 - AGAR SOYA BD BBL™ TRYPTICASE™ (MEDIO DE AGAR DIGERIDO DE SOJA Y CASEÍNA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 2435, "currency": "MXN" } } }, { "id": "0", "description": "R1471674 - DISCOS DE FACTOR X", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1301.3, "currency": "MXN" } } }, { "id": "0", "description": "R1471680 - SOLUCIÓN DE HEMINA (0.5 G/L)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2682.9, "currency": "MXN" } } }, { "id": "0", "description": "R1471681 - TIMIDINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3627.26, "currency": "MXN" } } }, { "id": "0", "description": "R1471686 - BD DIFCO ™ CALDO MUELLER HINTON 500G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2440, "currency": "MXN" } } }, { "id": "0", "description": "R1471687 - GENTAMICINA SAL DE SULFATO DE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2263.17, "currency": "MXN" } } }, { "id": "0", "description": "R1471689 - DALVABANCINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9694.8, "currency": "MXN" } } }, { "id": "0", "description": "R1471690 - DAPTOMICINA (ANTIBIÓTICO LIPOPÉPTIDO CÍCLICO)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9504.04, "currency": "MXN" } } }, { "id": "0", "description": "R1471691 - SAL DE MESILATO DE DEFEROXAMINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 3105.83, "currency": "MXN" } } }, { "id": "0", "description": "R1471692 - 1,1,3,3-TETRAETOXIPROPANO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7899.71, "currency": "MXN" } } }, { "id": "0", "description": "R1471693 - QUERCETIN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6341.79, "currency": "MXN" } } }, { "id": "0", "description": "R1471694 - REACTIVO DE FENOL DE FOLIN & CIOCALTEU", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4580.94, "currency": "MXN" } } }, { "id": "0", "description": "R1471699 - HEXAHIDRATO DE CLORURO DE COBALTO (II). REACTIVO ACS, 98%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1805.44, "currency": "MXN" } } }, { "id": "0", "description": "R1471700 - ANTICUERPO ANTIMIOSINA (ESQUELÉTICO, LENTO), MONOCLONAL DE RATÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10618.79, "currency": "MXN" } } }, { "id": "0", "description": "R1471724 - KIT DE DETECCIÓN DE MUERTE CELULAR IN SITU, TMR ROJO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12871.04, "currency": "MXN" } } }, { "id": "0", "description": "R1471725 - ELTROMBOPAG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8461.18, "currency": "MXN" } } }, { "id": "0", "description": "R1471736 - POLIVINILPIRROLIDONA (PESO MOLAR PROMEDIO 40,000)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1250.34, "currency": "MXN" } } }, { "id": "0", "description": "R1471740 - ÁCIDO GÁLICO ANHIDRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 612.43, "currency": "MXN" } } }, { "id": "0", "description": "R1471756 - CH-223191", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10963.68, "currency": "MXN" } } }, { "id": "0", "description": "R1471757 - CLOTETRACICLINA (CTC)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1573.39, "currency": "MXN" } } }, { "id": "0", "description": "R1471758 - LECTINA DE ARACHIS HIPOGAEA (MANÍ)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9428.51, "currency": "MXN" } } }, { "id": "0", "description": "R1471759 - HIALURONIDASA DE TESTÍCULOS BOVINOS. TIPO IV-S, POLVO LIOFILIZADO (ESENCIALMENTE SIN SAL), 750-3000 UNIDADES/MG DE SÓLIDO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4283.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471766 - AVIBACTAM SÓDICO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9383.92, "currency": "MXN" } } }, { "id": "0", "description": "R1471768 - SOLUCIÓN PREPARADA DE FLEOMICINA (0,2 µM FILTRADO, 20 MG/ML EN HEPES DE 20 MM)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1960.14, "currency": "MXN" } } }, { "id": "0", "description": "R1471780 - MEZCLA ESTÁNDAR DE ÉSTERES METÍLICOS DE ÁCIDOS GRASOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6025.8, "currency": "MXN" } } }, { "id": "0", "description": "R1471782 - IONÓFORO DE CALCIO A23187. =98% (TLC), POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14710.15, "currency": "MXN" } } }, { "id": "0", "description": "R1471783 - M16 MEDIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1314.95, "currency": "MXN" } } }, { "id": "0", "description": "R1466955 - ESTROPTOZOCINA, >=75 % EN BASE A ANÓMERO ALFA, >=98 % (HPLC), POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 36156.12, "currency": "MXN" } } }, { "id": "0", "description": "R1460497 - SULFATO DE ALUMINIO Y POTASIO, 12 HIDRATOS, CRISTAL, GRADO REACTIVO BAKER ANALYZED™ ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 991, "currency": "MXN" } } }, { "id": "0", "description": "R1462752 - BILIS DE BUEY. ELABORADA BAJO PROCESO DE BAJAS TEMPERATURAS Y DESHIDRATACIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1590, "currency": "MXN" } } }, { "id": "0", "description": "R1463447 - METANOL <=99.9% (POR GC, CORREGIDO POR CONTENIDO DE AGUA), BAKER ANALYZED ™ HPLC PARA CROMATOGRAFÍA LÍQUIDA, PARA HPLC / UHPLC", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 16, "unit": { "name": "PIEZA", "value": { "amount": 671, "currency": "MXN" } } }, { "id": "0", "description": "R1466303 - XILENOS, GRADO REACTIVO BAKER ANALYZED™ ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 9, "unit": { "name": "PIEZA", "value": { "amount": 2144, "currency": "MXN" } } }, { "id": "0", "description": "R1469495 - ALCOHOL ETILICO (ETANOL) AL 96 %", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3586, "currency": "MXN" } } }, { "id": "0", "description": "R1469500 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 10, COLOR AZUL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 126, "currency": "MXN" } } }, { "id": "0", "description": "R1469501 - AMORTIGUADOR (BUFFER)DE REFERENCIA PH 4.0, COLOR ROSA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 110, "currency": "MXN" } } }, { "id": "0", "description": "R1469502 - AMORTIGUADOR (BUFFER) DE REFERENCIA PH 7, COLOR AMARILLO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 110, "currency": "MXN" } } }, { "id": "0", "description": "R1470571 - 2-PROPANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4165, "currency": "MXN" } } }, { "id": "0", "description": "R1467902 - HUMAN LEPTIN DUAL RANGE ELISA KIT/96 POZOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 13625.52, "currency": "MXN" } } }, { "id": "0", "description": "R1471248 - KIT ELISA DE IL18 HUMANA/INTERLEUCINA-18", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16055.15, "currency": "MXN" } } }, { "id": "0", "description": "R1471564 - HIDROXIDO DE AMONIO SOLUCIÓN. REACTIVO ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1676.7, "currency": "MXN" } } }, { "id": "0", "description": "R1471673 - DISCOS DE FACTOR X + V", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1008.79, "currency": "MXN" } } }, { "id": "0", "description": "R1471676 - BD BBL ™ SENSI-DISC ™ AZTREONAM ATM-30 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2643.85, "currency": "MXN" } } }, { "id": "0", "description": "R1471679 - DISCO NITROFURANTOÍNA F/M-300 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2454.6, "currency": "MXN" } } }, { "id": "0", "description": "R1471695 - ÓXIDO DE 1,2-PROPILENO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1865.3, "currency": "MXN" } } }, { "id": "0", "description": "R1471754 - A (ALPHA)-NAFTOFLAVONA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 897, "currency": "MXN" } } }, { "id": "0", "description": "R1466249 - TETROXIDO DE OSMIO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1176, "currency": "MXN" } } }, { "id": "0", "description": "R1469742 - GLUTARALDEHÍDO, SOLUCIÓN ACUOSA 25%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1041.6, "currency": "MXN" } } }, { "id": "0", "description": "R1470991 - SOLUCIÓN DE ACEITE ROJO O-ISOPROPANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 785.4, "currency": "MXN" } } }, { "id": "0", "description": "R1471696 - GLUTARALDEHÍDO GRADO PARA MICROSCOPÍA ELECTRÓNICA. SOLUCIÓN ACUOSA AL 70%", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2452.8, "currency": "MXN" } } }, { "id": "0", "description": "R1471698 - KIT EMBED 812 PARA INCLUSIÓN EN MICROSCOPÍA ELECTRÓNICA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3024, "currency": "MXN" } } }, { "id": "0", "description": "R1464621 - BD BBL™ AGAR SAL Y MANITOL, 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 1809.08, "currency": "MXN" } } }, { "id": "0", "description": "R1470924 - BD BBL™ BASE DE AGAR SANGRE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2828.79, "currency": "MXN" } } }, { "id": "0", "description": "R1470957 - SENSIDISCOS DE AMPICILINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2279, "currency": "MXN" } } }, { "id": "0", "description": "R1470958 - SENSIDISCOS DE VANCOMICINA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2401.44, "currency": "MXN" } } }, { "id": "0", "description": "R1471502 - AGAROSA D1 BAJA EEO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 12127.5, "currency": "MXN" } } }, { "id": "0", "description": "R1471655 - LYSE/FIX BUFFER 5X", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10272, "currency": "MXN" } } }, { "id": "0", "description": "R1471677 - DISCO DE PRUEBA DE SUSCEPTIBILIDAD ANTIMICROBIANA SENSI-DISC™ CEFAZOLINA 30 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2250.19, "currency": "MXN" } } }, { "id": "0", "description": "R1471682 - BD SENSI-DISC ™ PENICILINA P-10 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2304.92, "currency": "MXN" } } }, { "id": "0", "description": "R1471683 - BBL™ SENSI-DISC™ TETRACICLINA 30 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2320.78, "currency": "MXN" } } }, { "id": "0", "description": "R1471684 - DISCO OXACILINA OX-1 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2304.92, "currency": "MXN" } } }, { "id": "0", "description": "R1471685 - BD SENSI-DISC™ TOBRAMICINA 10 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2381.27, "currency": "MXN" } } }, { "id": "0", "description": "R1471688 - SENSIDISCOS DE GENTAMICINA ALTA CARGA\nBD SENSI-DISC™ GENTAMICINA 120 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 439.36, "currency": "MXN" } } }, { "id": "0", "description": "R1471765 - AGAROSA D5", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 17069.5, "currency": "MXN" } } }, { "id": "0", "description": "R1463839 - ANTI-RABBIT IGG, HRP-LINKED ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4759, "currency": "MXN" } } }, { "id": "0", "description": "R1464093 - KIT PARA CUANTIFICACIÓN NEONATAL HTSH FEIA PLUS, EN MICROPLACA DE LA HORMONA ESTIMULANTE DE LA TIROIDES TIROTROFINA (TSH) EN SANGRE TOTAL DE NEONATOS COLECTADA EN PAPEL FILTRO CON CALIBRADORES Y CONTROLES INTERNOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 35568, "currency": "MXN" } } }, { "id": "0", "description": "R1464689 - ANTI-MOUSE IGG HRP- LINKED ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4759, "currency": "MXN" } } }, { "id": "0", "description": "R1464713 - MARCADOR DE PROTEÍNA AZUL PRETEÑIDO, RANGO AMPLIO (11-250 KDA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2746, "currency": "MXN" } } }, { "id": "0", "description": "R1467736 - KIT PARA CUANTIFICACIÓN NEONATAL G6PD (GLUCOSA 6-FOSFATO DESHIDROGENASA)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30096, "currency": "MXN" } } }, { "id": "0", "description": "R1469314 - ENZIMA DE RESTRICCION APAI", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 8662, "currency": "MXN" } } }, { "id": "0", "description": "R1469316 - ENZIMA DE RESTRICCIÓN MSPA1I KIT (10,000 UNITS/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8662, "currency": "MXN" } } }, { "id": "0", "description": "R1470619 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13799, "currency": "MXN" } } }, { "id": "0", "description": "R1469022 - PHUSION® HIGH-FIDELITY DNA POLYMERASE (2,000 UNITS/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3279, "currency": "MXN" } } }, { "id": "0", "description": "R1471122 - ENZIMA DE RESTRICCION ALWI (CONCENTRACIÓN: 10,000 UNITS/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2050, "currency": "MXN" } } }, { "id": "0", "description": "R1471123 - ENZIMA DE RESTRICCION NLAIII. CONCENTRACIÓN:10.000 UNIDADES/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8416, "currency": "MXN" } } }, { "id": "0", "description": "R1471124 - ENZIMA DE RESTRICCION SMAI (PEQUEÑO, RECOMBINANTE). CONCENTRACIÓN: 20.000 UNIDADES/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1913, "currency": "MXN" } } }, { "id": "0", "description": "R1471130 - KIT DE MUTAGÉNESIS DIRIGIDA AL SITIO Q5 ® (SIN CÉLULAS COMPETENTES)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4044, "currency": "MXN" } } }, { "id": "0", "description": "R1471503 - ENZIMA XBAI (20.000 UNIDADES/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 2104, "currency": "MXN" } } }, { "id": "0", "description": "R1471519 - ANTICUERPO MTOR (7C10) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471520 - ANTICUERPO ATG7 (D12B11) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471521 - ANTICUERPO FOSFO-ULK1 (SER555) (D1H4) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9595, "currency": "MXN" } } }, { "id": "0", "description": "R1471522 - ANTICUERPOS ATG14 (D1A1N) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471609 - CVIQI, ENZIMAS DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2104, "currency": "MXN" } } }, { "id": "0", "description": "R1471610 - ALUI (ALUMINIO), ENZIMA DE RESTRICCIÓN. CONCENTRACIÓN: 10.000 UNIDADES/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2050, "currency": "MXN" } } }, { "id": "0", "description": "R1471647 - TAQ DNA POLYMERASE WITH STANDARD TAQ BUFFER (5,000 UNITS/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7597, "currency": "MXN" } } }, { "id": "0", "description": "R1471672 - ENZIMA SPEI, RECOMBINANTE (10,000 U/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2050, "currency": "MXN" } } }, { "id": "0", "description": "R1471708 - BECLIN-1 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7739, "currency": "MXN" } } }, { "id": "0", "description": "R1471709 - ANTICUERPO FOSFO-ULK1 (SER757) (D7O6U) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9595, "currency": "MXN" } } }, { "id": "0", "description": "R1471710 - ANTICUERPO ULK1 (D8H5) RABBIT MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471711 - ANTICUERPO PROTEÍNA RIBOSOMAL FOSFO-S6 (SER240/244) (D68F8) XP ® RABBIT MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10641, "currency": "MXN" } } }, { "id": "0", "description": "R1471712 - ANTICUERPO PROTEÍNA RIBOSOMAL S6 (5G10) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471713 - ANTICUERPO FOSFO-4E-BP1 (THR37/46) (236B4) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9595, "currency": "MXN" } } }, { "id": "0", "description": "R1471714 - ANTICUERPOS 4E-BP1 (53H11) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8184, "currency": "MXN" } } }, { "id": "0", "description": "R1471715 - ANTICUERPO LC3B (E7X4S) XP® RABBIT MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9203, "currency": "MXN" } } }, { "id": "0", "description": "R1471716 - ANTICUERPO MTOR", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7739, "currency": "MXN" } } }, { "id": "0", "description": "R1471717 - ANTICUERPO FOSFO-MTOR (SER2448)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9020, "currency": "MXN" } } }, { "id": "0", "description": "R1471718 - ANTICUERPO PHOSPHO-ATG14 (SER29) (D4B8M) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10399, "currency": "MXN" } } }, { "id": "0", "description": "R1471719 - ANTICUERPO FOSFO-BECLIN-1 (SER30) (E1C4X) CONEJO MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10399, "currency": "MXN" } } }, { "id": "0", "description": "R1471720 - BAFILOMYCIN A1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2822, "currency": "MXN" } } }, { "id": "0", "description": "R1471721 - A-769662", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3520, "currency": "MXN" } } }, { "id": "0", "description": "R1471737 - ENDONUCLEASAS DE RESTRICCIÓN HAEIII (10.000 UNIDADES/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7815, "currency": "MXN" } } }, { "id": "0", "description": "R1471763 - ENZIMAS DE RESTRICCIÓN DE ALTA FIDELIDAD (SPEI-HF ®). (20.000 UNIDADES/ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 8416, "currency": "MXN" } } }, { "id": "0", "description": "R1471781 - ENZIMAS DE RESTRICCIÓN HPY188I, CONCENTRACIÓN: 10.000 UNIDADES/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2050, "currency": "MXN" } } }, { "id": "0", "description": "R1463628 - TAQMAN™ TAMRA PROBE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8530.27, "currency": "MXN" } } }, { "id": "0", "description": "R1464603 - TAQMAN™ CYP4A11. ENSAYOS DE EXPRESIÓN GÉNICA HS04194779_G1 FAM-MGB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1464604 - TAQMAN™ CYP4F2. ENSAYOS DE EXPRESIÓN GÉNICA HS00426608_M1 FAM-MGB", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1465346 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 52358.31, "currency": "MXN" } } }, { "id": "0", "description": "R1468730 - TAQMAN™ CYP4F3 TAQMAN GENE EXPRESSION ASSAYS HS01587860_MH", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7856.47, "currency": "MXN" } } }, { "id": "0", "description": "R1469225 - TAQMAN GENE EXPRESSION MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10936.66, "currency": "MXN" } } }, { "id": "0", "description": "R1469441 - TAQMAN™ UNIVERSAL MASTER MIX II, WITH UNG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 11383.05, "currency": "MXN" } } }, { "id": "0", "description": "R1469673 - TAQMAN™ GENOTYPING MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 2210.91, "currency": "MXN" } } }, { "id": "0", "description": "R1470371 - TAQMAN™ MGB PROBE (LABEL 5\" ,FAM™, VIC™, TET™, Y NED™ , 6-FAM™)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 21191.79, "currency": "MXN" } } }, { "id": "0", "description": "R1469676 - TAQMAN™ MGB PROBE (6-FAM™)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7306.19, "currency": "MXN" } } }, { "id": "0", "description": "R1468719 - TAQMAN™ MICRORNA REVERSE TRANSCRIPTION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9083.17, "currency": "MXN" } } }, { "id": "0", "description": "R1470887 - TAQMAN™ ARRAY, HUMAN CYP450 & OTHER OXYGENASES, FAST 96-WELL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5240.92, "currency": "MXN" } } }, { "id": "0", "description": "R1470892 - TAQMAN™ FAST ADVANCED, MEZCLA MAESTRA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11235, "currency": "MXN" } } }, { "id": "0", "description": "R1470894 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHR. ASSAY ID: HS00169233_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470895 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: AHRR. ASSAY ID: HS01005075_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470896 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: ARNT. ASSAY ID: HS01121918_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470897 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: CYP2J2. ASSAY ID: HS00356035_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470898 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: EPHX2. ASSAY ID: HS00932316_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2093.53, "currency": "MXN" } } }, { "id": "0", "description": "R1470899 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: KEAP1. ASSAY ID: HS00202227_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470901 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFE2L2. ASSAY ID: HS00975961_G1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470902 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARA. ASSAY ID: HS00947536_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470903 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: PPARG. ASSAY ID: HS01115513_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1470904 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1804538. GENE: TOP2A. ASSAY ID: C___7477997_20", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470905 - TAQMAN™ GENOTYPING ASSAY SNP ID:RS2236168. GENE: XDH. ASSAY ID: C__26435993_20", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470906 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS373455425. GENE: XDH. ASSAY ID: C_365253619_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470908 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS487121. GENE: MIR924HG. ASSAY ID: C___2313112_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470909 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS4987121. GENE: CBR3 ASSAY ID: C__43955396_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470910 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS1800566. GENE: NQO1. ASSAY ID: C___2091255_30", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9407.44, "currency": "MXN" } } }, { "id": "0", "description": "R1470911 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS2835286. GENE: CBR3-AS1. ASSAY ID: C__16075424_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470912 - TAQMAN™ GENOTYPING ASSAY SNP ID: RS3014216. GENE: AKR1A1. ASSAY ID: C__11869471_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1470913 - TAQMAN™ MATRIZ, NFKB HUMANA,", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 5286.89, "currency": "MXN" } } }, { "id": "0", "description": "R1470914 - TAQMAN™ MATRIZ, TRANSPORTADORES HUMANOS DE FÁRMACOS, RÁPIDO DE 96 POCILLOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5286.89, "currency": "MXN" } } }, { "id": "0", "description": "R1471561 - TAQMAN™ GTXPRESS™ MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19126.16, "currency": "MXN" } } }, { "id": "0", "description": "R1471562 - TAQMAN™ GENOTYPING ASSAY SNP RS1065411, GENE: GSTM1  ASSAY ID: C__44202997_20", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9407.44, "currency": "MXN" } } }, { "id": "0", "description": "R1471563 - TAQMAN™ SNP GENOTYPING ASSAY, HUMAN. SNP ID:RS1056806. GENE GSTM1, ASSAY ID: C_175674977_10.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1471565 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP: RS749174, GENE: GSTP1. ASSAY ID:C___3237199_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1471566 - TAQMAN™ SNP GENOTYPING ASSAY. ID SNP:RS762803, GENE: GSTP1, ASSAY ID: C___3237197_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8203.19, "currency": "MXN" } } }, { "id": "0", "description": "R1471613 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS4132601 GENE IKZF1. ASSAY ID: C__26019772_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15353.57, "currency": "MXN" } } }, { "id": "0", "description": "R1471614 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP RS2836371 GENE ERG. ASSAY ID: C__2439755_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15353.57, "currency": "MXN" } } }, { "id": "0", "description": "R1471615 - TAQMAN™PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS3731249. GENE CDKN2A . ASSAY ID: C__25611114_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15353.57, "currency": "MXN" } } }, { "id": "0", "description": "R1471618 - TAQMAN™ PRE-DESIGNED SNP GENOTYPING ASSAY, HUMAN. SNP: RS7090445 GENE ARID5B. ASSAY ID: C__30203240_10", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15353.57, "currency": "MXN" } } }, { "id": "0", "description": "R1471750 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELA. ASSAY ID: HS01042014_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1471751 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: RELB. ASSAY ID: HS00232399_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1471752 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: HUMAN. GENE: NFKB1. ASSAY ID: HS00765730_M1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } }, { "id": "0", "description": "R1471755 - TAQMAN™ GENE EXPRESSION ASSAY (FAM). TARGET SPECIES: RAT. GENE: AIF1. ASSAY ID: RN03993468_G1", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5136.69, "currency": "MXN" } } } ], "documents": [ { "id": "1", "title": "JUST_REACTIVOS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:20.951Z" }, { "id": "2", "title": "AT REACTIVOS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:22.691Z" }, { "id": "3", "title": "APPLIED.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:24.938Z" }, { "id": "4", "title": "NOT508.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:26.937Z" }, { "id": "5", "title": "NOT511.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:28.413Z" }, { "id": "6", "title": "NOT513.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:31.456Z" }, { "id": "7", "title": "EQUIVER.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:32.937Z" }, { "id": "8", "title": "NOT_MARIA_SOCORRO.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:34.704Z" }, { "id": "9", "title": "MAYIMEX.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:36.356Z" }, { "id": "10", "title": "QUIMILAB.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:38.008Z" }, { "id": "11", "title": "SILVERA.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:41.806Z" }, { "id": "12", "title": "NOROESTE.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:45.103Z" }, { "id": "13", "title": "ACCESORIOS .pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:46.808Z" }, { "id": "14", "title": "COMERCIALIZADORA.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:48.754Z" }, { "id": "15", "title": "VIRMEL.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:50.423Z" }, { "id": "16", "title": "UNIPARTS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:52.014Z" }, { "id": "17", "title": "BIOADVANCED.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:54.286Z" }, { "id": "18", "title": "ARAVEL.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:55.950Z" }, { "id": "19", "title": "INSUMOS Y ACCESORIOS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:57.575Z" }, { "id": "20", "title": "LAB-TECH.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:55:59.825Z" }, { "id": "21", "title": "VALANER.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:56:04.478Z" }, { "id": "22", "title": "NOT_PERKIN.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/e54f9441950f4df3a9a175ef8b37dfa2/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-09T20:56:06.980Z" } ] }, "awards": [ { "id": "1", "status": "active", "suppliers": [ { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV" } ], "value": { "amount": 1503346.08, "currency": "MXN" } }, { "id": "2", "status": "active", "suppliers": [ { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV" } ], "value": { "amount": 55248.77, "currency": "MXN" } }, { "id": "3", "status": "active", "suppliers": [ { "id": "EQUIVER SA DE CV", "name": "EQUIVER SA DE CV" } ], "value": { "amount": 88139.15, "currency": "MXN" } }, { "id": "4", "status": "active", "suppliers": [ { "id": "BIOSYSTEMS LIFESCIENCE SA DE CV", "name": "BIOSYSTEMS LIFESCIENCE SA DE CV" } ], "value": { "amount": 28344.81, "currency": "MXN" } }, { "id": "5", "status": "active", "suppliers": [ { "id": "ACCESORIOS PARA LABORATORIOS SA DE CV", "name": "ACCESORIOS PARA LABORATORIOS SA DE CV" } ], "value": { "amount": 965092.1, "currency": "MXN" } }, { "id": "6", "status": "active", "suppliers": [ { "id": "HIROSTECNOLOGIAS SA DE CV", "name": "HIROSTECNOLOGIAS SA DE CV" } ], "value": { "amount": 117338.66, "currency": "MXN" } }, { "id": "7", "status": "active", "suppliers": [ { "id": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA", "name": "MARIA SOCORRO DATHOLLI DE CIRIZA SOSA" } ], "value": { "amount": 1457052.8, "currency": "MXN" } }, { "id": "8", "status": "active", "suppliers": [ { "id": "MAYIMEX SA DE CV", "name": "MAYIMEX SA DE CV" } ], "value": { "amount": 243484, "currency": "MXN" } }, { "id": "9", "status": "active", "suppliers": [ { "id": "QUIMILAB SA DE CV", "name": "QUIMILAB SA DE CV" } ], "value": { "amount": 523765.95, "currency": "MXN" } }, { "id": "10", "status": "active", "suppliers": [ { "id": "PERKIN-ELMER DE MEXICO SA", "name": "PERKIN-ELMER DE MEXICO SA" } ], "value": { "amount": 452238.88, "currency": "MXN" } }, { "id": "11", "status": "active", "suppliers": [ { "id": "BIOADVANCED SYSTEMS SA DE CV", "name": "BIOADVANCED SYSTEMS SA DE CV" } ], "value": { "amount": 523291.87, "currency": "MXN" } }, { "id": "12", "status": "active", "suppliers": [ { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV" } ], "value": { "amount": 1048505.44, "currency": "MXN" } }, { "id": "13", "status": "active", "suppliers": [ { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV" } ], "value": { "amount": 1392941.92, "currency": "MXN" } }, { "id": "14", "status": "active", "suppliers": [ { "id": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV" } ], "value": { "amount": 1533164.47, "currency": "MXN" } }, { "id": "15", "status": "active", "suppliers": [ { "id": "LAB TECH INSTRUMENTACION SA DE CV", "name": "LAB TECH INSTRUMENTACION SA DE CV" } ], "value": { "amount": 61237.56, "currency": "MXN" } }, { "id": "16", "status": "active", "suppliers": [ { "id": "QUIMICA VIRMEL SA DE CV", "name": "QUIMICA VIRMEL SA DE CV" } ], "value": { "amount": 94540.75, "currency": "MXN" } }, { "id": "17", "status": "active", "suppliers": [ { "id": "INSUMOS Y ACCESORIOS CIENTIFICOS SA DE CV", "name": "INSUMOS Y ACCESORIOS CIENTIFICOS SA DE CV" } ], "value": { "amount": 16618.39, "currency": "MXN" } }, { "id": "18", "status": "active", "suppliers": [ { "id": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV", "name": "DISTRIBUIDORA QUIMICA Y HOSPITALARIA ARAVEL SA DE CV" } ], "value": { "amount": 178461.1, "currency": "MXN" } }, { "id": "19", "status": "active", "suppliers": [ { "id": "QUIMICA VALANER SA DE CV", "name": "QUIMICA VALANER SA DE CV" } ], "value": { "amount": 515150.2, "currency": "MXN" } }, { "id": "20", "status": "active", "suppliers": [ { "id": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV" } ], "value": { "amount": 612678.43, "currency": "MXN" } } ], "extensions": { "source": "ComprasMX", "canonical": "https://licitia.com.mx/adjudicacion/aa-12-ncz-012ncz001-n-97-2024", "license": "https://creativecommons.org/licenses/by/4.0/", "ocidPrefixRegistered": false } }