{ "html_url": "https://licitia.com.mx/licitacion/la-12-nck-012nck001-i-12-2026", "canonical": "https://licitia.com.mx/licitacion/la-12-nck-012nck001-i-12-2026", "id": "c71a8eb95d9c4038978bf59875bd806c", "procedure_number": "LA-12-NCK-012NCK001-I-12-2026", "file_number": "E-2026-00049647", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "description": { "short": null, "detailed": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN INVESTIGACIÓN" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO PARCIAL", "moved_at": "2026-06-27T01:31:46.019Z" }, "buyer": { "agency": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "acronym": "INNN", "branch": "12 - SALUD", "buying_unit": "DIRECCIÓN DE ADMINISTRACIÓN, SUBDIRECCIÓN DE RECURSOS MATERIALES", "requesting_unit": "unidad requiriente data", "requesting_group": "DIRECCIÓN DE ADMINISTRACIÓN, SUBDIRECCIÓN DE RECURSOS MATERIALES", "entity": "TESORERÍA DE LA FEDERACIÓN", "slug": "innn", "unit_slug": "direccion-de-administracion-subdireccion-de-recursos-materiales-012nck001" }, "classification": { "procedure_type": "LICITACIÓN PÚBLICA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "INTERNACIONAL ABIERTO", "fiscal_year": 2026, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": null, "exception_basis": null, "internal_control_number": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN INVESTIGA", "supply_source_number": null }, "schedule": { "published_at": "2026-05-15T19:55:17.000Z", "clarification_meeting_at": "2026-05-26T16:00:00.000Z", "clarification_questions_deadline_at": "2026-05-25T16:00:00.000Z", "clarification_responses_deadline_at": null, "bid_opening_at": "2026-06-04T16:00:00.000Z", "award_at": "2026-06-25T16:00:00.000Z", "estimated_contract_at": "2026-06-29T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO (S)-A-AMINO-3-HIDROXI-5-METIL-4-ISOXAZOLEPROPIÓNICO ((±)-AMPA) INHIBIDOR. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO D-ASPÁRTICO. FRASCO 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO CACODÍLICO ULTRAPURO PARA PREPARAR AMORTIGUADOR PARA MICROSCOPÍA ELECTRÓNICA. FRASCO 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO CÍTRICO MONOHIDRATADO. FRASCO 500G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO DIETILENTRIAMINOPENTA ACÉTICO (PUREZA MAYOR A 99%). FRASCO 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO IBOTÉNICO. FRASCO 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO IBOTÉNICO. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO KAÍNICO MONOHIDRATADO. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO KAÍNICO MONOHIDRATADO. FRASCO 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ÁCIDO META FOSFÓRICO GRADO REACTIVO. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ACIDO QUINORRINCO( ÁCIDO 2, 3-PIRIDINDICARBOXÍLICO). FRASCO 25 MG.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO RETINOICO, ALL TRANS. FRASCO 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO RETINOICO. FRASCO 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ÁCIDO 2-TIOBARBITÚRICO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO =98%, PELLETS (ANHIDRO). FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS BASE. FRASCO 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS BASE. REACTIVO ACS. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS-HCL. FRASCO 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS-HCL. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2´, 7´ DIACETILDICLOROFLUORESCEINA (DCFHDA). 5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2´,7´ DICLOROFLUORESCEÍNA DIACETATO. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-ARAQUIDONILGLICEROL. FRASCO 5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3-HIDROXIFLAVONA. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "5-IODOTUBERCIDINA. FRASCO DE 5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "ALIMENTO PROBIÓTICO EN GOTAS LACTOBACILLUS REUTERI PROTECTIS (BIOGAIA PROTECTIS) EN GOTAS. FRASCO DE 5 ML", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM251. ANTAGONISTA DEL RECEPTOR CANNABINOIDE (CB1). 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM630. AGONISTA INVERSO DEL RECEPTOR CANNABINOIDE 2 (CB2). 5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ANANDAMIDA. 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAYTRIL 0.5% SOLUCIÓN INYECTABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAYTRIL SOLUCIÓN ORAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BUPRENORFINA DE LIBERACIÓN PROLONGADA, USO ANIMAL. SUSPENSIÓN INYECTABLE 1.3 MG/ML. VIAL CON 3 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CEFOPERAZONA. FRASCO DE 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CIS-DIAMINODICLOROPLATINO (II). 200 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CISPLATINO SOLUCIÓN INYECTABLE INTRAVENOSA 50MG/50 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORANFENICOL 3% SOLUCION SPRAY - VIOLETA GENCIANA 0.15 % DE 63.2 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE PIOGLITAZONA (AGONISTA PPARS). 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE APOMORFINA R-(-)-HEMIHIDRATADO. FRASCO 250 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE MEFLOQUINA. 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE PROTRIPTILINA ESTÁNDAR FARMACEÚTICO DE REFERENCIA PARA ANÁLISIS POR ESPECTROMETRÍA DE MASAS (MS) O MATERIA PRIMA. FRASCO 200 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLLAGENASA B (0.195 U/MG LYO). 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENROFLOXACINA 10%. FRASCO 20 ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": "12", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTREPTOZOTOCINA. FCO 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GARAMICINA. FRASCO 2 ML", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICLAZIDA. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRATO DE ARAQUIDONIL-2'-CLOROETILAMIDA (ACEA). 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "LAQUINIMOD (ABR-215062; N-ETIL-N-FENIL-5-CLORO-1,2-DIHIDRO-4-HIDRO-1-METIL-2-OXO-3-QUINOLINA-CARBOXAMIDA). 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MALATO DE HIDRÓGENO MK-801. 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEGLUMINA DE FLUNIXIN (SOLUCIÓN INYECTABLE CON 50 MG VEHÍCULO C.B.P.1 ML). FRASCO ÁMPULA DE 250 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METFORMINA DE 500MG EN SOLUCIÓN CON JERINGA DOSIFICADORA DE 10 ML. FRASCO 150 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-ARAQUIDONOIL-SEROTONINA. 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NATAMICINA. FRASCO DE 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PARACETAMOL EN JARABE (3.2 GR/ 100 ML). FRASCO 120 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PD98059 (INHIBIDOR FARMACOLOGICO DE ERK). FRASCO 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PENTILENTETRAZOL. 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PENTOBARBITAL SÓDICO. SOLUCIÓN INYECTABLE. FÓRMULA, CADA 100 MILILITROS CONTIENEN PENTOBARBITAL SÓDICO 6.3 G, VEHÍCULO C.B.P. 100 ML", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": "19", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25901-1085", "specific_item_code": "25901", "cucop_description": "080.783.8206 SUSTANCIAS BIOLÓGICAS PEPSINA PARA HIBRIDACION IN SITU. SEIS PAQUETES DE 2 G. CADA UNO PARA PREPARAR 230 ML. DE SOLUCIÓN. JUEGO. RTC.", "description": "PEPSINA DE MUCOSA GÁSTRICA PORCINA. 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PIPERACILINA. FRASCO 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SAL DE MESILATO DE (R)-(+)-WIN 55,212-2 (25 MG)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SP600125 (INHIBIDOR FARMACOLOGICO DE JNK). FRASCO 50 MG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TAK-242/RESATORVID. 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TEMOZOLAMIDA CON UN 98% O MAS DE PUREZA. FRASCO 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TEMOZOLOMIDA, POLVO, =98% (HPLC). FRASCO 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "XILACINA 20MG/ML", "requested_quantity": "24", "minimum_quantity": "24", "maximum_quantity": "61", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI-S100B DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-5HT1A ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO PARA WB. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-5-HT-1B ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL DE CONEJO ANTI-A1R (RECEPTOR DE ADENOSINA 1). VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-A2AR (RECEPTOR DE ADENOSINA 2A). VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO, ANTI-ABHD6 DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACIONES EN INMUNIHISTOQUIMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-ACMSD, PRODUCIDO EN CONEJO, REACTIVIDAD PARA HUMANO Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ACTINA DE CONEJO O RATÓN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA PARA WB. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-ACTINA RATÓN 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE CONEJO ANTI-ADK (ADENOSINA CINASA). VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI- AIF DE HUMANO ANTICUERPO MONOCLONAL DE RATÓN. VIAL CON 200 µG/µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI-ANEXINA V CONJUGADO A ALEXA FLUOR 488 CON EXCITACIÓN/EMISIÓN: 495/519 PARA CITOMETRÍA DE FLUJO EN UNA SOLUCIÓN CON 25 MM HEPES, 140 MM NACL, 1 MM EDTA, PH 7.4, CON ALBÚMINA DE SUERO BOVINO (BSA) AL 0.1%  EN UNA SOLUCIÓN CON 25 MM HEPES, 140 MM NACL, 1 MM EDTA, PH 7.4, CON ALBÚMINA DE SUERO BOVINO (BSA) AL 0.1% (500 µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE RATÓN IGG2A ¿, ANTI-ASCL-1 DE RATA Y HUMANO. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI- ALFA SINUCLEÍNA ( 211) HUMANA HECHO EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA LOS RESIDUOS DE AMINOÁCIDOS 121-125 DE ALFASINUCLEINA HUMANA. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ALFASINUCLEINA NITRADA (SYN 514) HUMANA HECHA EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA LA ALFASINUCLEINA OXIDADA DE ORIGEN HUMANO. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ALFA SINUCLEINA FOSFORILADA (SERINA 129) HUMANA HECHA EN CONEJO (CLONA JB22-44, ISOTIPO IGG) QUE RECONOZC LA SERINA 129 (M-P-S(P)-E-E) DERIVADA DE LA ALFASINUCLEÍNA HUMANA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-ALFA-SINUCLEINA 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ATF4 (ACTIVATING TRANSCRIPTION FACTOR- 4). ANTICUERPO ANTI-ATF4 (ACTIVATING TRANSCRIPTION FACTOR- 4) ANTICUERPO MONOCLONAL HECHO EN RATÓN, PARA LA DETECCIÓN DE LA PROTEÍNA ACTIVATING TRANSCRIPTION FACTOR 4. PARA IF, WB, IP, IHC (P) Y ELISA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI ATPASA V O ANTI COMPLEJO V PRODUCIDO EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI ALFA TUBULINA DE HUMANO, RATA Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCIA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-ß-ACTINA ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN. IDENTIFICAN: RATA Y RATÓN, PARA WB E IHC. VIAL CON 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-BETA ACTINA, PRODUCIDO EN RATÓN, PARA RATÓN, RATA, HUMANO Y AVE 200 µG/ML EN PBS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI BCL-2 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI BDNF MONOCLONAL ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA BDNF. REACCIONA/DETECTA A LA PROTEÍNA BDNF DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI BECLINA-1 POLICLONAL DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI BETA CATENINA DE HUMANO Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCIA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI-B- GALACTOSIDASA DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CAMK2, C-TERMINAL PRODUCIDO EN CONEJO, POLICLONAL, IDENTIFICAN: RATA, RATÓN Y HUMANO, PARA WB E IHC. VIAL CON 1000 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CASPASA-3 ESCINDIDA (ASP175) HECHO EN CONEJO CON REACTIVIDAD EN HUMANO, RATA Y RATÓN. VIAL CON 300 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASPASA 3 ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA EN TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA. CONCENTRACIÓN 10 MG/ML . VIAL DE 6 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASPASA 9 ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA EN TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA. CONCENTRACIÓN 1 MG/ML. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CASPASA 9 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO CATALASA (ANTI-CATALASE).ESPECIE HUÉSPED: CONEJO  ESPECIES REACTIVAS:RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI RECEPTOR A CANNABINOIDE TIPO2 (CB2) DE HUMANO O RATA OBTENIDO EN CONEJO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-CCBL1/KAT1, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI- CD127 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA HIL-7R-M21 (RUO)) ACOPLADO A FICOERITRINA-CIANINA 7 (PE-CY7). VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD25 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA 2A3 (RUO (GMP)) ACOPLADO A ALOFICOCIANINA (APC). VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD25 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA BC96 (RUO)) ACOPLADO A FICOERITRINA (PE). VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HUMANO CD274 (B7-H1, PD-L1) MARCADO CON BRILLIANT VIOLET 421. VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD3 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA UCHT1 (RUO)) ACOPLADO A ALEXA FLUOR 488 (AF488). VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD4 ANTI-HUMANO MARCADO CON APC/CYANINE7. VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD4 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA RPA-T4 (RUO) ) ACOPLADO A ALOFICOCIANINA-CIANINA 7 (APC-CY7). VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD63 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA EL CD63 HUMANO. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD8 ANTI-HUMANO MARCADO CON PE. VIAL PARA 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD81 HUMANO HECHO EN RATÓN (ISOTIPO IGG2BK) QUE RECONOZCA LOS AMINOÁCIDOS 90-210 DE CD81 DE ORIGEN HUMANO. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CD9 DE HUMANO HECHO EN CONEJO (ISOTIPO IGG1) QUE RECONOZCA LOS RESIDUOS DE AMINOÁCIDOS 21-51 DE AMINOÁCIDOS DE LA REGIÓN N-TERMINAL DEL CD9 HUMANO. VIAL CON 400 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI- CDKN2A DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-CFOS, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN 1 MG /ML, LÍQUIDO EN BUFFER PBS 50% + GLICEROL 50%, ADICIONADO CON 0.035% DE AZIDA DE SODIO 1 MG /ML, LÍQUIDO EN BUFFER PBS 50% + GLICEROL 50%, ADICIONADO CON 0.035% DE AZIDA DE SODIO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYCLIN D1 (A-12) MOUSE MONOCLONAL 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI CISTEÍNA-GLUTAMATO LIGASA (GAMMA-GLUTAMILCISTEINA SINTASA-GCS) HECHA EN CONEJO PARA USO EN RATA, RATÓN Y HUMANO PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CMYC ANTIBODY 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI COX IV DE HUMANO, RATA Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCI Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-CYC E DE HUMANO.ANTICUERPO MONOCLONAL DE RATÓN. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-DISC-1 (B-2), PRODUCIDO EN RATÓN, PARA RATÓN, RATA Y HUMANO 200 µG/ML EN PBS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-DOBLECORTINA/DCX (E-6), PRODUCIDO EN RATON, PARA HUMANO, RATA Y RATÓN. 200 µG/ML. EN PBS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN, ANTI EAAT1 DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-EAAT1/GLAST, PRODUCIDO EN CONEJO, PARA RATA Y RATÓN, CONCENTRACIÓN APROX. 0.28 MG/ML, EN BUFFER PBS 1% Y GLICEROL 20% Y CONSERVADOR PROCLIN (0.025%) 300 CONCENTRACIÓN APROX. 0.28 MG/ML, EN BUFFER PBS 1% Y GLICEROL 20% Y CONSERVADOR PROCLIN (0.025%) 300. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE CONEJO ANTI-FAAH1 (AMIDA HIDROLASA DE ÁCIDOS GRASOS). VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO DE CONEJO PARA FACTOR NUCLEAR TIPO ERITORIDE 2 (INMUNOHISTOQUÍMICA) REACTIVO CON RATÓN, HUMANOS Y RATA. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI FERRITINA MONOCLONAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI FLUORESCEINA ALEXA FLUOR 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-FOSFOTIROSINA (Y1068) DEL RECEPTOR DE CRECIMIENTO EPIDÉRMICO (EGFR) DE CONEJO O RATÓN, MONOCLONAL, CON REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-GALECTINA 3 ANTICUERPO MONOCLONAL, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL GENERADO EN RATÓN DIRIGIDO A LA PROTEÍNA ÁCIDA FIBRILAR GLIAL (GFAP) DE HUMANO, RATA Y CONEJO. APLICACIÓN EN WB-WESTERN BLOTTING, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA Y CITOMETRÍA DE FLUJO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-GFAP EN RATÓN MONOCLONAL, REACTIVIDAD A HUMANO, RATA Y RATÓN PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-PROTEINA GLIAL FIBRILAR (GFAP), PRODUCIDO EN RATÓN, PARA HUMANO, RATÓN Y RATA, ACOPLADO A ALEXA FLUOR 488. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA GLIAL FIBRILAR ACÍDICA ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA PARA TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA,. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-GFAP¿, ANTICUERPO POLICLONAL PRODUCIDO EN POLLO, DIRIDO A DETECTAR GFAP EN RATA Y RATÓN, ÚTTIL EN WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA) E INMUNOFLUORESCENCIA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-GLICOPROTEÍNA P", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-GLUTAMINA SINTETASA, PRODUCIDO EN CONEJO, PARA RATA, RATÓN, PEZ ZEBRA, GATO, PERRO Y HUMANO, IGG1, CONCENTRACIÓN 1 MG/ML, COMPATIBLE PARA WB, ICC/IF, IHC-P  CONCENTRACIÓN 1 MG/ML, COMPATIBLE PARA WB, ICC/IF, IHC-P. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN, ANTI GLUA1 DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-GLUR2/AMPAR, PRODUCIDO EN RATÓN, ISOTIPO IGG1, KAPPA; PARA HUMANO, RATÓN, PRIMATES NO-HUMANOS, RATA LÍQUIDO, 0.5 MG/ML CON 0.1% DE AZIDA DE SODIO, PRODUCIDO PARA DETECTAR LOS AMINOÁCIDOS 175-430 DE LA REGIÓN N-TERMINAL DE GLUR2/AMPAR LÍQUIDO, 0.5 MG/ML CON 0.1% DE AZIDA DE SODIO, PRODUCIDO PARA DETECTAR LOS AMINOÁCIDOS 175-430 DE LA REGIÓN N-TERMINAL DE GLUR2/AMPAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-GRIN2A/NMDAR2A, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-GRIN2B/NMDAR2B, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTATIÓN PEROXIDASA ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA EN TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA. CONCENTRACIÓN 10 MG/ML. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HCN4", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL DE CONEJO PARA 4-HIDROXINONENAL (INMUNOHISTOQUÍMICA) REACTIVO CON RATÓN, PRIMANTES NO HUMANOS Y RATA CON CONCENTRACIÓN DE 1 MG/ML Y DIAMINOBENCIDINA COMO CROMÓFORO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO 4 HIDROXINONENAL. ANTICUERPO POLICLONAL DE CONEJO, PARA UTILIZARSE EN INMUNOHISTOQUIMICA EN TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA. CONCENTRACIÓN 1 MG/ML. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-HIF1 ALFA PRODUCIDO EN CONEJO, PARA RATA, RATÓN, HUMANO, CONEJO, BOVINO 0.42 MG/ML, LÍQUIDO EN PBS, 1% BSA, 20% GLICEROL, ADICIONADO CON CONSERVADOR 0.025% PROCLIN 300 0.42 MG/ML, LÍQUIDO EN PBS, 1% BSA, 20% GLICEROL, ADICIONADO CON CONSERVADOR 0.025% PROCLIN 300. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HIF-1 ALFA (HIPOXIC INDUCIBLE FACTOR -1 ALFA). ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN PARA USO EN ICC/ IF, WB, IHC-F, IHC-P, ELISA, PARA DETECTAR LA PROTEÍNA HIF-1ALFA DE ORIGEN HUMANO, DE RATÓN Y DE RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HIF PDH2 DE HUMANO ANTICUERPO MONOCLONAL DE RATÓN.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA HO-1. REACCIONA/DETECTA A LA PROTEÍNA HO-1 DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATON, ANTI IAP2 DE ORIGEN HUMANO Y RATÓN, CON APLICACIONES INMUNOFLUORESENCIA Y WESTERN BLOT. VIAL CON 200 µG/µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI IBA-1 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI IBA1 DE RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-IBA1 IGG, PRODUCIDO EN CONEJO, DIRIDO A DETECTAR IBA1 EN RATA Y RATÓN, SE UTILIZA EN WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA) E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL GENERADO EN EL CONEJO, DIRIGIDO A LA PROTEÍNA IBA1/AIF-1 DE HUMANO, RATA Y CONEJO. APLICACIÓN EN WB-WESTERN BLOTTING, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA Y CITOMETRÍA DE FLUJO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-IBA1/AIF-1, PRODUCIDO EN CONEJO, RECONOCE HUMANO, RATÓN, RATA , HÁMSTER Y MONO, ACOPLADO A ALEXA FLUOR 647. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-IBA1/AIF-1, PRODUCIDO EN CABRA, PARA HUMANO, RATÓN, RATA, PERRO, CERDO, CABALLO Y GATO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-IDO1, PRODUCIDO EN CONEJO, ISOTIPO IGG1, PARA RATÓN Y HUMANO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTIRATÓN IGD, PRODUCIDO EN RATA, ACOPLADO A BRILLIANT VIOLET 421, 0.2 MG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 488 RABBIT ANTI-GOAT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 568 RABBIT ANTI-GOAT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTICABRA, ESPECIES REACTIVAS: CABRA PARA WB", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A HRP, 0.15 MG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), DE ADSORCIÓN CRUZADA, PRODUCIDO EN POLLO, ACOPLADO A ALEXA FLUOR 594", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI CONEJO ACOPLADO A FITC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "162", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO PARA FLUORESCENCIA ANTI-CONEJO HECHO EN DONKEY LONGITUD DE ONDA 488", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR PLUS 647, 1MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CONEJO DE BURRO CONJUGADO CON VRDYE 490 (0.5 MG)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 405, 1MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 488, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "167", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO DE CABRA CONJUGADO CON ALEXA FLUOR 546, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "168", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO (H+L), FRAGMENTO F(AB')2 DE IGG, CONJUGADO AL FLUOROCROMO ALEXA FLUOR 555, PRODUCIDO EN CABRA, DIRIGIDO A CONEJO, ÚTIL PARA INMUNOFLUORESCENCIA, CITOMETRÍA DE FLUJO. FRASCO 250 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-RABBIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "170", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO CABRA ANTI-IGG DE CONEJO BIOTINILADO, VIAL DE 2 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "171", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A HRP LÍQUIDO EN PBS CON 0.75% BSA, 50% GLICEROL, PH7.3; VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "172", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "173", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "174", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON PEROXIDASA DE RABANO. APLICACIÒN EN WESTERN BLOT. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "175", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO HRP PARA WESTERN BLOT IGG H+L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "176", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI CONEJO ACOPLADO A CY3. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "177", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN POLLO, ACOPLADO A ALEXA FLUOR 594, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "178", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-IGG (H+L) DE CONEJO HECHO EN BURRO (ISOTIPO IGG1 ) ACOPLADO A PEROXIDASA DE RÁBANO PICANTE (HRP) PURIFICADO POR AFINIDAD,1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "179", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IGG ANTI-HUMANA (MOLÉCULA COMPLETA) MARCADA CON FOSFATASA ALCALINA, PRODUCIDA EN CABRA, 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "180", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO DE CABRA ANTI IG-G HUMANA. VIAL DE 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "181", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-HUMAN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "182", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-HUMAN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "183", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-POLLO IGY H&L, ACOPLADO AL FLUROCROMO ALEXA FLUOR 488 PREADSORBIDA. PRODUCIO EN CABRA, DIRIDO A POLLO, ÚTIL PARA WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA), INMUNOFLUORESCENCIA. FRASCO 500 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "184", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE POLLO CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "185", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE POLLO CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "186", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO IGG DE CABRA ANTI-RATA (H+L), FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "187", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-RAT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "188", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-RAT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "189", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IGG ANTI-RATA (MOLECULA COMPLETA)–ACOPLADA A FOSFATASA ALCALINA, PRODUCIDA EN CONEJO. VIAL CON 0.5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "190", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR 350, 1MG, DYLIGHT350", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "191", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN DE CABALLO, PEROXIDASA DE RÁBANO, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "192", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-MOUSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "193", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG, ACOPLADO A CY3, PRODUCIDO EN CABRA, DIRIGIDO A RATÓN, ÚTIL PARA ESTUDIOS DE INMUNOFLUORESCENCIA. FRASCO 2 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "194", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN (H+L), DE ADSORCIÓN CRUZADA DE IGG DE CABRA, ACOPLADO AL FLUOROCROMO CIANINA 5 (CY5). PRODUCIDO EN CABRA, DIRIGIDO A RATÓN, ÚTIL PARA WESTERN BLOT, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA. FRASCO 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "195", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO HECHO EN CABRA ANTI RATÓN PARA WB, 500 UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "196", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-RATÓN DE CABRA CONJUGADO CON VRDYE 490, 0.5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "197", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-MOUSE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "198", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE RATÓN CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "199", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE RATÓN CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "200", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN CONEJO, ACOPLADO A ALEXA FLUOR 568, 1MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "201", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI RATÓN ACOPLADO A CY3. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "202", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI RATÓN ACOPLADO A FITC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "203", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATON IGG1 ¿, CLON 4, UTIL PARA WESTERN BLOT Y INMUNOISTOQUIMICA EN PARAFINA PARA RATÓN, RATA Y HUMANO. VIAL 100UL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "204", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG1, ¿ RATÓN MARCADO CON PE. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "205", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG1, ¿ RATÓN MARCADO CON PERCP. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "206", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG2B, ¿ RATÓN MARCADO CON APC/CYANINE7. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "207", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG2B, ¿ RATÓN MARCADO CON BRILLIANT VIOLET 421. VIAL CON 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "208", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO IGM DE CABRA ANTI-RATÓN (H+L), FITC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "209", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IGM ANTI-HUMANA (ESPECIFICA CADENA µ ) MARCADA CON FOSFATASA ALCALINA, PRODUCIDA EN CABRA. 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "210", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IL-1 BETA ANTICUERPO POLICLONAL, IDENTIFICAN: RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "211", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI IL-6ANTICUERPO MONOCLONAL, ESPECIE REACTIVA: RATA, RATÓN PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "212", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI OXIDO NÍTRICO SINTASA INDUCIBLE (INOS) HECHO EN RATÓN MONOCLONAL, PARA USO EN RATÓN, RATA Y HUMANO PARA WESTERN BLOT E INMUNOFLUORESCENCIA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "213", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA KEAP1. REACCIONA/DETECTA A LA PROTEÍNA KEAP1 DE RATA, RATÓN Y HUMANO, PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "214", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-KINURENINA-3-MONOOXIGENASA REGIÓN N-TERMINAL, PRODUCIDO EN CONEJO, REACTIVIDAD PARA HUMANO, RATÓN, RATA, PERRO, CABALLO Y CONEJO 0.5 MG/ ML, EN BUFFER PBS 1X CON AZIDA DE SODIO (0.09% (P/V)) Y 2% DE SACAROSA 0.5 MG/ ML, EN BUFFER PBS 1X CON AZIDA DE SODIO (0.09% (P/V)) Y 2% DE SACAROSA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "215", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-KYNU, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN, 100 UL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "216", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI LACTOFERRITINA PRODUCIDO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "217", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-LAMP2, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN DIRIGIDO A LA SECUENCIA DE AMINOÁCIDOS 311-410 DE LA PROTEÍNA HUMANA LAMP2, EN BUFFER PBS CON 0.02% DE AZIDA DE SODIO, 0.05% BSA, + GLICEROL 50%. DIRIGIDO A LA SECUENCIA DE AMINOÁCIDOS 311-410 DE LA PROTEÍNA HUMANA LAMP2, EN BUFFER PBS CON 0.02% DE AZIDA DE SODIO, 0.05% BSA, + GLICEROL 50%. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "218", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-LC3A POLICLONAL DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "219", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-LC3B POLICLONAL DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "220", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO, ANTI-MAGL DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACIONES EN INMUNIHISTOQUIMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "221", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-MAP2, PRODUCIDO EN RATÓN, PARA RATA Y RATÓN ACOPLADO A ALEXA FLUOR 647 0.5 MG/ML, LÍQUIDO, EN BUFFER DE FOSFATOS CON AZIDA DE SODIO 0.09%, 100 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "222", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI PROTEÍNA ASOCIADA A MICROTUBULOS 2 NEURONALES (MAP2) HECHO EN RATÓN PARA USO EN RATÓN, RATA Y HUMANO PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "223", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO CONTRA PROTEÍNA BÁSICA DE MIELINA (MBP) HECHO EN CONEJO PARA USO EN RATÓN, RATA Y HUMANO PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "224", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI PROTEINA BÁSICA DE MIELINA DE HUMANO, RATA Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCIA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "225", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-MEGF10, PRODUCIDO EN CONEJO, PARA RATA, RATÓN Y HUMANO DIRIGIDO A LA SECUENCIA DE AMINOÁCIDOS 26-160 DE LA PROTEÍNA HUMANA MEGF10, EN BUFFER PBS CON 0.09% DE AZIDA DE SODIO + GLICEROL 50%. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "226", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-MERTK, PRODUCIDO EN CONEJO, PARA RATA, RATÓN Y HUMANO DIRIGIDO A LA SECUENCIA DE AMINOÁCIDOS 840-999 DE LA PROTEÍNA MERTK DE HUMANO, LÍQUIDO EN BUFFER PBS+GLICEROL 50% Y 0.02% DE AZIDA DE SODIO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "227", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI MOTOFUSINA-2 (MFN2) PRODUCIDO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "228", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-SUPEROXIDE DISMUTASE (MNSOD) REACTIVIDAD CON RATA Y RATON PARA WB E IHC. VIAL CON 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "229", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO CONTRA 3-MERCAPTOPIRUVATO (MPST) SULFURTRANSFERASA HECHO EN CONEJO PARA USO EN RATA PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "230", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTO-MTF-1 DE HUMANO. ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "231", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-NEUN, CLON A60, PRODUCIDO EN RATÓN, DIRIGIDO A DETECTAR EL NIVEL DE NEUN EN RATA Y RATÓN, VALIDADO PARA SU USO EN INMUNOHISTOQUÍMICA (PARAFINA), INMUNOFLUORESENCIA Y WESTERN BLOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "232", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI NEUN MONOCLONAL ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC. VIAL DE 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "233", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUEPO ANTI-NEUN (FOXO3) ANTICUERPO MONOCLONAL HECHO EN RATÓN, PARA IF, WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "234", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI NEUN DE RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "235", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI NUCLEO NEURONAL (NEUN) HECHO EN CONEJO PARA USO EN RATÓN, HUMANO Y RATA PARA INMUNOFLUORESCENCIAS Y WESTERN BOT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "236", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-NF¿B P65 (C-TERMINAL), PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN EN BUFFER DE FOSFATOS CON 0.09% DE AZIDA DE SODIO Y 0.2% DE GELATINA EN BUFFER DE FOSFATOS CON 0.09% DE AZIDA DE SODIO Y 0.2% DE GELATINA. VIAL CON 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "237", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA NRF2. REACCIONA/DETECTA A LA PROTEÍNA NRF2 DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "238", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-NMDAR2B (REGIÓN C-TERMINAL), PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN LIOFILIZADO, FROMULADO EN BUFFER 10MM HEPES (PH 7.5), 0.15M NACL, 0.1 MG/ML BSA Y 50% GLICEROL. LIOFILIZADO, FROMULADO EN BUFFER 10MM HEPES (PH 7.5), 0.15M NACL, 0.1 MG/ML BSA Y 50% GLICEROL. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "239", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-RATON CONTRA EL RECEPTOR N-METIL-D-ASPARTATO (NMDA) SUBUNIDAD 1. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "240", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-RECEPTOR NMDAR1 ANTICUERPO POLYCLONAL, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "241", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI NOS 1 NEURONAL, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "242", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI NOS 2 INDUCIBLE, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "243", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI NOS 3 ENDOTELIAL, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "244", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-NR1, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN, 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "245", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-RECEPTOR NMDAR2A (NR2A) ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "246", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO FACTOR NUCLEAR TIPO ERITROIDE 2 (ANTI-NRF2). ESPECIE HUÉSPED: CONEJO ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "247", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN CONTRA NURR1/NR4A2, UTIL PARA INMUNOPRECIPITACIÓN DE LA CROMATINA (CHIP) Y WESTERN BLOT PARA RATÓN, RATA Y HUMANO. VIAL 100UL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "248", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-PROTEÍNA ESPECÍFICA DE OLIGODENDROCITOS, HECHO EN CONEJO O RATÓN, REACTIVIDAD CONTRA HUMANO Y RATA, PARA CORTES DE TEJIDO FIJADOS E INCLUIDOS EN PARAFINA. VIAL CON 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "249", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL GENERADO EN RATÓN, DIRIGIDO A LA PROTEÍNA MARCADORA DE OLIGODENDROCITOS O4 DE HUMANO, RATA Y CONEJO (POLVO LIOFILIZADO). APLICACIÓN EN WB-WESTERN BLOTTING, INMUNOHISTOQUÍMICA E INMUNOFLUORESCENCIA. VIAL CON 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "250", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI ORNITINA DESCARBOXILASA PRODUCIDO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "251", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-P21 DE HUMANO. ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML.L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "252", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO ANTI P21 HECHO EN RATÓN MONOCLONAL, PARA USO EN RATÓN, RATA Y HUMANO PARA WESTERN BLOT E INMUNOFLUORESCENCIA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "253", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-P21 (CONTRA LA REGIÓN CARBOXILO TERMINAL) DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "254", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-P53 (CLONA DO-1) DE RATÓN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "255", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE CONEJO ANTI-PANEXINA 1. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "256", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI-PAX-6 HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATA, Y RATÓN, PARA USO EN WESTERN BLOT, INMUNOFLUORESCENCIA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "257", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-PCNA (PC10), PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN, 200 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "258", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HUMANO CD279 (PD-1) MARCADO CON PERCP. VIAL CON 500 UL (100 PRUEBAS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "259", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-PGC1A, PRODUCIDO EN CONEJO, PARA HUMANO, RATA, RATÓN, CERDO, CABRA, HAMSTER, OVEJA, ARDILLA, PERRO, CABALLO Y PRIMATES NO-HUMANOS. 1 MG/ML, LIBRE DE BSA, PRODUCIDO PARA DETECTAR LA PORCIÓN INTERNA (RESIDUOS 400-500) DE LA PROTEÍNA HUMANA PGC1-ALFA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "260", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI PPAR ALFA ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 200 UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "261", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI PPAR BETA-DELTA ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 200 UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "262", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI PPAR GAMMA ESPECIES REACTIVAS RATA, RATON PARA WB E IHC, 200 UG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "263", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI PROHIBITINA-2, PRODUCIDO EN CONEJO, REACTIVIDAD CONTRA HUMANO, RATA, RATÓN, PARA CORTES DE TEJIDO INCLUIDO EN PARAFINA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "264", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-PSD95 ANTICUERPO MONOCLONAL, ESPECIE REACTIVAS: RATA, RATÓN, PARA WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "265", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-PSD95 HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATÓN, Y RATA PARA USO EN WESTERN BLOT, INMUNOHISTOQUÍMICA, E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "266", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI PSD-95 DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "267", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-PSD95, PRODUCIDO EN CONEJO, PARA RATA, RATÓN Y HUMANO LÍQUIDO, EN AMORTIGUADOR 98.98% PBS, 1% BSA CON 0.02% DE AZIDA DE SODIO, PH: 7.4, 1 TUBO CON 0.9 - 1 MG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "268", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-PSTAT1 DE HUMANOANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "269", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-PSTAT3 DE HUMANO.ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "270", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI NO-RECEPTOR TIROCINA CINASA PYK2 PRODUCIDO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "271", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-QPRT, PRODUCIDO EN CONEJO, REACTIVIDAD PARA HUMANO, RATÓN Y RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "272", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-RBFOX3/NEUN , PRODUCIDO EN RATÓN, PARA HUMANO, RATÓN Y RATA, ACOPLADO A DYLIGHT350. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "273", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL RECOMBINANTE ANTI-REELINA DE HUMANO, RATA, RATÓN OBTENIDO EN CONEJO, PARA USO EN WESTERN BLOT, INMUNOHISTOQUÍMICA, CITOMETRÍA DE FLUJO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "274", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-TDP-43 MONOCLONAL FOSFORILADO (S409/410) DE CONEJO, PARA INMUNOHISTOQUIMICA EN BLOQUES DE PARAFINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "275", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI SDF-1 (STROMAL CELL DERIVED FACTOR 1, SINÓNIMO CXCL12) ANTICUERPO MONOCLONAL HECHO EN RATÓN, PARA LA DETECCIÓN ESPECÍFICA DE LA PROTEÍNA SDF-1ALFA Y BETA DE RATÓN, RATA Y HUMANO POR IF, WB E IHC. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "276", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-SHH), PRODUCIDO EN RATÓN, PARA RATÓN, RATA, HUMANO Y AVE 200 µG/ML EN PBS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "277", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-SINAPTOFISINA (CLONA YE269) HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATÓN, Y RATA PARA USO EN WESTERN BLOT, INMUNOHISTOQUÍMICA, E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "278", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-SINAPTOFISINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "279", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-SINAPTOFISINA, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "280", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN CONEJO, ANTI-SLUG DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACOINES EN INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "281", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CABRA, ANTI-SNAI1 DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACIONES EN INMUNIHISTOQUIMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "282", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-SUPEROXIDO DISMUTASA (CU/ZN) REACTIVIDAD RATA Y RATÓN PARA WB E IHC, 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "283", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO SUPERÓXIDO DISMUTASA 1 (ANTI-SUPEROXIDE DISMUTASE 1). ESPECIE HUÉSPED: CONEJO ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "284", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA SOD-CU/ZN (SOD1). REACCIONA/DETECTA A LA PROTEÍNA SOD-CU/ZN (SOD1) DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "285", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA SOD-MN (SOD2). REACCIONA/DETECTA A LA PROTEÍNA SOD-MN (SOD2) DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOHISTOQUÍMICA, ELISA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "286", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-SQSTM1/P62 POLICLONAL DE CONEJO REACTIVO PARA HUMANO Y RATA. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "287", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-STAT1 DE HUMANO.ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "288", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-STAT3 DE HUMANO.ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "289", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL ANTI-TBR-1 DE RATÓN, HUMANO Y RATA OBTENIDO EN CONEJO, PARA USO EN WESTERN BLOT E INMUNOHISTOQUIMICA. VIAL CON 100 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "290", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-TIGAR DE HUMANO ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "291", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO POLICLONAL PURIFICADO POR AFINIDAD ANTI-TIROSINA HIDROXILASA HECHO EN CONEJO, PRESENTACIÓN LÍQUIDA EN BUFFER CON 10 MM HEPES, 150 MM NACL, PH 7.5, 100 µG POR ML BSA Y 50% GLICEROL. VIAL CON150 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "292", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-TIROSINA HIDROXILASA 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "293", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MARCADOR DE MICROGLÍA ANTI ANTI-TMEM119 PRODUCIDO EN CONEJO O RATÓN, REACTIVIDAD CONTRA HUMANO, RATÓN, PARA CORTES DE TEJIDO FIJADOS E INCLUIDOS EN PARAFINA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "294", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-TNF-A ANTICUERPO MONOCLONAL, ESPECIES REACTIVAS: RATA, RATÓN, HUMANO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "295", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI TOMM20 PRODUCIDO EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "296", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI TRIPTASA MURINO. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "297", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-TRPV1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "298", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-TUBULINA RATÓN 200 µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "299", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-UNC5H1/UNC5A, PRODUCIDO EN CONEJO, PARA HUMANO, RATÓN Y RATA 1 MG/ML, LÍQUIDO EN BUFFER PBS, PH 7.4, 150MM NACL, 0.02% AZIDA DE SODIO Y 50% GLICEROL. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "300", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-UNC5H3 (F-4), PRODUCIDO EN RATÓN, PARA RATÓN, RATA Y HUMANO 200 µG/ML EN PBS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "301", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-VDAC1 DE HUMANO.ANTICUERPO MONOCLONAL DE RATÓN. VIAL DE 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "302", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-VDCA1 MONOCLONAL DE RATÓN 200µG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "303", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN CONEJO, ANTI-ZEB1 DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACOINES EN INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "304", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO (ACOPLADO A FLURÓFORO VERDE), 200 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "305", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA DE CABRA ANTI-IGG DE RATÓN (H+L), 1.5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "306", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONJUGADO DE ESTREPTOAVIDINA-PEROXIDASA DE RÁBANO. VIAL CON 2 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "307", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DL-ALFA-ÁCIDO LIPOICO =98.0%, 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "308", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "ACRÍLICO DENTAL AUTOCURABLE NO. 66 C (35G)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "309", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "MONÓMERO PARA ACRÍLICO DENTAL AUTOCURABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "310", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "ACRÍLICO DENTAL AUTOPOLIMERIZABLE DE SECADO RÁPIDO, LÍQUIDO, MONÓMERO. FRASCO 950 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "311", "cucop_code": "25901-1853", "specific_item_code": "25901", "cucop_description": "080.831.0163 REACTIVOS QUÍMICOS AGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "description": "AGAROSA DE BAJO PUNTO DE FUSIÓN, 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "312", "cucop_code": "25901-1853", "specific_item_code": "25901", "cucop_description": "080.831.0163 REACTIVOS QUÍMICOS AGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "description": "AGAROSA REACTIVO, PARA BIOLOGÍA MOLECULAR. FRASCO 100 G", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "7", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "313", "cucop_code": "25901-1853", "specific_item_code": "25901", "cucop_description": "080.831.0163 REACTIVOS QUÍMICOS AGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "description": "AGAROSA, GRADO BIOLOGÍA MOLECULAR. PRESENTACIÓN DE 500G PARA ELECTROFORESIS. FRASCO 500G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "314", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "AGUA INYECTABLE ESTÉRIL. CAJA/100 AMPOLLETAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "315", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-ARAQUIDONILGLICEROL. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "316", "cucop_code": "25901-1364", "specific_item_code": "25901", "cucop_description": "080.829.0270 REACTIVOS QUÍMICOS AZUL DE BRENTENOL. FRASCO CON 25 G. TA.", "description": "AZUL DE TIAZOLIL BROMURO DE TETRAZOLIO PUREZA GRADO HPLC POLVO. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "317", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "BOROHIDRURO DE SODIO =98.0%, 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "318", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BROMHIDRATO DE GALANTAMINA, 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "319", "cucop_code": "25901-1862", "specific_item_code": "25901", "cucop_description": "080.831.3241 REACTIVOS QUÍMICOS BROMURO DE ETIDIO (BROMURO DE 7-DIAMINO-10-ETIL-9-FENIL-FENENTRIDINIO). GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 G. TA.", "description": "SOLUCIÓN DE BROMURO DE ETIDIO (10 MG/ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "320", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE CARGA PARA ADN CON COLORANTE AZUL DE BROMOFENOL 10X. CAJA CON TRES TUBOS DE 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "321", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-ACETIL-L-CISTEÍNA (PUREZA MAYOR A 98%), 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "322", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOZAPINE-D4 (ESTANDAR ANALÍTICO PARA LC/MS). VIAL 500µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "323", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE APOMORFINA HEMIHIDRATO, 250 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "324", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORHIDRATO DE MEMANTINA, 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "325", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORHIDRATO PF-04859989, INHIBIDOR DE KINURENINA AMINOTRANSFERASA II, 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "326", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "COLLAGENASA B (0.195 U/MG LYO), 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "327", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONTROL CRISPR PLÁSMIDO DE ACTIVACIÓN. VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "328", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONTROL SHRNA PLASMIDO A. VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "329", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONTROL SIRNA A. VIAL 10 µM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "330", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONTROL SIRNA A CONJUGADO CON FLUORESCEINA. VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "331", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIACETATO DE 2',7'-DICLOROFLUORESCEÍNA, DIACETILDICLOROFLUORESCEÍNA. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "332", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "N,N-DIMETIL 4 NITROSOANILINA 97%, 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "333", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DISULFURO DE 3-CARBOXI-4-NITROFENILO. =98% GRADO REACTIVO, 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "334", "cucop_code": "25901-1954", "specific_item_code": "25901", "cucop_description": "080.832.4149 SUSTANCIA BIOLÓGICAS DNA POLIMERASA DE THERMUS AQUATICUS. (TAQ-POLIMERASA) RECOMBINANTE. GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 UNIDADES/MICROLITRO. C (-20 °C 0 °C).", "description": "DNA POLIMERASA TIPO PWO. ENZIMA CON ALTA PROCESIVIDAD 5´- 3´. SIN ACTIVIDAD ENDONUCLEASA 5´-3´. ENZIMA COMPATIBLE CON NUCLEÓTIDOS MODIFICADOS. VIAL 100U.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "335", "cucop_code": "25901-0809", "specific_item_code": "25901", "cucop_description": "080.610.2877 SUSTANCIA BIOLÓGICAS DESOXINUCLEOSIDOS TRIFOSFATADOS (DATP, DTTP, DCTP Y DGTP). GRADO BIOLOGIA MOLECULAR. JUEGO DE FRASCOS INDIVIDUALES DE 100 MICROMOLES EN 10 ML. FRASCO CON 10 ML. C (-20 °C).", "description": "DNTP MEZCLA. CAJA C/10 MM C/UNO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "336", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS DE E.COLI QUÍMICAMENTE COMPETENTES CEPA DH5A (DH5A COMPETENT CELLS), ALTA EFICIENCIA, LÍQUIDO. 10 X 100 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "337", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS DE E.COLI QUÍMICAMENTE COMPETENTES CEPA STBL3 (STBL3 COMPETENT CELLS), ALTA EFICIENCIA, LÍQUIDO. 21 X 50 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "338", "cucop_code": "25901-1565", "specific_item_code": "25901", "cucop_description": "080.829.4433 SUSTANCIA BIOLÓGICAS ENZIMA DE RESTRICCION HIND III ENDONUCLEASA DE HEMOPHILUS INFLUENZAE RD. FRASCO CON 500 U. CTC. (-20 °C).", "description": "ENZIMA DE RESTRICCIÓN HINDIII (HINDIII RESTRICTION ENZYME), LÍQUIDO A 10 U/µL. 10,000 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "339", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "N-ETILMALEIMIDA (CRISTALINA CRYSTALLINE, =98%). FRASCO 5 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "340", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA DE REACCIÓN CON COLORANTE EVAGREEN PARA TÉCNICA HRM . FRASCO 5ML AL 2X. FRASCO 5ML 2X.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "341", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXONUCLEASA T O ARNSA T (EXONUCLEASE T, RNASE T), LÍQUIDO A 5,000 UNIDADES/ML, 1250 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "342", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXONUCLEASA DEPENDIENTE DE FOSFATO 5' (5'-PHOSPHATE-DEPENDENT EXONUCLEASE), LÍQUIDO A 1 U/µL, 40 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "343", "cucop_code": "25901-1928", "specific_item_code": "25901", "cucop_description": "080.832.0535 REACTIVOS QUÍMICOS REACTIVO DE FENOL. REACTIVO PREPARADO SEGUN FOLIN -CIOCALTEU. FRASCO CON 500 ML. TA.", "description": "REACTIVO DE FENOL DE FOLIN Y CIOCALTEU. ADECUADO PARA LA DETERMINACIÓN DE PROTEÍNA TOTAL POR EL MÉTODO DE LOWRY 2N. 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "344", "cucop_code": "25901-1928", "specific_item_code": "25901", "cucop_description": "080.832.0535 REACTIVOS QUÍMICOS REACTIVO DE FENOL. REACTIVO PREPARADO SEGUN FOLIN -CIOCALTEU. FRASCO CON 500 ML. TA.", "description": "SOLUCIÓN MONOFÁSICA DE FENOL E ISOTIOCIANATO DE GUANIDINA DISEÑADA PARA AISLAR FRACCIONES SEPARADAS DE ARN, ADN Y PROTEÍNAS A PARTIR DE MUESTRAS DE CÉLULAS Y TEJIDOS DE ORIGEN HUMANO, ANIMAL, VEGETAL, BACTERIANO O PROCEDENTES DE LEVADURA, EN EL PLAZO DE UNA HORA. PURIFICA DE FORMA FIABLE EL ARN A PARTIR DE MÚLTIPLES FUENTES Y VOLÚMENES DE MUESTRA COMO CON PEQUEÑAS CANTIDADES DE TEJIDO (50–100 MG) Y CÉLULAS (5 × 106), ASÍ COMO CON GRANDES CANTIDADES DE TEJIDO (=1 G) Y CÉLULAS (>107). REACTIVO QUE MANTIENE LA INTEGRIDAD DEL ARN GRACIAS A LA INHIBICIÓN ALTAMENTE EFICAZ DE LA ACTIVIDAD DE ARNASA, AL TIEMPO QUE DESTRUYE LAS CÉLULAS Y DISUELVE LOS COMPONENTES CELULARES DURANTE LA HOMOGENEIZACIÓN DE MUESTRAS. FRASCO 100 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "345", "cucop_code": "25901-1928", "specific_item_code": "25901", "cucop_description": "080.832.0535 REACTIVOS QUÍMICOS REACTIVO DE FENOL. REACTIVO PREPARADO SEGUN FOLIN -CIOCALTEU. FRASCO CON 500 ML. TA.", "description": "SOLUCIÓN FENOLICA FOLIN-CIOCALTEU 2M. FRASCO DE 500ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "346", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GEL ROJO PARA TINCIÓN DE ÁCIDOS NUCLEICOS EN GEL 10, 000X, 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "347", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GLUCOSA 6 FOSFATO DESHIDROGENASA DE S.CEREVISIAE TIPO VII EN SUSOENSION DE SULFATO DE AMONIO =200 UNITS/MG PROTEIN, 250 U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "348", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HISTIDINA =99% (TLC). 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "349", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "L-HISTIDINA. FRASCO 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "350", "cucop_code": "25901-1434", "specific_item_code": "25901", "cucop_description": "080.829.1039 REACTIVOS QUÍMICOS COLORANTE HOECHST 33258. FRASCO CON 500 MG. TA.", "description": "HOECHST 33258, SOLUCIÓN ACUOSA 1 MG/ML, <98%. VIAL CON 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "351", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE MEZCLA DE REACCIÓN CON TAQ POLIMERASA HOTSTAR TAQ (1000 U)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "352", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HIPOCLORITO DE SODIO 5%, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "353", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INHIBIDOR DE KINURENINA 3-MONOOXIGENASA, RO 61-8048, POLVO, =98% (HPLC) SINÓNIMO: 3,4-DIMETOXI-N-[4-(3-NITROFENIL)-2-TIAZOLIL]-BENZENOSULFONAMIDA, 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "354", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COCTEL INHIBIDOR DE FOSFATASAS EN TABLETAS. FRASCO CON 20 PASTILLAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "355", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COCTEL DE INHIBIDORES DE PROTEASAS, SOLUCIÓN EN DMSO, PARA LA INHIBICIÓN DE SERIN PROTEASAS, CISTEIN PROTEASAS, PROTEASAS ACIDAS Y AMINOPEPTIDASAS, PARA SU USO EN CÉLULAS DE MAMÍFEROS Y EXTRACTOS DE TEJIDO. FRASCO CON 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "356", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COCTEIL INHIBIDOR DE PROTEASAS 100X, 5 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "357", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COCKTAIL INHIBIDOR DE PROTEASAS EN TABLETAS COMPRIMIDAS CON EDTA 1MM. CAJA CON 30 TABLETAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "358", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-KINURENINA (PUREZA MAYOR A 98% GRADO HPLC), 1 G", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "359", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KLOTHO PLÁSMIDO SHRNA (H). VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "360", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA). VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "361", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KLOTHO SIRNA (H). VIAL 10 µM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "362", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CALDO LURIA (CALDO LB), MEDIO DE ENRIQUECIMIENTO ESPECIALMENTE PARA ESCHERICHIA COLI, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "363", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CALDO LB CON AGAR LENNOX, MEDIO NUTRICIONALMENTE RICO PARA EL CRECIMIENTO Y MANTENIMIENTO DE CULTIVOS PUROS DE CEPAS RECOMBINANTES DE E.COLI, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "364", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIMPIADOR DE RNASAS ÚTIL PARA DESNATURALIZAR AGENTES, INACTIVAR RÁPIDAMENTE LAS RNASAS, DNASAS, EL RNA Y DNA. MÉTODO MÁS FÁCIL Y EFICAZ PARA QUITAR RÁPIDAMENTE LA CONTAMINACIÓN POTENCIAL. BOTELLA ESPRAY 475ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "365", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOPOLISACARIDOS DE ESCHERICHIA COLI O111:B4, 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "366", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOPOLISACÁRIDO DE E. COLI LIOFILIZADO, 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "367", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOPOLISACARIDO DE E. COLI, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "368", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOPOLISACÁRIDO DE ESCHERICHIA COLI O111:B4. PURIFICADO POR EXTRACCIÓN FENOL. FRASCO 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "369", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MALEATO DE HIDRÓGENO MK-801, 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "370", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "MANNITOL. FRASCO DE 250 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "371", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTANDÀR DE PESO MOLECULAR DE DNA DE 1KB, 500 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "372", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE DNA, DE 100 A 2000 PARES DE BASES, 100 APLICACIONES. VIAL DE 250 µG (1 µG/µL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "373", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE ADN DE 100 PARES DE BASES CON 1 ML TAMPÓN DE CARGA 10X, 500 µL", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "374", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA PCR MEZCLA MAESTRA, 200 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "375", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA DE PCR EN TIEMPO REAL SYBR™ GREEN DISEÑADA PARA RAPIDA VELOCIDAD, FIABLE Y ECONÓMICA PARA APLICACIONES DE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) EN TIEMPO REAL. EL VIAL DE 1 ML DE LA MEZCLA 2X CONTIENE COLORANTE SYBR™ GREEN 1, ADN POLIMERASA RÁPIDA LD AMPLITAQ GOLD™, MEZCLA DE DNTPS CON DUTP/DTTP, REFERENCIA PASIVA 1 Y COMPONENTES DE TAMPÓN OPTIMIZADOS. 100 REACCIONES EN UN VOLUMEN TOTAL DE 20 µL. ALMACENAR A -5-30 °C. VIAL CON 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "376", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA UNIVERSAL TAQMAN PARA PCR, 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "377", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROPERLAS DE SEPARACIÓN MAGNÉTICA PARA AISLAMIENTO DE CÉLULAS CD11B+ (MICROGLÍAS) DE RATÓN Y DE HUMANO PARA 1X10E08 CÉLULAS TOTALES, COMPATIBLES PARA COLUMNAS DE SEPARACIÓN MAGNÉTICA TIPO LS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "378", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROPERLAS DE SEPARACIÓN MAGNÉTICA PARA AISLAMIENTO DE CÉLULAS GLAST+ (ASTROCITOS) DE RATÓN Y DE HUMANO PARA 5X10E07 CÉLULAS TOTALES, COMPATIBLES PARA COLUMNAS DE SEPARACIÓN MAGNÉTICA TIPO LS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "379", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "NICOTINA 99% LÍQUIDA, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "380", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NICOTINA. FRASCO 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "381", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLANZAPINE-D8 (ESTANDAR ANALÍTICO PARA LC/MS). VIAL 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "382", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CEBADOR OLIGO 5'D PO4 [(T)12-18] 3', (0.5 µG/µL), 50 µL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "383", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENCIA DE OLIGONUCLEÓTIDO (27-MERO) TOMM40F: 5´-GTTTTAGGGTAGAAGGATAGGTAAAGG-3´", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "384", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENCIA DE OLIGONUCLEÓTIDO (25-MERO) TOMM40R: 5´-AACACTCTAAAAAAAACCAACACTT-3´* MARCADO CON BIOTINA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "385", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENIA DE OLIGONUCLEÓTIDO PARA SECUENCIAR (16-MERO) TOM-S1:5´- TTTGGTTAGGAGTAGT-3´", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "386", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONCULEÓTIDO (20MERO) F-RS10542523:5´FAM-TGA CCT CAA GCTGTC CTC TT-3´", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "387", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONCULEÓTIDO (18MERO) R-RS10542523:5´-TGG GCT GCC TTT TCAAGC-3, CT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "388", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHF; 5´-56FAM ATGAAG GCC TTC GAG TCC CTC AAG TCC TTC-3'", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "389", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHR; 5´GGC GGT GGC GGC TGT TGC TGC TGC TGC TGC - 3´", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "390", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEOTIDOS HDL_FWD 5'-GCTCCGAAGCTTCCTTATGGCACTGGACTGAC-3'", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "391", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEOTIDOS HDL_RVS 5'-GATGCGTCTAGAGTTCCCTGTGTTGCCTGCTG-3'", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "392", "cucop_code": "25901-1921", "specific_item_code": "25901", "cucop_description": "080.832.0469 REACTIVOS QUÍMICOS PERCOLL. FRASCO CON 25 ML. RTC.", "description": "PERCOLL, 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "393", "cucop_code": "25901-1921", "specific_item_code": "25901", "cucop_description": "080.832.0469 REACTIVOS QUÍMICOS PERCOLL. FRASCO CON 25 ML. RTC.", "description": "PERCOLL, MEDIO CLÁSICO PARA CENTRIFUGACIÓN EN GRADIENTE DE DENSIDAD DE CÉLULAS, VIRUS Y PARTÍCULAS CELULARES. PERCOLL CONSISTE EN PARTÍCULAS DE SÍLICE COLOIDAL DE 15– 30 NM DE DIÁMETRO (23% P/P EN AGUA) QUE HAN SIDO RECUBIERTAS CON POLIVINILPIRROLIDONA (PVP). LA PVP HACE QUE EL PRODUCTO SEA COMPLETAMENTE ATÓXICO E IDEAL PARA UTILIZAR CON MATERIALES BIOLÓGICOS. FRASCO DE 25 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "394", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERLAS MAGNÉTICAS PARA SELECCIÓN DE ADN POR TAMAÑOS (SPRI MAGNETIC SIZE SELECTION BEADS), 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "395", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERLAS MAGNÉTICAS DE ESTREPTAVIDINA (STREPTAVIDIN MAGNETIC BEADS), LÍQUIDO, 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "396", "cucop_code": "25901-1865", "specific_item_code": "25901", "cucop_description": "080.831.3274 REACTIVOS QUÍMICOS PERSULFATO DE AMONIO. GRADO BIOLOGIA MOLECULAR. FRASCO CON 100 G. TA.", "description": "PERSULFATO DE AMONIO, 10 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "397", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA PCR PIROMARK DE 200 REACCIONES. MEZCLA MAESTRACONCENTRADA 10X QUEINCLUYE ADN POLIMERASAHOTSTARTAQ Y TAMPÓN DEREACCIÓN OPTIMIZADO QUECONTIENE MGCL2 3 MM Y DNTP, 200 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "398", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PLÁSMIDO CRISPR DE ACTIVACIÓN (H) KLOTHO. VIAL CON 20 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "399", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA PCR CUANTITATIVA EN TIEMPO (RT-QPCR SYB) DE UN SOLO PASO CON MMLV Y ADN POLIMERASA TAQ DE ARRANQUE. KIT PARA MUESTRAS DE 5 X 24", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "400", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "RESINA ACRÍLICA DENTAL AUTOCURABLE, 500G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "401", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RISPERIDONE-D4 (ESTANDAR ANALÍTICO PARA CROMATOGRAFÍA DE LÍQUIDOS (LC)/MS) , VIAL DE 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "402", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "RNASA A, 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "403", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-SERINA (PUREZA MAYOR A 98%), 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "404", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE PERMEABILIZACIÓN 10X PARA USO EXCLUSIVO DE CITOMETRÍA (SOLUCIÓN DE <15% FORMALDEHIDO AND <50% DIETILENGLICOL Y AGENTE PERMEABILIZANTE), 500 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "405", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE RESGUARDO DE RNA, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "406", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN ESTABILIZADORA Y DE ALMACENAMIENTO DE RNA Y PARA COLECCIÓN DE TEJIDOS. REACTIVO PARA ALMACENAMIENTO ACUOSO DE TEJIDOS, PARA ESTABILIZAR Y PROTEGER RNA DE ESPECÍMENES FRESCOS, EVITANDO DEGRADACIÓN DEL RNA. FRASCO 250ML (RNA/LATER)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "407", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN SALINA INYECTABLE. CAJA/100 AMPOLLETAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "408", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA MARCADORA DE MITOCONDRIA BASE DE ROSAMINA Y CARBOCYANINA EN VERDE. CAJA C/10 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "409", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA TAQMAN PARA ABHD6 ESPECIE: RATA. VIAL CON 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "410", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA TAQMMAN PARA DNMT1, ESPECIE: RATA. VIAL CON 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "411", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA TAQMMAN PARA DNMT3B, ESPECIE: RATA. VIAL CON 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "412", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA TAQMMAN PARA TET1, ESPECIE: RATA. VIAL CON 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "413", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONDA TAQMMAN PARA TET2, ESPECIE: RATA. VIAL CON 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "414", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TINCIÓN DE ÁCIDO NUCLEICO FLUORESCENTE VERDE SYTO 9. COMPUESTO FLUORESCENTE CON UN PICO DE EXCITACIÓN A 483 NM Y UN PICO DE EMISIÓN A 500 NM. VIAL 100UL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "415", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAMPÓN DE UNIÓN DE ANEXINA (5X) PARA CITOMETRÍA DE FLUJO, (SOLUCIÓN ESTÉRIL Y FILTRADA DE 50 MM DE HEPES, 700 MM DE NACL, 12,5 MM DE CACL2, PH 7,4); (ANNEXIN V BINDING BUFFER). 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "416", "cucop_code": "25901-1954", "specific_item_code": "25901", "cucop_description": "080.832.4149 SUSTANCIA BIOLÓGICAS DNA POLIMERASA DE THERMUS AQUATICUS. (TAQ-POLIMERASA) RECOMBINANTE. GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 UNIDADES/MICROLITRO. C (-20 °C 0 °C).", "description": "ADN POLIMERASA TAQ, RECOMBINANTE (5 U/µ L), 500 UNIDADES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "417", "cucop_code": "25901-1868", "specific_item_code": "25901", "cucop_description": "080.831.3340 REACTIVOS QUÍMICOS TEMED (N N N N-TETRAMETILETILENDIAMINO). PUREZA MÍNIMO DEL 99%. FRASCO CON 50 ML. TA.", "description": "TEMED, 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "418", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE CDNA DE REVERSA TRANSCRIPCIÓN DE ALTA CAPACIDAD, 50 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "419", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRANSCRIPTASA INVERSA, LÍQUIDO A 200 U/µL. 10,000 UNIDADES (10,000 U)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "420", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TRANSCRIPTASA INVERSA M-MLV (200 U/µ L); TAMPÓN DE PRIMERA CADENA 5X, 1 ML; DTT, 500 µL (100 MM). CAJA/ 200 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "421", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT TRANSCRIPTOR COMPLETO PARA SÍNTESIS DE ADNC DE ALTA FIDELIDAD. 100 ENSAYOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "422", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZOL, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "423", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZOL, REACTIVO PARA EXTRACCIÓN DE RNA, 200 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "424", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "XANTINA OXIDASA DE LECHE BOVINA LIOFILIZADA 50 U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "425", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "XANTINA OXIDASA GRADE I, AMMONIUM SULFATE SUSPENSION, =0.4 UNITS/MG PROTEIN. FRASCO DE 25U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "426", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "X-GAL (5-BROMO-4-CHLORO-3-INDOLYL ß-D-GALACTOPYRANOSIDE ), 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "427", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZINC EN POLVO <10 µM, =98%, 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "428", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE CONCENTRADO 10,000X. FRASCO 5 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "429", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE BLASTICIDINA, 10 MG/ML (20 MM HEPES), FILTRADA POR 0.22 µM, 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "430", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEZCLA DE AMINOÁCIDOS NO ESENCIALES PARA CULTIVO CELULAR. FRASCO CON 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "431", "cucop_code": "25901-0844", "specific_item_code": "25901", "cucop_description": "080.725.0014 SUSTANCIAS BIOLÓGICAS ALBUMINA BOVINA POLIMERIZADA AL 22% CONSERVADA EN AZIDA DE SODIO AL 0.1%. FRASCO CON 10 ML. RTC.", "description": "ALBÚMINA DE SUERO DE BOVINO, POLVO LIOFILIZADO,ESENCIALMENTE LIBRE DE IGG, BAJO EN ENDOTOXINAS, APTO PATA CULTIVO CELULAR. FRASCO CON 100 GR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "432", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN DE ANTIBIÓTICO Y ANTIMICÓTICO (10,000 U/ML DE PENICILINA, 10,000 µG/ML DE ESTREPTOMICINA Y 25 µG/ML DE ANFOTERICINA B), ESTÉRIL, CONGELADO (100X). 100 ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": "26", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "433", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN PENICILINA-STREPTOMICINA, 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "434", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "B-27 MINUS INSULIN (50X). FRASCO CON 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "435", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SUPLEMENTO B-27 PLUS (50X) ESTÈRIL,LIBRE DE ENDOTOXINAS. FRASCO CON 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "436", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SUPLEMENTO B-27 (50X), SIN SUERO. FRASCO CON 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "437", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FACTOR NEUROTRÓFICO DERIVADO DEL CEREBRO DE HUMANO (BDNF). VIAL 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "438", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "CITOSINA ß-D-ARABINOFURANOSIDE. FRASCO 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "439", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "COLÁGENA TIPO 1 DE COLA DE RATA. SOLUCIÓN 3 MG/ML. FRASCO 20 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "440", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "COLORANTE DE VIABILIDAD DE CALCEÍNA AM. CAJA 20 X 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "441", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CRISTAL VIOLETA PARA CULTIVO CELULAR, 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "442", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DIFERENCIACIÓN DE NEURONAS DOPAMINÉRGICAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "443", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIHIDROCLORURO DE PUROMICINA DE STREPTOMYCES ALBONIGER. FRASCO 25 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "444", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIMETIL SULFOXIDO PARA CULTIVO CELULAR, 50 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "445", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIMETILSULFÓXIDO (DMSO) PARA CULTIVO CELULAR, PUREZA MAYOR AL 99.7%, 250 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "446", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE CRECIMIENTO PARA LA EXPANSIÓN DE CÉLULAS PROGENITORAS NEURONALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "447", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FACTOR DE CRECIMIENTO NEUROTRÓFICO DERIVADO DEL CEREBRO (BDNF) , PROTEÍNA RECOMBINANTE HUMANA, POLVO LIFILIZADO. VIAL CON 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "448", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPLEMENTO DEL FACTOR DE CRECIMIENTO ENDOTELIAL 100X, LÍQUIDO, ESTÉRIL, LIBRE DE ENDOTOXINAS, 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "449", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FACTOR DE CRECIMIENTO NT3 , PROTEÍNA RECOMBINANTE HUMANA, POLVO LIFILIZADO. VIAL CON 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "450", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FIBRONECTINA DE PLASMA HUMANO, LIQUIDA, SOLUCIÓN AL 0.1% ADECUADA PARA CULTIVO CELULAR. VIAL CON 5 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "451", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÒN ESTÈRIL 0.1% DE GELATINA PARA CULTIVO CELULAR, LIBRE DE ENDOTOXINA, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "452", "cucop_code": "25901-1906", "specific_item_code": "25901", "cucop_description": "080.832.0303 REACTIVOS QUÍMICOS L-GLUTAMINA. PARA FINES BIOQUÍMICOS. FRASCO CON 25 G. TA.", "description": "L-GLUTAMINA (200 MM, 100X), LÍQUIDO PARA CULTIVO CELULAR, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "453", "cucop_code": "25901-1907", "specific_item_code": "25901", "cucop_description": "080.832.0311 REACTIVOS QUÍMICOS GLUTATION FORMA REDUCIDA. CRISTALES. RA. FRASCO CON 10 G. RTC.", "description": "L-GLUTATION REDUCIDO (GSH), PUREZA ARRIBA DE 98% PARA CULTIVO CELULAR. FRASCO DE 10 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "454", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "HIGROMICINA B, POLVO, PUREZA MAYOR AL 98% PARA CULTIVO CELULAR, 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "455", "cucop_code": "25901-1906", "specific_item_code": "25901", "cucop_description": "080.832.0303 REACTIVOS QUÍMICOS L-GLUTAMINA. PARA FINES BIOQUÍMICOS. FRASCO CON 25 G. TA.", "description": "SOLUCIÓN 200 MM DE DIPÉPTIDO DE L-ALANIL-L-GLUTAMINA EN 0.85 % DE NACL, CONGELADO (GLUTAMAX), 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "456", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LAMININA DE FIBROBLASTOS HUMANOS, DERIVADA DE CULTIVO CELULAR, LIQUIDA, 0.5 MG/ML, ADECUADA PARA CULTIVO CELULAR. VIAL CON 100 µL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "457", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍNEA CELULAR L2 AISLADA DE PULMÓN DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "458", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍNEA CELULAR DE MICRO ENDOTELIO VASCULAR CEREBRAL HUMANO HBEC-5I", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "459", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍNEA CELULAR, CÉLULAS PROGENITORAS NEURONALES DERIVADAS BYS012, NORMAL; HUMANO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "460", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍNEA CELULAR SVG-P12", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "461", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍNEA CELULAR HMC3", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "462", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS DE RIÑÓN EMBRIONARIO HUMANO HEK-293 (HEK293)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "463", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS DE MICROGLÍA DE RATÓN SIM-A9 (SIMA9)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "464", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CÉLULAS DE MICROGLÍA DE HUMANO HMC3", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "465", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEURONAS CORTICALES DE HUMANO HCN-2 (HCN2)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "466", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEURONAS DE RATÓN CATH.A (CATHA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "467", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ASTROCITOS INMORTALIZADOS DE HUMANO-SV40T", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "468", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ASTROCITOS DE RATÓN C8-D1A (C8D1A)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "469", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MACRÓFAGOS DE RATÓN RAW 264.7", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "470", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MONOCITOS/MACRÓFAGOS DE HUMANO THP-1 (THP1)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "471", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MATRIGEL, MATRIZ DE MEMBRANA BASAL CALIFICADO PARA CRECIMIENTO DE CÉLULAS TRONCALES EMBRIONARIAS HUMANAS. FRASCO CON 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "472", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO NEUROBASAL LÍQUIDO SIN SUERO, SIN L-GLUTAMINA Y CON ROJO FENOL PARA EL MANTENIMIENTO A LARGO PLAZO Y LA MADURACIÓN DE NEURONAS PRENATALES Y EMBRIONARIAS. FRASCO CON 500 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "9", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "473", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO EN POLVO DMEM BAJO EN GLUCOSA. CAJA CON 20 SOBRES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "474", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM BAJO EN GLUCOSA EN POLVO. CON 1 G/L DE GLUCOSA, GLUTAMINA Y PIRUVATO DE SODIO SIN BICARBONATO DE SODIO NI HEPES. 1 PAQUETE CON 10 SOBRES (= 10 LITROS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "475", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO DMEM \"MEDIO EAGLE MODIFICADO DULBECOS\" ALTA GLUCOSA, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "476", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM ALTO EN GLUCOSA EN POLVO. CON GLUTAMINA Y 4.5 G/L DE GLUCOSA SIN PIRUVATO DE SODIO NI BICARBONATO DE SODIO. 1 PAQUETE CON 10 SOBRES (= 10 LITROS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "477", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO DMEM ALTA GLUCOSA CON PIRUVATO DE SODIO, EN POLVO PARA 10L. CAJA CON 10 SOBRES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "478", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM SIN GLUCOSA. MEDIO DMEM LÍQUIDO CON ROJO DE FENOL Y GLUTAMINA, SIN GLUCOSA, SIN HEPES, SIN PIRUVTO DE SODIO. FRASCO CON 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "479", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM/ MEZCLA DE NUTRIENTES F-12, EN POLVO, CON L-GLUTAMINA, CON PIRIDOXINA CLORHIDRATO. 10 SOBRES X 1 L POLVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "480", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO CELULAR DMEM/F-12, POLVO ESTÉRIL EN SOBRES, ADICIONADO CON L-GLUTAMINA Y ROJO DE FENOL. CAJA CON 10 SOBRES (1X10L)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "481", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM/F-12 LÍQUIDO CON GLUTAMAX, CON ROJO FENOL, SIN HEPES, ESTÉRIL. FRASCO CON 500 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "482", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO DULBECCOS ALTA GLUCOSA Y CON PIRUVATO. CAJA/10 FCOS PARA 1L.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "483", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO DULBECCO ALTO EN GLUCOSA. CAJA CON 10 FRASCOS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "484", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO F12, EN POLVO PARA 10L. FRASCO O CAJA CON 10 SOBRES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "485", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO F-12K, 500 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "486", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO CELULAR RPMI 1640, POLVO ESTÉRIL EN SOBRES, ADICIONADO CON L-GLUTAMINA Y ROJO DE FENOL. SOBRE PARA 10L C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "487", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE DIFERENCIACIÓN DE CÉLULAS MADRE NEURONALES HUMANAS. BOTELLA 250 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "488", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO NEUROBASAL  ESTÉRIL, LIBRE DE ENDOTOXINAS, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "489", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEM, MEDIO ESENCIAL MÍNIMO EAGLE. CON SALES EARLE'S, L-GLUTAMINA SIN BICARBONATO DE SODIO. EN POLVO, CAJA CON 10 SOBRES (10L)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "490", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12 (DMEM/F12). EN POLVO, CAJA CON 10 SOBRES (10L)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "491", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN DE METILGLIOXAL, 25 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "492", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MONOFOSFATO DE N6,2'-O-DIBUTIRILADENOSINA 3',5'-CÍCLICO, SAL DE SODIO EN POLVO CON PUREZA =96% POR HPLC, 5 FRASCOS DE 1 GRAMO CADA UNO (5X1 GRAMO)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "493", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "N-ACETIL-L-CISTEINA PUREZA SUPERIOR AL 98% GRADO CULTIVO CELULAR. FRASCO 10G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "494", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO PARA BIOLOGÍA MOLECULAR, POLVO, PUREZA MAYOR AL 98%, 250 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "495", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "POLI-L-ORNITINA PARA USO COMO SUSTRATO EN CULTIVO CELULAR. FRASCO 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "496", "cucop_code": "25901-1244", "specific_item_code": "25901", "cucop_description": "080.823.1351 CONTROLES Y ESTANDARES. PIRUVATO DE SODIO. 2 MMOL/L FRASCO CON 100 ML. RTC.", "description": "SOLUCIÓN PIRUVATO DE SODIO 100 MM, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "497", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÒN DE POLI-L-LISINA, ESTÉRIL, 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "498", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLI-L-LISINA BROMOHIDRATADO  PARA CULTIVO CELULAR, 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "499", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE POLI-L-LISINA (0.1 % (W/V) EN AGUA) PARA TÉCNICA DE HISTOLOGÍA, 100 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "500", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE POLI-L-LISINA, 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "501", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO, FILTRADO ESTÉRIL, LIBRE DE MICOPLASMA, ENDOTOXINAS Y ANTIBIÓTICO, 500 ML", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": "35", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "502", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO DE CABRA. FRASCO 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "503", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO DE ALBÚMINA BOVINA. FRASCO DE 10 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "504", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPLEMENTO N-2 (100X)SIN SUERO DEFINIDO QUÍMICAMENTE BASADO EN LA FORMULACIÓN BOTTENSTEIN N-1. FRASCO CON 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "505", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA DE PÁNCREAS PORCINO. FRASCO CON 25 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "506", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA 0.25%-EDTA PARA CULTIVO CELULAR, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "507", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA-EDTA (0,25%) CON ROJO DE FENOL, LÍQUIDO, ESTÉRIL PARA CULTIVO CELULAR, 100 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "508", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN ESTÉRIL DE TRIPSINA-EDTA AL 2.5% PRESENTACIÓN 100 ML (10X). FRASCO CON 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "509", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO CGMP, PARA EL MANTENIMIENTO DE CÉLULAS TRONCALES EMBRIONARIAS HUMANAS Y CÉLULAS TRONCALES PLURIPOTENTES INDUCIDAS HUMANAS EN CONDICIONES LIBRES DE CÉLULAS ALIMENTADORAS (FEEDER-FREE). 1 MEDIO BASAL DE 400 ML MÁS 100 ML DE SUPLEMENTO 5X", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "510", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DETERGENTE CONCENTRADO PH 12.00 PARA LIMPIEZA DE MATERIAL DE VIDRIO, PLÁSTICO, ACERO INOXIDABLE Y PORCELANA. 4 L", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "511", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DETERGENTE NEUTRO CONCENTRADO LIBRE DE FOSFATOS PH 7.0 PARA LAVADO DE MATERIAL DE VIDRIO, PLÁSTICO Y PORCELANA. 4 L", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "512", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 PARA BIOLOGÍA MOLECULAR; EXTRACCIÓN DE PROTEÍNAS, BUFFER, LAVADOS, WESTERNBLOT, ELISA. FRASCO DE 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "513", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20, LÍQUIDO VISCOSO. FRASCO CON 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "514", "cucop_code": "25901-1762", "specific_item_code": "25901", "cucop_description": "080.830.5080 REACTIVOS QUÍMICOS TWEEN 80 (MONOLEATO DE POLIOXIETILENSORBITAN). QP. FRASCO CON 100 ML. TA.", "description": "TWEEN 80, LÍQUIDO VISCOSO. FRASCO CON 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "515", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SODIO DODECIL SULFATO SDS, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "516", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DUECIL SULFATO DE SODIO (SDS) GRADO ELECTROFORESIS. FRASCO 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "517", "cucop_code": "25901-1791", "specific_item_code": "25901", "cucop_description": "080.830.5833 REACTIVOS QUÍMICOS TRITON X 100. LIQUIDO. RA. FRASCO CON 500 ML. TA.", "description": "TRITON X100. FRASCO 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "518", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NONIDET P40. FRASCO 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "519", "cucop_code": "25901-1622", "specific_item_code": "25901", "cucop_description": "080.830.0834 REACTIVOS QUÍMICOS DIGITONINA. RA. POLVO. FRASCO CON 1 G. TA.", "description": "DIGITONINA. FRASCO DE 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "520", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NONIDET P40. FRASCO DE 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "521", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CASSETES DE INCLUSIÓN PARA MICROPROCESAMIENTO CON 6 COMPARTIMIENTOS, DE POLÍMERO DE ACETAL DE 7 X 12 X 5 MM, CON 3000 ABERTURAS CUADRADAS DE 0,36 MM. CAJA C/50 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "522", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN DAPI. VIAL 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "523", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DAPI (4',6-DIAMIDINO-2-PHENYLINDOLE), TINCIÓN NUCLEAR DE CÉLULAS FIJAS, PRESENTACIÓN DE FRASCO CUENTAGOTAS DE 2.5 ML, LÍQUIDO, PARA TINCIÓN FLUORESCENTE, ALTA PUREZA COMPATIBLE PARA USO EN MICROSCOPIO DE FLUORESCENCIA Y CITÓMETRO DE FLUJO. 1 PAQ CON 6 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "524", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DAPI (4',6-DIAMIDINO-2-FENILINDOL, DIHIDROCLORURO). FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "525", "cucop_code": "25901-1897", "specific_item_code": "25901", "cucop_description": "080.832.0212 REACTIVOS QUÍMICOS ÁCIDO NNNN -TETRACETICO. ETILENGLICOL BIS.(BETA-AMINO-ETIL-ETER). RA. CRISTALES. FRASCO CON 10 G. TA.", "description": "ETILENGLICOL. FRASCO DE 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "526", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FLUORO-JADE B PARA HISTOQUÍMICA. FRASCO 30 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "527", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GELATINA DE PIEL DE CERDO. POLVO, FUERZA DE GEL ¿300 G BLOOM, TIPO A, ADECUADO PARA ELECTROFORESIS Y CULTIVO CELULAR. FRASCO CON 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "528", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICEROL. FRASCO DE 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "529", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MACH2 UNIV HRP POLYMER 6ML MEZCLA DE ANTICUERPOS SECUNDARIOS CONJUGADO DE PEROXIDASA DE RÁBANO ANTI-RATÓN Y ANTI-CABRA REACCIONA CON LAS CADENAS PESADAS Y LIGERAS DE IGG DE RATÓN Y CONEJO. TAMBIÉN REACCIONA CON TODAS LAS SUBCLASES DE IGG DE RATÓN Y CONEJO Y CON IGM DE RATÓN Y CONEJO. FRASCO GOTERO 6 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "530", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE PARA MICROSCOPÍA, LIBRE DE AGUA. CONSISTE EN POLÍMEROS DE ACRILATO MEZCLADOS DISUELTOS EN XILENOS. FRASCO CON 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "531", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE PARA FLUORESCENCIA ANTIBLANQUEAMIENTO DE ACABADO DURO SECADO RÁPIDO. FRASCO CON GOTERO 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "532", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE BASADO EN GLICEROL ACUOSO QUE NO SE SOLIDIFIQUE, SINO SEA LÍQUIDO VISCOSO EN LA LAMINILLA, QUE NO SE SEQUE FÁCILMENTE AL MANTENER LA LAMINILLA SELLADA. FRASCO DE 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "533", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "METACRILATO DE 3-(TRIMETOXISILIL)PROPILO 98%, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "534", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "2 METHYLBUTANO. BOTELLA 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "535", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO GRADO 2 CIRCULAR DE 240 MM, PAQUETE 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "536", "cucop_code": "25501-0298", "specific_item_code": "25501", "cucop_description": "080.681.0859 PAPELES SEDA PARA LIMPIEZA DE LENTES DE MICROSCOPIO. CUADERNO CON 50 HOJAS.", "description": "PAPEL SEDA, UTILIZADO PARA LIMPIAR LENTES DE MICROSCOPIO SIN RAYARLOS. BLOCK CON 100 HOJAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "537", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PARAFINA EN POLVO. PUNTO DE SOLIDIFICACIÓN 56-58°C. AGENTE INCLUSIÓN PARA HISTOLOGÍA. BOLSA 1 KG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "538", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PARAFORMALDEHIDO EN POLVO. FRASCO DE 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "539", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PERÓXIDO DE HIDRÓGENO 3%. FRASCO SOLUCIÓN 200 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "540", "cucop_code": "25501-0411", "specific_item_code": "25501", "cucop_description": "080.729.0010 PORTA OBJETOS DE VIDRIO RECTANGULARES DE GROSOR UNIFORME DE 75 X 25 X 0.8 A 1.1 MM: LISOS. CAJA CON 50 PIEZAS.", "description": "PORTA OBJETOS DE 25MM X 75 MM. CAJA C/50 PZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "541", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE BLOQUEO PARA INMUNOFLUORESCENCIAS RATON SOBRE RATÓN (M.O.M.). VIAL 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "542", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RESINA HIDROFÍLICA LÍQUIDA GRADO MEDIO PARA INCLUSIÓN DE TEJIDOS PARA MICROSCOPÍA ELECTRÓNICA (LR-WHITE). BOTELLA DE 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "543", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BACKGROUND SNIPER REACTIVO DE BLOQUEO UNIVERSAL, UTILIZADO PARA REDUCIR LA TINCIÓN DE FONDO INESPECÍFICA PARA INMUNOHISTOQUÍMICA, ELISA, MICROSCOPÍA INMUNOELECTRÓNICA E INMUNOGOLD. FRASCO 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "544", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE RECUPERACIÓN ANTIGÉNICA 10X PARA INMUNOHISTOQUÍMICA, PARA CORTES DE TEJIDO, MEDIANTE CALOR, COMPATIBLE CON LOS ANTICUERPOS. BOTELLA DE 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "545", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO NORMAL DE CABRA PARA PARA BLOQUEAR SITIOS INESPECÍFICOS EN LA INMUNOHISTOQUÍMICA; LIOFILIZADO PARA RECONSTITUIR. BOTELLA DE 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "546", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE DE INCLUSIÓN DE TEJIDOS PARA CORTE POR CONGELACIÓN. FRASCO DE 118 ML", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "547", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE PROTEASA 3CL, SIN ETIQUETAR (SARS-COV-2), PARA 96 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "548", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ÁCIDO BICINCONINICO. FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "549", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA ÁCIDO QUINOLÍNICO. REACTIVIDAD: HUMANO, RATA Y RATÓN, (TODAS LAS ESPECIES). SENSIBILIDAD: 0.58 NG/ML. RANGO: 1.23-100 NG/ML, 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "550", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE ACTIVIDAD DE LA ACIL-COA SINTETASA, 100 ENSAYOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "551", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA ACTIVIDAD DEL COMPLEJO I MITOCONDRIAL. KIT PARA 100", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "552", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA AMPLIFICACIÓN DE ADNC AMPIGENE. KIT PARA 200 REACCIONES QUE CONSTA DE 8 VIALES (100UL) DE 5X CDNA SYNTHESIS MIX Y 8 VIALES (25UL) DE 20X RTASE CON INHIBIDOR DE RNASE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "553", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA AISLAMIENTO MITOCONDRIAL, 100 ENSAYOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "554", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE AISLAMIENTO DE NEURONAS DE RATÓN CON MICROPERLAS ANTIBIOTINA PARA UN TOTAL DE 5X10E8 CÉLULAS COMPATIBLES PARA COLUMNAS DE SEPARACIÓN MAGNÉTICA TIPO LS. PARA 5×10E8 CÉLULAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "555", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETECCIÓN POR ELISA DE LA PROTEÍNA APELINA. MÉTODO COLORIMÉTRICO PARA LA DETECCIÓN DE APELINA HUMANA, DE RATA Y DE RATÓN DE SUERO, PLASMA, SUPERNADANTE CELULAR Y LISADOS CELULARES. CAJA CON 96 POZOS (12 TIRAS DE 8 POZOS CADA UNA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "556", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC ANNEXIN V APOPTOSIS DETECTION KIT WITH 7-AAD. KIT CON 300 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "557", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TINCIÓN ANEXINA V-FITC PARA DETECCIÓN DE MUERTE CELULAR POR CITOMETRÍA DE FLUJO (50 ENSAYOS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "558", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE APOPTOSIS, FLUORESCENTE. KIT PARA 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "559", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCIÓN DE AUTOFAGIA, 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "560", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ANTICUERPO SECUNDARIO BIOTINILADO, ACOPLADO AL COMPLEJO AVIDINA-ESTREPTAVIDINA. LA PROTEÍNA MARCADA QUE SE VISUALICE POR INCUBACIÓN EN PEROXIDASA Y REACCIONE CON ANTICUERPOS PRIMARIOS HECHO EN CONEJO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "561", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT SISTEMA DE DETECCIÓN SUPER SENSIBLE (LINK-LABEL) INTERACCIÓN STREPTAVIDINA-BIOTINA, PARA INMUNOHISTOQUÍMICA. KIT QUE INCLUYE DOS BOTELLAS 1) UNA BOTELLA DE 110 ML MULTI-LINK CON UNA MEZCLA DE IGG ANTI-RATÓN Y ANTI-CONEJO CONJUGADAS CON MOLÉCULAS DE BIOTINA; 2)UNA BOTELLA DE MARCA PARA ESTREPAVIDINA CONJUGADA CON UNA ENZIMA (PEROXIDASA DE RÁBANO HRP)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "562", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ANTICUERPO SECUNDARIO BIOTINILADO, ACOPLADO AL COMPLEJO AVIDINA-ESTREPTAVIDINA. LA PROTEÍNA MARCADA QUE SE VISUALICE POR INCUBACIÓN EN PEROXIDASA Y REACCIONE CON ANTICUERPOS PRIMARIOS HECHOS EN RATÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "563", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA DE DETECCIÓN BASADO EN LA INTERACCIÓN DE ESTREPTAVIDINA-BIOTINA ALTAMENTE ESPECÍFICA Y SENSIBLE PARA DETECTAR UN ANTICUERPO PRIMARIO UNIDO (IHC LINK-LABEL SUPER SENSITIVE). 1000 PRUEBAS. KIT MULTILINK CON 2 FRASCOS 1 FRASCO: LABEL DE 110 ML. 1 FRASCO: MEZCLA DE IGG ANTIRRATÓN Y ANTICONEJO CONJUGADAS CON MOLÉCULAS DE BIOTINA DE 110 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "564", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA BNDF. REACTIVIDAD: HUMANO, RATA Y RATÓN.SENSIBILIDAD: 1.35 PG/ML. RANGO: 15.6 - 10000 PG/ML, 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "565", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE MATRIZ DE MICROESFERAS PARA CITOMETRÍA PARA CITOCINAS HUMANAS: TH1/TH2/TH17. REACTIVIDAD: HUMANO. SENSIBILIDAD, 80 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "566", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA ACTIVIDAD DE LA CITRATO SINTASA. KIT 96", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "567", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COCKTAIL DE ANTICUERPOS DE LINEAJE HUMANO DIRIGIDO CONTRA CD3, CD14, CD16, CD19, CD20 Y CD56 MARCADO CON APC. HECHO EN RATÓN. REACTIVIDAD: HUMANO. KIT DE 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "568", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT EN BASE DE COLUMNAS PARA PURIFICACIÓN DE RNA TOTAL Y RNA INTEREFERENCIA. CAJA CON 50 COLUMNAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "569", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA MEDIR CONCENTRACIÓN DE PROTEÍNAS POR EL MÉTODO DEL ÁCID BICINCONINICO. KIT 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "570", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA CORTICOSTERONA PARA ROEDORES. DETECCIÓN COLORIMÉTRICA, CON UNA SENSIBILIDAD DE DETECCIÓN DE 32-20000 PG/ML LIMITE DE DETECCION 27 PG/ML, 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "571", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DE CORTICOSTERONA DE RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "572", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CPGENOME RAT METHYLATED GENOMIC DNA STANDARD. 5 µG DNA EN BUFFER QUE CONTIENE 10MM TRIS-HCL PH 8.0, 0.1MM EDTA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "573", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CROMÓGENO DIAMINOBENCIDINA (DAB). CROMÓGENO PARA LA TINCIÓN DE TEJIDOS FIJADOS CON FORMALINA E INCLUIDOS EN PARAFINA, COMO PARTE DE LA TÉCNICA DE INMUNOHISTOQUÍMICA (IHC) QUE UTILIZA UN SISTEMA DE DETECCIÓN DE PEROXIDASA DE RÁBANO PICANTE (HRP). KIT CON 2 FRASCOS: 1 FRASCO CON CROMÓGENO: 5 ML; 1 FRASCO CON AMORTIGUADOR: 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "574", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE LA CK (CREATINA CINASA) EN SUERO O PLASMA. MÉTODO CINÉTICO. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT PARA 75 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "575", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE COLESTEROL EN SUERO O PLASMA. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT CON 200 MILILITROS/200 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "576", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DETERMINACIÓN CUANTITATIVA DE GLUCOSA SUERO O PLASMA, LIBRE DE HEMÓLISIS1 Y LCR . CONTIENE TRIS, GLUCOSA OXIDASA, PEROXIDASA 4- AMINOFENAZONA. 1 KIT 200 REACCIONES PARA MUESTRAS DE 5 X 24", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "577", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE COLESTEROL HDL EN SUERO O PLASMA. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT PARA 125 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "578", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE LA LDH (LACTATO DESHIDROGENASA) EN SUERO. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT PARA 20 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "579", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE COLESTEROL LDL EN SUERO. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT PARA 125 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "580", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE LA PROTEÍNA C REACTIVA (PCR) DE RATA EN SUERO Y PLASMA. MÉTODO DE DETECCIÓN ESPECTROFOTOMÉTRICO/COLORIMÉTRICO. KIT PARA 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "581", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE CUANTIFICACIÓN DE PROTEÍNAS-BCA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "582", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA CUANTIFICACIÓN DE PROTEÍNAS PARA DETERMINAR LA CONCENTRACIÓN DE PROTEÍNAS EN MUESTRAS PREPARADAS PARA ELECTROFORESIS BIDIMENSIONAL. EL KIT 2-D QUANT ESTÁ DISEÑADO PARA LA DETERMINACIÓN PRECISA DE LA CONCENTRACIÓN DE PROTEÍNAS EN MUESTRAS PREPARADAS PARA TÉCNICAS DE ELECTROFORESIS COMO ELECTROFORESIS 2-D, SDS-PAGE O IEF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "583", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE SDMA (DIMETIL ARGININA SIMÉTRICA) DE RATA EN SUERO Y PLASMA. KIT PARA 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "584", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE TRIGLICÉRIDOS EN SUERO O PLASMA. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT CON 50 ML/50 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "585", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE TROPONINA I DE RATA EN SUERO Y PLASMA. KIT PARA 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "586", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE CORTISOL DE RATA EN SUERO, PLASMA Y TEJIDO HOMOGENIZADO. KIT PARA 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "587", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LA CUANTIFICACIÓN DE GLUCOSA EN SUERO O PLASMA. MÉTODO DE LA GLUCOSA OXIDASA/PEROXIDASA. DETECCIÓN ESPECTROFOTOMÉTRICA. KIT CON 200 ML/200 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "588", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CROMÓGENO BETAZOIDE-DIAMINOBENCIDINA (DAB). CROMÓGENO PARA LA TINCIÓN DE TEJIDOS FIJADOS CON FORMALINA E INCLUIDOS EN PARAFINA, COMO PARTE DE LA TÉCNICA DE INMUNOHISTOQUÍMICA (IHC) QUE UTILIZA UN SISTEMA DE DETECCIÓN DE PEROXIDASA DE RÁBANO PICANTE (HRP). KIT CON CROMÓGENO (2 X 20 ML) Y BUFFER DE SUSTRATO (1 X 1 ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "589", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT SISTEMA CROMÓGENO DE DETECCIÓN DE DIAMINOBENCIDINA (DAB) PARA INMUNOHISTOQUÍMICA CONSTA DE 2-COMPONENTES. 1) PAQUETE DE 2 BOTELLAS CON 5 ML CADA UNA DE CROMÓGENO DAB; 2) AMORTIGUADOR DAB ESTABLE (STABLE DAB BUFFER) 1 BOTELLA CON 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "590", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCIÓN DE DAÑO UV-DNA, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "591", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SUSTRATO DIAMINOBENCIDINA PARA TEJIDO. KIT CON 2 FRASCOS DE 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "592", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIRECT-ZOL RNA MINIPREP PLUS KI, PRODUCT SUPPLIED W/ 200 ML TRI REAGENTT. KIT PARA 200 PREPS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "593", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DISOCIACIÓN DE TEJIDO NEURAL - NEURONAS POSTNATALES, 50 PREPARACIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "594", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EZ DNA METHYLATION-GOLD KIT. KIT PARA 200 REACCIONES, EL CUAL CONTIENE: 20 TUBOS DE CT CONVERSION REAGENT*, 7ML DE M-DILUTION BUFFER, 1.5 ML DE M-DISSOLVING BUFFER, 125 ML DE M-BINDING BUFFER , 24 ML DE M-WASH BUFFER**, 40 ML DE M-DESULPHONATION BUFFER, 4 ML DE M-ELUTION BUFFER, 200 ZYMO-SPIN™ IC COLUMNS Y 200 COLLECTION TUBES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "595", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA ENSAYO DE ESCALERA DE DNA-APOPTOSIS, 50 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "596", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA DE DETECCIÓN BASADO EN LA INTERACCIÓN DE ESTREPTAVIDINA-BIOTINA ALTAMENTE ESPECÍFICA Y SENSIBLE PARA DETECTAR UN ANTICUERPO PRIMARIO UNIDO (IHC LINK-LABEL SUPER SENSITIVE). KIT PARA 1000 PRUEBAS CON SOLUCIÓN MARCADORA (110 ML) Y MEZCLA DE IGG ANTI-RATÓN Y ANTI-CONEJO CONJUGADAS CON BIOTINA (110 ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "597", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ETIQUETADO DE CÉLULAS MULTICOLOR. SOLUCIONES DE LOS COLORANTES DIL, DID, Y DIO PARA EL MARCAJE FLUORESCENTE DE CÉLULAS. CAJA CON 1 ML DE CADA SOLUCIÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "598", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA FAGOCITOSIS, PARTÍCULAS DE ZYMOSAN ACOPLADAS A PHRODO VERDE, 5 X 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "599", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE PODER ANTIOXIDANTE REDUCTOR FÉRRICO (FRAP). RANGO: 0.5 TO 180 µM FE3+ POTENCIAL DE REDUCCIÓN, 250 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "600", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TINCIÓN RÁPIDA DE GOLGI PARA ESPINAS DENDRÍTICAS PARA HASTA 50 CEREBROS DE RATÓN. 1 KIT PARA 50 TINCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "601", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE IFN-Y HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "602", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE IL-10 HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "603", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DE IL-10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "604", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DE IL-13", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "605", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE IL-17A HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "606", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOUSE IL-1 BETA UNCOATED ELISA KIT. KIT PARA 96 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "607", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DE IL-1 BETA RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "608", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE IL-1B HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "609", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ELISA PARA DETERMINACIÓN DE IL-4 RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "610", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE IL-5 HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "611", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACION DE IL-6 HUMANO POR ELISA. KIT PARA 5 PLACAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "612", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOUSE IL-6 ELISA KIT, KIT PARA 96 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "613", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DE IL-6 RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "614", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA DETERMINAR INSULINA DE RATA. SENSIBILIDAD DEL ENSAYO: 5 µIU/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "615", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE POTENCIAL DE MEMBRANA MITOCONDRIAL JC-1. KIT PARA 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "616", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE LIMPIEZA 2-D", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "617", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOFECTAMINA. KIT CON UN VIAL DE 1 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "618", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DNA METILACIÓN DIRECTO POR QUÍMICA DE CONVERSIÓN DEL BISULFITO UTILIZANDO COLUMNAS, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "619", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETECCIÓN DE MICOPLASMAS MEDIANTE PCR OPTIMIZADO PARA SU UTILIZACIÓN CON TAQ JUMPSTART", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "620", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MINIBOMBAS OSMOTICAS DE INFUSION A 0.25 MICROLITROS POR HORA. PAQUETE CON 10 BOMBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "621", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MINI BOMBA OSMÓTICA (3.0 CM LARGO X 0.7 CM DE DIÁMETRO, VOLUMEN DESPLAZADO 1.0 ML), MEMBRANA EXTERNA DE MEZCLA DE ÉSTERES DE CELULOSA Y UN RESERVORIO DE FÁRMACO DE ELASTÓMERO DE HIDROCARBURO TERMOPLÁSTICO. CAJA CON 10 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "622", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MINIBOMBAS OSMOTICAS DE INFUSIÓN A 0.5 MICROLITROS POR HORA. PAQUETE CON 10 BOMBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "623", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PROLIFERACIÓN CELULAR (MTT), 2500 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "624", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETECCIÓN DE NGF, ELISA SANDWICH, REACTIVIDAD RATA Y HUMANO, DETECCIÓN COLORIMÉTRICA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "625", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS DE 18 PB, DESALADOS Y LIOFILIZADOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "626", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WB PARA ANTÍGENOS ONCONEURONALES (HU, YO, RI, CV2, ANFIFISINA, MA, TA Y TR)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "627", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN HUMANA, KIT DE ENSAYO BASADO EN PERLAS MULTIPLEX. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "628", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE INFLAMACIÓN HUMANA 1 (13 BLANCOS: IL-1ß, IFN-A2, IFN-¿, TNF-A, MCP-1 (CCL2), IL-6, IL-8 (CXCL8), IL-10, IL-12P70, IL-17A, IL-18, IL-23 Y IL-33.) CON PLACA CON FONDO EN V. KIT DE 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "629", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN PARA MACRÓFAGOS DE RATÓN M1 (6-PLEX) CON FONDO PLANO. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "630", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN PARA MACRÓFAGOS DE RATÓN M2 (6-PLEX) CON FONDO PLANO. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "631", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE INFLAMACIÓN PARA MACRÓFAGOS DE RATÓN M2 (6 BLANCOS: TGF-ß1 (FREE ACTIVE FORM), CCL22 (MDC), IL-10, IL-6, G-CSF, CCL17 (TARC) ) CON FONDO PLANO, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "632", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE INFLAMACIÓN PARA MACRÓFAGOS DE RATÓN M2 (6 BLANCOS: IFN¿, IL-6, IL-10, IL-12P70, MCP-1, TNFA ) CON FONDO PLANO, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "633", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN PARA RATA, ENSAYO MULTIPLEX LEGENDPLEX™ V02. ESTE PANEL ESTÁ BASADO EN MICROESFERAS, PARA SU USO EN CITOMETRÍA DE FLUJO. PERMITE LA CUANTIFICACIÓN SIMULTÁNEA DE 13 CITOCINAS (IL-1A, IL-1ß, IL-6, IL-10, IL-12P70, IL-17A, IL-18, IL-33, CXCL1/KC, CCL2/MCP-1, GM-CSF, IFN-¿ Y TNF-A). KIT PARA 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "634", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN VASCULAR HUMANA, KIT DE ENSAYO BASADO DE PERLAS MULTIPLEX. KIT PARA 100 PRUEBAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "635", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE INFLAMACIÓN VASCULAR HUMANA 1-U (PARA 10 PROTEÍNAS: MIOGLOBINA, NGAL, CRP, MMP-2, MPO, SAA, IGFBP-4, ICAM-1, VCAM-1Y MMP-9) CON PLACA CON FONDO EN V, PARA HUMANO, 100 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "636", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE NEUROINFLAMACIÓN HUMANA (13-PLEX), KIT DE ENSAYO BASADO EN PERLAS MULTIPLEX. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "637", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE NEUROINFLAMACIÓN HUMANA 1 (13 BLANCOS: VILIP-1, CCL2 (MCP-1), STREM-2, BDNF, FREE ACTIVE TGF-ß1, VEGF, IL-6, STREM-1, ß-NGF, IL-18, TNF-A, SRAGE, CX3CL1 ) CON PLACA FILTRANTE, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "638", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN DE RESPUESTA INUMNE ESENCIAL HU W/VBP. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "639", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE RESPUESTA INMUNE ESENCIAL, KIT DE ENSAYO BASADO EN PERLAS MULTIPLEX. KIT DE 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "640", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL DE RESPUESTA INMUNE ESENCIAL HU (13 BLANCOS: IL-4, IL-2, CXCL10 (IP-10), IL-1ß, TNF-A, CCL2 (MCP-1), IL-17A, IL-6, IL-10, IFN-¿, IL-12P70, CXCL8 (IL-8), Y TGF-ß1 LIBRE ACTIVO) CON CON PLACA CON FONDO EN V, PARA HUMANO, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "641", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PANEL INFLAMACIÓN DE RESPUESTA INMUNE ESENCIAL (13 BLANCOS:IL-4, IL-2, CXCL10 (IP-10), IL-1ß, TNF-A, CCL2 (MCP-1), IL-17A, IL-6, IL-10, IFN-¿, IL-12P70, CXCL8 (IL-8), TGF-ß1)C, 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "642", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PCR PUNTO FINAL. 500 X 20 µL RXNS, 5 ML (5 X 1 ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "643", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE PD1 HUMANO POR ELISA. KIT PARA 15 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "644", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE PDL1 HUMANO POR ELISA. KIT PARA 15 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "645", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PURIFICACIÓN DE ADN MICROBIANO DE UNA VARIEDAD DE MUESTRAS DE ENTRADA QUE ESTÁ INMEDIATAMENTE LISTO PARA ANÁLISIS DE MICROBIOMA O METAGENOMA (ZYMOBIOMICS DNA MINIPREP). 50 REACTIVOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "646", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ENZIMATICO PYROMARK GOLD Q24 PARA LA TECNOLOGÍA DE PIROSECUENCIACIÓN. CONTIENE MEZCLA DE SUSTRATOS Y NUCLEOTIDOS. ANALIZA METILACIÓN DE DNA. 5X24 MUESTRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "647", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE TINCIÓN CON ROJO NEUTRO 100X PARA DETECCIÓN DE VIABILIDAD CELULAR POR MICROSCOPÍA (1000 ENSAYOS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "648", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA DE RT-PCR DE UN PASO CON ADN POLIMERASA. KIT CON 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "649", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCION DE SENESENCIA POR TINCION HISTOQUIMICA BASADO EN B-GALACTOSIDASA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "650", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SENESCENCIA CELULAR DE BETA-GALACTOSIDASA. CAJA / 100 TESTS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "651", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DETECCIÓN DE SENESCENCIA CELULAR, 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "652", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "50 X TAE BUFFER. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "653", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "JUEGO DE REACTIVOS DE SUSTRATO TMB. CONSTA DE 2 REACTIVOS CON 110 MILILITROS CADA UNO. KIT DE 2 FRASCOS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "654", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ELISA PARA TNF ALFA DISPONIBLES PARA RATONES, RATAS. 100 ENSAYOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "655", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA DETERMINACIÓN DE TNF-A HUMANO POR ELISA. KIT PARA 5 PLACAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "656", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA PARA DETERMINACIÓN DETNF-ALFA RATA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "657", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOUSE TNF ALPHA ELISA KIT, HIGH SENSITIVITY. KIT PARA 96 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "658", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DEL ENSAYO DE TUNEL-BROMOURIDINA, 50 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "659", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ENSAYO TUNEL-FITC 100 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "660", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROMETHION FLOW CELL (PAQ. 4)R10.4.1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "661", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NATIVE BARCODING KIT 24V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "662", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NATIVE BARCODE AUXILIARY V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "663", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLOW CELL WASH KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "664", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SEQUENCING AUXILIARY VIALS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "665", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "G-TUBE (10)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "666", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEBNEXT ULTRA II END REPAIR/DA24 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "667", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEBNEXTFFPEDNAREPAIRMIX24 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "668", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BLUNT/TA LIGASE MASTERMIX50 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "669", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEBNEXTQUICK LIGATIONMODULE20 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "670", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIGATION SEQUENCING KIT V14", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "671", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "SOSTÉN METÁLICO PARA SONDA DE SILICIO \"NEUROPIXEL 1.0\". CAJA DE 2 BARRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "672", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CABLE PARA CONEXIÓN DE ELECTRODOS \"NEUROPIXEL 1.0\"", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "673", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CABEZAL PARA ELECTRODOS \"NEUROPIXEL 1.0\"", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "674", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE SONDAS FICTICIAS \"NEUROPIXEL 1.0\" CON TAPA/CAPUCHÓN METÁLICO. CAJA CON 6 SONDAS FICTICIAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "675", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE CONTEO CELULAR DE ENSAYOS COLORIMÉTRICOS SENSIBLES PARA LA DETERMINACIÓN DE LA VIABILIDAD CELULAR EN ENSAYOS DE PROLIFERACIÓN CELULAR Y CITOTOXICIDAD. CAJA/ 100 TEST", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "676", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE ELECTRODOS DE REGISTRO ELECTROFISIOLÓGICO \"NEUROPIXEL PROBE 1.0\" CON TAPA/CAPUCHÓN METÁLICA *EXCLUSIVIDAD DE PRODUCCIÓN POR IMEC. CAJA CON 5 SONDAS DE SILICIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "677", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VINA GREEN CHROMOGEN KIT 25ML. CROMÓGENO PERMANENTE QUE PRODUCE UNA TINCIÓN VERDE EN PRESENCIA DE PEROXIDASA DE RÁBANO PICANTE (HRP). VINA GREEN ES ADECUADO TANTO PARA APLICACIONES DE INMUNOHISTOQUÍMICA (IHC) COMO DE HIBRIDACIÓN IN SITU (ISH). EL KIT CONSTA DE VINA GREEN CHROMOGEN (BRR807BC) 1 X 1 ML, VINA GREEN BUFFER (1 X 25 ML), DROPPER BOTTLE Y MIXING VIAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "678", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PRO FLUXPAK COMPATIBLE CON EL EQUIPO SEAHORSE XFE96/XF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "679", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAQUETE COMERCIAL PARA AISLAR DNA GENÓMICO Y RNA TOTAL A PARTIR DE PEQUEÑAS CANTIDADES DE PLASMA O SUERO DE HUMANOS,SALIVA, RASPADO BUCAL. CON ESTE KIT SE PROCESAN EFICAZMENTE CÉLULAS BUCALES Y UNA VARIEDAD DE LÍQUIDOS BIOLÓGICOS. INCLUYE COLUMNAS Y DIGESTIÓN CON PROTEINASA K. COMPATIBLE CON PAQUETE COMERCIAL DE TOMA DE MUESTRA DE SALIVA PARA DNA Y RNA. RENDIMIENTO DE = 5 µG DNA AND = 10 µG RNA. PAQUETE PARA 50 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "680", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA PARA PCR EN TIEMPO REAL PARA GENOTIPADO DE DNA, CON SONDAS DE HIDRÓLISIS O SONDAS TAQMAN OFRECE RESULTADOS DE GENOTIPADO PRECISOS CON UN GRAN RENDIMIENTO EN MENOS DE 50 MIN (AMPLIFICACIÓN RÁPIDA). LA MEZCLA MAESTRA VIENE CONCENTRADA (2X) Y ES COMPATIBLE CON EQUIPO STEP ONE O QUANT STUDIO; COMBINA ADN POLIMERASA RÁPIDA, UP, DNTP, TINTE DE SEGUIMIENTO Y TINTE ROX™ EN UN CÓMODO FORMATO DE VIAL ÚNICO. VOL. 1ML PARA 400 RXNS DE 5UL, CONCENTRACIÓN 2X. VIAL PARA 400 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "681", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA PAR PCR DE PUNTO FINAL EN UNA CONCENTRACIÓN 2X. CONTIENE DNTPS, MGCL2 Y TAMPÓN DE REACCIÓN EN CONCENTRACIONES ÓPTIMAS PARA UNA AMPLIFICACIÓN EFICIENTE DE PLANTILLAS DE ADN MEDIANTE PCR, TAMBIÉN CONTIENE ADN POLIMERASA DE ALTA FIDELIDAD Y CON ALTA VELOCIDAD DE ELONGACIÓN: 1 SEG PARA <1 KB 5 SEG/KB PARA <10 KB 10 SEG/KB PARA ~10 KB. VIAL PARA 500 REACCIONES (1 ML)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "682", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS2075650 DEL GEN HUMANO TOMM40 MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: GAGATGAGAGTTGGTGTGGGGTTGG[A/G]GTGGAGTGTGACAGCGTTTCTCTTC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "683", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA PARA PCR CUANTITATIVO EN TIEMPO REAL (QPCR), PARA USARSE CON SONDAS DE HIDRÓLISIS O SONDAS TAQMAN. COMPATIBLE CON TERMOCICLADORES DE TIEMPO REAL: QUANTSTUDIO Y STEPONE. ESTA MEZCLA MAESTRA PROPORCIONA RESULTADOS RÁPIDOS (<40 MINUTOS POR ADN POLIMERASA RECOMBINANTE MEJORADA) Y REPRODUCIBLES PARA TODAS LAS APLICACIONES DE QPCR BASADAS EN SONDAS. FRASCO DE 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "684", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA LIMPIAR REACCIONES DE PCR A PARTIR DE GEL DE AGAROSA O EN SOLUCIÓN POR COLUMNA. CONTIENE SOLUCIONES DE UNIÓN, LAVADO Y ELUCIÓN. PAQUETE DE 50 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "685", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PANEL DE INFLAMACIÓN HUMANA PERMITE LA EXPLORACIÓN DE LA FUNCIÓN INMUNITARIA MEDIANTE INMUNOENSAYOS TIPO ELISA PARA EL ANÁLISIS DE 20 PROTEÍNAS DIANA EN UN SOLO POCILLO A TRAVÉS DE LA TECNOLOGÍA LUMINEX XMAP. CONTIENE: CITOCINAS: GM-CSF, IFN ALFA, IFN GAMMA, IL-1 ALFA, IL-1 BETA, IL-4, IL-6, IL-8, IL-10, IL-12P70, IL-13, IL-17A (CTLA-8), TNF ALFA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "686", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA UNIVERSAL PARA SONDAS DE HIDRÓLISIS (2X), NO UNG AMPERASA, QUE OFREZCA RESULTADOS EN 40 MINUTOS PARA 40 CICLOS DE PCR EN TIEMPO REAL. DEBE CONTENER COLORANTE DE REFERENCIA PASIVA ROX Y SER COMPATIBLE CON EQUIPOS STEP ONE Y QUANTSTUDIO5. MEZCLA PARA LA IDENTIFICACIÓN DE GENOTIPOS DE ALTO RENDIMIENTO. 5ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "687", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAQUETE COMERCIAL PARA LA REALIZACIÓN DE REACCIONES DE METILACIÓN CUANTITATIVA POR PIROSECUENCIACIÓN (5 X 24) COMPATIBLE CON EQUIPO PYROMARK Q24 (ÚNICO EQUIPO EN EL MERCADO QUE REALIZA METILACIÓN CUANTITATIVA POR PIROSECUENCIACIÓN). EL KIT DEBE CONTENER MEZCLA DE SUSTRATOS (ADENOSINA-5'-FOSFOSULFATO Y LUCIFERINA) Y MEZCLA DE ENZIMAS (ADN-POLIMERASA, ATP-SULFURILASA) PARA LA PIROSECUENCIACIÓN, DATPAS , DCTP, DTTP, DGTP. CONSERVAR NUCLEÓTIDOS, ENZIMAS Y SUSTRATOS (SENSIBLES A LA LUZ) A 4–8 °C", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "688", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETATO DE TALIO. FRASCO 25 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "689", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "ADENOSINA 5'-TRIFOSFATO DE MAGNESIO. VIAL 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "690", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 4.0, FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "691", "cucop_code": "25901-1228", "specific_item_code": "25901", "cucop_description": "080.823.0288 SOLUCIÓNES AMORTIGUADORAS. SOLUCIÓN AMORTIGUADORA PH 7.0 PARA CALIBRACION DE POTENCIOMETROS. FRASCO CON 500 ML. TA.", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 7.0, FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "692", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 10.0, FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "693", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "1400W, N-(3-AMINOMETILL)BENCILACETAMIDINA, 2HCL. FRASCO 10MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "694", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "C1426-5G. CYCLOHEXANEDIAMINE. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "695", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CARBONILCIANURO-P-TRIFLUOROMETOXIFENILHIDRAZONA (FCCP) =98% (TLC), POWDER (10MG). FRASCO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "696", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CASEINATO DE SODIO, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "697", "cucop_code": "25901-1391", "specific_item_code": "25901", "cucop_description": "080.829.0571 REACTIVOS QUÍMICOS. CITRATO DE SODIO. 2H2O. RA. CRISTALES. FRASCO CON 1000 G. TA.", "description": "CITRATO DE SODIO, GRADO ANALÍTICO. 1 KG. FRASCO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "698", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROQUINA SAL DE DIFOSFATO = 98.5%, 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "699", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORURO DE BENZALCONIO 80%. FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "700", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CNQX DISODIUM SALT 10 MG ( 6-CYANO-7-NITROQUINOXALINE-2,3-DIONE, 6-CYANO-2,3-DIHYDROXY-7-NITRO-QUINOXALINA). BOTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "701", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CNQX C127-50MG. VIAL CON 50", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "702", "cucop_code": "25901-0687", "specific_item_code": "25901", "cucop_description": "080.610.0848 SUPLEMENTOS O ADITIVOS. DESOXICOLATO DE SODIO. Q.P. PARA AÑADIR A MEDIOS DE CULTIVO. FRASCO CON 100 G. TA.", "description": "COLATO DE SODIO PUREZA SUPERIOR A 98%. FRASCO 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "703", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORURO DE COBRE (II) 99%. FRASCO 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "704", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "CURCUMINA. POLVO AMARILLO, PESO MOLECULAR 368.38 G/MOL. FRASCO 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "705", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SULFATO DE COBRE PENTAHIDRATADO GRADO REACTVO, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "706", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIETIL DITIOCARBAMATO DE SODIO TRIHIDRATADO GRADO REACTIVO, 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "707", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIHIDROCLORURO DE PRAMIPEXOL: (S)-2-AMINO-4,5,6,7-TETRAHYDRO-6-(PROPYLAMINO)BENZOTHIAZOLE DIHYDROCHLORIDE) EN POLVO, PUREZA MAYOR AL 98% Y DE USO EN CROMATOGRAFÍA LÍQUIDA DE ALTA EFICACIA. VIAL DE 50 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "708", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ESTREPTOZOTOCINA (ESTROPTOZOCINA) > 98%, POLVO, >75% ANÓMERO ALFA. FRASCO CON 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "709", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FERROCIANURO DE POTASIO, 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "710", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUO-4 SAL DE PENTAPOTASIO, IMPERMEABLE A CÉLULAS. FRASCO DE 500 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "711", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FORMIATO DE AMONIO 5M EN AMPOLLETAS. PAQUETE DE 6 AMPOLLETAS CON 2.2ML C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "712", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FORMIATO DE SODIO. FRASCO 25 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "713", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO MONOBÁSICO DE POTASIO ACS, =99,0%. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "714", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS ACS, =99,0%. FRASCO 500 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "715", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DIBÁSICO DE SODIO DODECAHIDRATADO ACS, =99,0. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "716", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DE SODIO DIBÁSICO ( NA2HPO4) ANHIDRO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "717", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DE SODIO MONOBÁSICO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "718", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DE SODIO MONOBÁSICO ANHIDRO O REACTIVO ACS. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "719", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO ACS, =99,0%. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "720", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FUMARATO DE QUETIAPINE-D8 (ESTANDAR ANALÍTICO PARA LC/MS). VIAL 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "721", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ÁCIDO ¿-AMINOBUTÍRICO (GABA) EN POLVO O CRISTALES. FRASCO DE 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "722", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "D-(+)-GALACTOSA. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "723", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSA. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "724", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSA =99.5%. FRASCO 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "725", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GLUCONATO DE POTASIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "726", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GAMA GLUTAMIL NITROANILIDA (ÁCIDO L-GLUTÁMICO GAMA ANILIDA)=99%. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "727", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GLUTATIOL PUREZA SUPERIOR O IGUAL AL 98%, 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "728", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GUANOSINA 5'-TRIFOSFATO SÓDICO. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "729", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEPES; ÁCIDO 4-(2-HIDROXIETIL)PIPERACINA-1-ETANOSULFÓNICO, ÁCIDO N-(2-HIDROXIETIL)PIPERACINA-N'-(2-ETANOSULFÓNICO), 10 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "730", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEPES; ÁCIDO 4-(2-HIDROXIETIL)PIPERACINA-1-ETANOSULFÓNICO, ÁCIDO N-(2-HIDROXIETIL)PIPERACINA-N'-(2-ETANOSULFÓNICO). FRASCO DE 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "731", "cucop_code": "25901-1823", "specific_item_code": "25901", "cucop_description": "080.830.8498 REACTIVOS QUÍMICOS ÓXIDO ROJO DE MERCURIO. (ÓXIDO DE MERCURIO). RA. ACS. POLVO. FRASCO CON 500 G. TA.", "description": "OXIDO DE MERCURIO ROJO (HGO) ACS. POLVO. FRASCO DE 50 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "732", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXOKINASA DE SACCHAROMYCES CEREVISIAE, TYPE F-300, LYOPHILIZED POWDER, =130 UNITS/MG PROTEINA (BIURET), GRADO REACTIVO. FRASCO DE 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "733", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE POTASIO ACS, =99,0%. FRASCO DE 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "734", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-AP5. FRASCO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "735", "cucop_code": "25101-0061", "specific_item_code": "25101", "cucop_description": "CLORURO DE POTASIO", "description": "CLORURO DE MAGNESIO, ANIHIDRO, =98%, 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "736", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "METANOSULFONATO DE CESIO, USADO EN PARCHES. VIAL 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "737", "cucop_code": "25901-1416", "specific_item_code": "25901", "cucop_description": "080.829.0845 REACTIVOS QUÍMICOS METABISULFITO DE POTASIO (K2S2O5) O DISULFITO DE POTASIO. RA. FRASCO CON 500 G. TA.", "description": "METABISULFITO DE SODIO, 98-100.5%, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "738", "cucop_code": "25901-1850", "specific_item_code": "25901", "cucop_description": "080.830.9728 REACTIVOS QUÍMICOS CLORURO DE MAGNESIO.6 H2O. CRISTALES. RA. ACS. FRASCO CON 500 G. RTC.", "description": "CLORURO DE MAGNESIO HEXAHIDRATADO, 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "739", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOWIOL 488, PARA SU USO COMO MEDIO DE MONTAJE PARA INMUNOFLUORESCENCIA. POLVO. FRASCO CON 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "740", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOWIOL MOUNTING MEDIUM, POLI(VINIL ALCOHOL). FRASCO DE 250 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "741", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BROMURO DE 3-(4,5-DIMETILTIAZOL-2-IL)-2,5-DIFENILTETRAZOLIO (MTT), 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "742", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BROMURO DE AZUL DE TIAZOLILO DE TETRAZOLIO (MTT) (ADECUADO PARA CULTIVO CELULAR), 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "743", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORURO DE SODIO EN SOLUCIÓN AL 0.9%, ESTERIL. FRASCO 1 L.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "744", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORURO DE SODIO GRADO ACS =99,0%. FRASCO 500 G", "requested_quantity": "19", "minimum_quantity": "19", "maximum_quantity": "48", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "745", "cucop_code": "25901-1781", "specific_item_code": "25901", "cucop_description": "080.830.5320 REACTIVOS QUÍMICOS YODURO DE POTASIO. RA. ACS. CRISTALES O GRANULADO. FRASCO CON 500 G. TA.", "description": "YODURO DE SODIO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "746", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NITRITO DE SODIO GRADO REACTIVO =99.0%. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "747", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SULFATO DE AMONIO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "748", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SULFATO DE AMONIO GRADO REACTIVO, 10 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "749", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLORURO DE NÍQUEL (II) HEXAHIDRATADO GRADO REACTIVO, 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "750", "cucop_code": "25901-1785", "specific_item_code": "25901", "cucop_description": "080.830.5650 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS NICOTINAMIDA ADENINA DINUCLEOTIDO. FOSFATO SAL MONOSODICA (NADP). FRASCO CON 100 MG. RTC.", "description": "ß-NICOTINAMIDA ADENINA DINUCLEÓTIDO FOSFATO SAL SÓDICA HIDRATADA (NADP) 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "751", "cucop_code": "25901-1920", "specific_item_code": "25901", "cucop_description": "080.832.0451 REACTIVOS QUÍMICOS NITRO-AZUL DE TETRAZOLIO. 2-2-DI-P-NITROFENIL-5-5-DIFENIL-3-3-(3-3-DIMETOXI-4-4-DIFENILEN). CLORURO DE DITETRAZOLIO GRADO III. CRISTALES. FRASCO CON 5 G. RTC.", "description": "NITROAZUL DE TETRAZOLIO EN CRISTALES. FRASCO DE 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "752", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO N-METIL-D-ASPÁRTICO (NMDA), 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "753", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "POLI(ETILENGLICOL), PEG, PROMEDIO MN 6,000, HIDROXILO. 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "754", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PICROTOXINA 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "755", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PIRIDOXAL 5´-FOSFATO. FRASCO 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "756", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ROTENONA, GRADO ACS. 250 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "757", "cucop_code": "25901-1705", "specific_item_code": "25901", "cucop_description": "080.830.3622 REACTIVOS QUÍMICOS SACAROSA (SUCROSA). RA. ACS. CRISTALES. FRASCO CON 500 G. TA.", "description": "SACAROSA, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "758", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SAL DISÓDICA DE CARBENICILINA GRADO USP DE 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "759", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SR 95531 HIDROBROMURO 10 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "760", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SR-95531 S106-50MG. VIAL CON 50", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "761", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SULFATO DE ALUMINIO Y AMONIO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "762", "cucop_code": "25901-1710", "specific_item_code": "25901", "cucop_description": "080.830.3739 REACTIVOS QUÍMICOS SULFATO DE ALUMINIO Y POTASIO. 12 H2O. (ALUMBRE DE POTASIO). RA. CRISTALES. FRASCO CON 500 G. TA.", "description": "SULFATO DE ALUMINIO Y POTASIO. REACTIVO ACS. POLVO. FRASCO 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "763", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SAL DE TARTRATO DE HIDRÓGENO DE (-)-NICOTINA, 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "764", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TAUROCOLATO DE SODIO SUPERIOR O IGUAL AL 97%, 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "765", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TEMOZOLOMIDA DE PUREZA = 98%, 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "766", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SAL DE TETRABUTILAMONIO DE MALONDIALDEHÍDO (ESTÁNDAR ANALÍTICO), 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "767", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "O-VANADATO DE SODIO, 1 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "768", "cucop_code": "25101-0057", "specific_item_code": "25101", "cucop_description": "SULFATO DE ZINC", "description": "SULFATO DE ZINC HEPTAHIDRATADO 99.5-100.5%, FRASCO DE 100 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "769", "cucop_code": "25901-1684", "specific_item_code": "25901", "cucop_description": "080.830.3192 REACTIVOS QUÍMICOS ACETATO DE PLOMO. 3 H2O. RA. GRANULADO. FRASCO CON 250 G. TA.", "description": "ACETONA GRADO REACTIVO. 4 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "770", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ACETONITRILO GRADO HPLC, 1 GALÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "771", "cucop_code": "25101-0001", "specific_item_code": "25101", "cucop_description": "ACIDOS AROMATICOS (COMPUESTOS AROMATICOS)", "description": "CICLOHEXANO GRADO HPLC =99.9%, FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "772", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLOROFORMO GRADO BIOLOGÍA MOLECULAR. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "773", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CLOROFORMO; =99.8%, GRADO REACTIVO ACS, 4 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "774", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "DIMETIL SULFÓXIDO SOLVENTE, 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "775", "cucop_code": "25901-1746", "specific_item_code": "25901", "cucop_description": "080.830.4646 REACTIVOS QUÍMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ETANOL ABSOLUTO, NO DESNATURALIZADO GRADO BIOLOGÍA MOLECULAR, LIBRE DE RNASAS Y DNASAS. FRASCO 4 L", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": "13", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "776", "cucop_code": "25901-1746", "specific_item_code": "25901", "cucop_description": "080.830.4646 REACTIVOS QUÍMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "PORRÓN DE ALCOHOL ABSOLUTO. PORRÓN DE 20 L", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "777", "cucop_code": "25901-1746", "specific_item_code": "25901", "cucop_description": "080.830.4646 REACTIVOS QUÍMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ETANOL ABSOLUTO, 19 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "778", "cucop_code": "25901-1746", "specific_item_code": "25901", "cucop_description": "080.830.4646 REACTIVOS QUÍMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ALCOHOL AL 96% REACTIVO ANALÍTICO. PORRÓN DE 20 L", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": "17", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "779", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICEROL Ó 1,2,3-PROPANOTRIOL PARA BIOLOGÍA MOLECULAR, PUREZA MAYOR AL 99%, 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "780", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOPROPANOL. BOTELLA DE 1 L", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "781", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOPROPOXIDO DE TITANIO (IV) PUREZA MAYOR AL 97%, 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "782", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL RA ACS, 99.8% O ALCOHOL METÍLICO ACS, 4 L", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": "13", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "783", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL HPLC O ALCOHOL METÍLICO GRADO CROMATOGRAFÍA, 4 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "784", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-METILBUTANO. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "785", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-METILBUTANO. FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "786", "cucop_code": "25901-1604", "specific_item_code": "25901", "cucop_description": "080.830.0453 REACTIVOS QUÍMICOS. HIDRÓXIDO DE AMONIO (MÍNIMO 58%). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "HIDRÓXIDO DE AMONIO , PUREZA 30-33% NH3 EN AGUA. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "787", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "N,N-DIMETILFORMAMIDA. FRASCO 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "788", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TERT-BUTANOL. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "789", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TRIETILAMINA =99%. FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "790", "cucop_code": "25101-0004", "specific_item_code": "25101", "cucop_description": "ALCOHOLES AROMATICOS Y FENOLES (COMPUESTOS AROMATICOS)", "description": "XILENO GRADO REACTIVO ANALÍTICO. FRASCO 4 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "791", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "XILOL. PORRÓN DE 20 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "792", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "AZUL DE TOLUIDIDNA. FRASCO DE 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "793", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "CALCEÍNA AM DE ALTA PUREZA PARA MICROSCOPIA DE FLUORESCENCIA, 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "794", "cucop_code": "25901-0007", "specific_item_code": "25901", "cucop_description": "HEMATOXILINA", "description": "COLORANTE HEMATOXILINA DE HARRIS IISTA PARA USAR. FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "795", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE PARA TINCIÓN DE ÁCIDOS NUCLÉICOS HOECHST 33258 (10 MG/ML), 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "796", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EOSINA AMARILLENTA (EOSINA Y). POLVO. FRASCO CON 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "797", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FALOIDINA ALEXA FLUOR 594, FRASCO PARA 300 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "798", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FALOIDINA, SONDA PARA DETECCIÓN DE ACTINA FILAMENTOSA CONJUGADO A ALEXA FLUOR 488. VIAL CON 300 U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "799", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FRASCO DE TINCIÓN PARA 24 LAMINILLAS, DE PLÁSTICO, CON TAPA, TAMAÑO 10,5 X 5 X 11,5 CM", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "12", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "800", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SUDAN NEGRO. FRASCO 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "801", "cucop_code": "25901-0007", "specific_item_code": "25901", "cucop_description": "HEMATOXILINA", "description": "HEMATOXILINA, POLVO. FRASCO 25 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "802", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "HOMODÍMERO DE ETIDIO-1 (ETHD-1), 1 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "803", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÁPIZ HIDROFÓBICO PARA INMUNOTINCIÓN", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "9", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "804", "cucop_code": "25501-0104", "specific_item_code": "25501", "cucop_description": "LAPIZ PUNTA DIAMANTE", "description": "LÁPIZ PUNTA DIAMANTE TIPO PLUMA PARA MARCAJE DE MATERIAL DE VIDRIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "805", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE ACUOSO CON DAPI. FRASCO DE 10 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "806", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE ANTIDECOLORACIÓN CON DAPI (4',6-DIAMIDINO-2-FENILINDOL), 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "807", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "MEDIO DE MONTAJE BASADO EN GLICEROL ACUOSO QUE NO SE SOLIDIFIQUE, SINO SEA LÍQUIDO VISCOSO EN LA LAMINILLA, QUE NO SE SEQUE FÁCILMENTE AL MANTENER LA LAMINILLA SELLADA, MEZCLADO CON DAPI PARA TEÑIR LOS NÚCLEOS. FRASCO DE 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "808", "cucop_code": "25901-1437", "specific_item_code": "25901", "cucop_description": "080.829.1066 REACTIVOS QUÍMICOS RODAMINA B. PARA MICROSCOPIA. RA. FRASCO CON 500 G. TA.", "description": "RODAMINA FALOIDINA. FRASCO PARA 300 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "809", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SOLUCIÓN AZUL DE TRIPANO 0.4 % EN PBS (0.4% TRYPAN BLUE SOLUTION), 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "810", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ULTRACRUZ AQUEOUS MOUNTING MEDIUM (DAPI) 10 ML. STORE MOUNTED SLIDES AT 4° C PROTECTED FROM LIGHT. VIAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "811", "cucop_code": "25901-1870", "specific_item_code": "25901", "cucop_description": "080.831.3365 REACTIVOS QUÍMICOS BIS-ACRILAMIDA (NN-METILENBISACRILAMIDA). GRADO ELECTROFORESIS. PUREZA MÍNIMO DEL 99%. LIBRE DE DNASA RNASA Y ACTIVIDAD DE PROTEASAS. FRASCO CON 500 G. RTC.", "description": "ACRILAMIDA/BISACRILAMIDA 37,5:1 (SOLUCIÓN). FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "812", "cucop_code": "25901-1870", "specific_item_code": "25901", "cucop_description": "080.831.3365 REACTIVOS QUÍMICOS BIS-ACRILAMIDA (NN-METILENBISACRILAMIDA). GRADO ELECTROFORESIS. PUREZA MÍNIMO DEL 99%. LIBRE DE DNASA RNASA Y ACTIVIDAD DE PROTEASAS. FRASCO CON 500 G. RTC.", "description": "ACRYLAMIDA/BISACRYLAMIDA, 5X100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "813", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALFA Í HUMANA RECOMBINANTE EXPRESADA EN E. COLI MARCADA CON HISTIDINA EN LA REGIÓN N-TERMINAL CON PUREZA >90% (SDS-PAGE) POLVO LIOFILIZADO. VIAL DE 500 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "814", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALMOHADILLAS DE ESPUMA NEGRAS PARA CAMARA DE WESTERN BLOT 8 X11 CM. CAJA CON 4", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "815", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BÚFER BLOQUEADOR INTERCEPT (TBS) ES UNA FORMULACIÓN BLOQUEADORA LISTA PARA USAR EN TBS. NO CONTIENE AZIDA SÓDICA, LO QUE LO HACE ADECUADO TANTO PARA LA DETECCIÓN EN EL INFRARROJO CERCANO COMO PARA LA QUIMIOLUMINISCENCIA. 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "816", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE BLOQUEO CON TWEEN 20 PARA MEMBRANAS DE WESTERN BLOT. FRASCO DE 1 L", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "817", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "COLORANTE PARA GELES DE ACRILAMIDA COOMASSIE BIO-SAFE, G250. BOTE DE 5 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "818", "cucop_code": "25901-1863", "specific_item_code": "25901", "cucop_description": "080.831.3258 SUSTANCIA BIOLÓGICAS DITIOTREITOL (DTT). GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 G. R.", "description": "DITIOTREITOL (DTT). 5 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "819", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS DE 10 A 180 KDA (MARCADOR DE PESO MOLECULAR) PARA SU USO EN GELES DE POLIACRILAMIDA. PAQUETE CON 2 TUBOS DE 250 MICROLITROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "820", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "FRASCO DE 500 GRAMOS DE LECHE DESCREMADA PARA WESTERN BLOT. FRASCO 300 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "821", "cucop_code": "25901-1479", "specific_item_code": "25901", "cucop_description": "080.829.1876 REACTIVOS QUÍMICOS. GLICINA (GLICOCOLA). POLVO. FRASCO CON 100 G. TA.", "description": "GLICINA, 500 G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "822", "cucop_code": "25901-1479", "specific_item_code": "25901", "cucop_description": "080.829.1876 REACTIVOS QUÍMICOS. GLICINA (GLICOCOLA). POLVO. FRASCO CON 100 G. TA.", "description": "GLICINA EN POLVO (GRADO BIOLOGIA MOLECULAR), ADECUADA PARA SU USO EN ELECTROFORESIS. FRASCO CON 2 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "823", "cucop_code": "25901-1479", "specific_item_code": "25901", "cucop_description": "080.829.1876 REACTIVOS QUÍMICOS. GLICINA (GLICOCOLA). POLVO. FRASCO CON 100 G. TA.", "description": "GLICINA EN POLVO, ADECUADA PARA SU USO EN ELECTROFORESIS. FRASCO CON 1 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "824", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE PARA MEMBRANAS DE PVDF Y NITROCELULOSA. KIT CON 2 BOTELLAS DE 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "825", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "LECHE EN POLVO DESCREMADA (LIBRE DE GRASA) PARA APLICACIONES DE WESTERN BLOT. FRASCO DE 300 G", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "826", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE 8 A 240KDA PRETEÑIDO. 2 TUBOS DE 500 µL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "827", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE PROTEÍNAS PRETEÑIDO DE 2 A 250 KDA. VIAL 500 UL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "828", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PRE-TEÑIDO CON MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES PARA PROTEÍNAS DE 10 A 250 KDA, PARA 250 USOS, COMPATIBLE PARA WESTERN BLOT Y FLUORESCENCIA. VIAL 500 UL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "829", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEMBRANA DE FLUORURO DE POLIVINILIDENO (PVDF), CON PORO DE 0.45 µM, PARA SU USO EN WESTERN BLOT, ROLLO DE 26.5 CM X 3.75 M", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "830", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEMBRANA DE NITROCELULOSA DE 0.45 µM PARA APLICACIONES DE WESTERN BLOT. ROLLO DE 3 METROS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "7", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "831", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEMBRANA INMUNO-BLOT PVDF 26CMX3.3M PARA QUIMIOLUMINISCENCIA CON PORO DE 0.2 µM, CAPACIDAD DE UNIÓN 150-160 µG/CM2. ROLLO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "832", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEMBRANA NITROCELULOSA PARA TRANSFERIR ÁCIDO NUCLEICO Y PROTEÍNAS. TAMAÑO DE PORO DE 0,2 µM, ROLLO DE 30 CM X 3,5 M.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "833", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO DE CELULOSA CUALITATIVO GRADO 1, RETENCIÒN 11 µM, DIAMETRO 125MM. PAQUETE CON 100 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "834", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO DE CELULOSA GRADO 5, POROSIDAD MEDIA, RETENCIÓN 2.5 µM, FLUJO LENTO, DIÁMETRO 12.5CM, PAQUETE CON 100 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "835", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO DELGADO PARA WESTERN BLOT 7.5 X 10 CM. CAJA DE 60 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "836", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO EXTRA GRUESO PARA TRANSFERENCIA CON TURBO TRANSFER, TAMAÑO 7.5 X 10 CM. CAJA DE 60 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "837", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO PARA WESTERN BLOT EXTRA GRUESO 7.5 X 10 CM. PAQUETE DE 60 HOJAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "838", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIERCE ECL WESTERN BLOTTING SUBSTRATE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "839", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA DE UNIÓN A IGG KAPPA DE RATÓN (M-IGG¿ BP-HRP) CONJUGADA A PEROXIDASA DE RÁBANO PICANTE (HRP) VIAL CON 200 µG/0,5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "840", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REFERENCIA ESTANDAR DE PESO MOLECULAR PARA GELES DE ELECTROFORESIS. MEZCLA DE 10 PROTEÍNAS RECOMBINANTES (10–250 KD), 8 BANDAS TEÑIDAS DE AZUL Y 2 BANDAS DE REFERENCIA ROSADAS (25 Y 75 KD), 50 APLICACIONES", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "11", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "841", "cucop_code": "25901-1869", "specific_item_code": "25901", "cucop_description": "080.831.3357 REACTIVOS QUÍMICOS ACRILAMIDA. GRADO ELECTROFORESIS. PUREZA MINIMA DEL 99%. LIBRE DE DNASA RNASA Y ACTIVIDAD DE PROTEASAS. FRASCO CON 500 G. TA.", "description": "SOLUCIÓN DE ACRILAMIDA AL 40% P/V PARA ELECTROFORESIS PH= 6 A 7. FRASCO ÁMBAR DE 1L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "842", "cucop_code": "25901-1870", "specific_item_code": "25901", "cucop_description": "080.831.3365 REACTIVOS QUÍMICOS BIS-ACRILAMIDA (NN-METILENBISACRILAMIDA). GRADO ELECTROFORESIS. PUREZA MÍNIMO DEL 99%. LIBRE DE DNASA RNASA Y ACTIVIDAD DE PROTEASAS. FRASCO CON 500 G. RTC.", "description": "SOLUCIÓN DE BISACRILAMIDA AL 2% P/V PARA ELECTROFORESIS. FRASCO ÁMBAR DE 250 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "843", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO ECL PARA WESTERN BLOTTING. FRASCO DE 250 ML DE SOLUCIÓN DE PERÓXIDO Y UN FRASCO DE 250 ML SOLUCIÓN LUMINOL ENHANCER", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "844", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO QUIMIOLUMINISCENTE PARA INMUNODETECCIÓN BASADA EN QUIMIOLUMINISCENCIA DE LA PEROXIDASA DE RÁBANO (HRP) EN MEMBRANAS DE INMUNOTRANSFERENCIA. CAJA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "845", "cucop_code": "25501-0038", "specific_item_code": "25501", "cucop_description": "RIEL CLIPS", "description": "ABRAZADERAS DE ALEACIÓN DE ALUMINIO PARA MANTENER FIJAS LAS PINZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "846", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "AGUJA EQUIPO ALADO MARIPOSA 23X19MM AZUL PARA TOMA Y RECOLECCIÓN DE SANGRE AL VACÍO. CAJA CON 50 PIEZAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "847", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "AGUJA PARA TOMA Y RECOLECCIÓN DE SANGRE AL VACÍO 21G X 1\" (0.8 X 25 MM) ESTÉRILES, DESECHABLES. CAJA CON 100 UNIDADES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "848", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "AGUJAS PARA VACUTAINER TAMAÑO: 21G X 38 MM. COLOR: VERDE. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "849", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "ALAMBRE DE PLATA DE 0.01 PULGADAS CORTADO A LA MEDIDA Y ENROLLADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "850", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "APLICADORES CON ALGODÓN DE PLÁSTICO, ESTÉRILES Y DESECHABLES DE 15 CM. PAQUETE CON 100 BOLSAS CON 3 APLICADORES C/U", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "851", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "APLICADORES DE ALGODÓN CON PALILLO DE PLÁSTICO (HISOPOS) ESTÉRILES. DIVIDIDO EN PAQUETES DE 3 PIEZAS. PAQUETE CON 300 APLICADORES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "852", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BANDAS ADHESIVAS CIRCULARES (CURITAS), DESECHABLES, ESTÉRILES, RESISTENTES AL AGUA 0.22MM DE DIÁMETRO. CAJA CON 100 UNIDADES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "853", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BANDEJA DE POLIPROPILENO ESTERILIZABLE EN AUTOCLAVE 10X3X3 CM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "854", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BISTURÍ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "855", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOMBA DE JERINGA. MODO DE TRABAJO: INFUSION, PARA UNA JERINGA, 10 µL-60 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "856", "cucop_code": "25501-0018", "specific_item_code": "25501", "cucop_description": "FRASCO AMBAR", "description": "BOTELLA DE BOROSILICATO DE VIDRIO AMBAR, CUELLO ROSCADO ANCHO CON TAPAROSCA (GL 45 COLOR AZUL Y ANILLO DE VERTIDO EN POLIPROPILENO). 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "857", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "BROCHA DE 1/2 PULGADA PARA LIMPIAR BALANZA ANALÍTICA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "858", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA AUTOCLAVABLE PARA ALMACENAMIENTO DE MICROTUBOS CON 100 ESPACIOS DE 12.3 MM DE DIÁMETRO, COMPATIBLE CON TUBOS DE 1.5 Y 2 ML O VIALES CRIOGÉNICOS, RANGO DE TEMPERATURA DE -80 A 121 °C Y UTILIZARSE EN ULTRACONGELADOR. PAQUETE DE 5 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "859", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA CON 20 PLACAS ÓPTICAS DE 48 POZOS COMPATIBLES CON EQUIPO DE PCR EN TIEMPO REAL STEP ONE", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "860", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE FILAMENTOS P-97", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "861", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE PLACAS INDIVIDUALES DE 96 POZOS DE POLIESTIRENO DE MITAD DE ÁREA CON TAPA, FONDO PLANO, PRECARGADAS, NO PIROGÉNICAS, ESTÉRILES PARA CULTIVO CELULAR. CAJA CON 100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "862", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE PLACAS PARA CULTIVO CELULAR DE 24 POZOS DE POLIESTIRENO CON FONDO PLANO, NO PIROGÉNICAS, ESTÉRILES, EMPACADAS INDIVIDUALMENTE. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "863", "cucop_code": "25501-0183", "specific_item_code": "25501", "cucop_description": "080.171.0070 CANASTILLAS. PARA TINCION DE 50 LAMINILLAS. DE ACERO INOXIDABLE CON ASA REMOVIBLE. PIEZA", "description": "CAJA PARA ALMACENAR PORTAOBJETOS (LAMINILLAS). CON CAPACIDAD PARA ALMACENAR 100 LAMINILLAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "864", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA REFRIGERANTE (NEVERA) PARA 12 MICROTUBOS DE 1.5 ML. BASE Y TAPA DE POLICARBONATO. ARREGLO DE 3X4. MANTIENE TEMPERATURAS INFERIORES A -15°C HASTA POR 1 HORA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "865", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE ALMECENAMIENTO PARA CONGELACIÓN DE MICROTUBOS DE 0.5 ML (TRANSPARENTE O COLORES)", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "866", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE 6 POZOS PARA CULTIVO CELULAR CON INSERTO DE MEMBRANA DE POLIÉSTER DE PORO DE 0,4 µM, TRATADO, CON TAPA, ESTÉRIL. CAJA CON 24 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "867", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE CULTIVO DE 400 MICROPOCILLOS POR 24 MULTIPOZOS PARA GENERACIÓN FÁCIL Y REPRODUCIBLE DE CUERPOS EMBRIOIDES Y ESFEROIDES. CAJA CON 5 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "868", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLATO DE CULTIVO CELULAR DE 90 X 20 MM, ÁREA DE CRECIMIENTO 57.5 CM2, DE POLIESTIRENO, ESTÉRILE. TRATADOS CON TC NO PIRÓGENO O CITÓXICO. CAJA CON 200 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "869", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE CULTIVO ESTÉRILES DE 6 POZOS SIN TRATAMIENTO (ULTRA BAJA RETENCIÓN) PLACA DE 6 POZOS NO TRATADA, FONDO PLANO CON TAPA, ESTÉRIL, ENVUELTA INDIVIDUALMENTE. CAJA CON 60 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "870", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE 6 OPOZOS ANTI-ADHERENTES ESTÉRILES. CAJA CON 50 PLACAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "871", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE 6 POZOS TRATADAS CON FONDO PLANO, NO PIROGÈNICAS, ESTÈRILES. 100 CAJAS DE CULTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "872", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE CULTIVO ESTÉRILES DE 96 POZOS SIN TRATAMIENTO (ULTRA BAJA RETENCIÓN) PLACAS DE POLIESTIRENO, ESTÉRILES NO TRATADAS PARA CULTIVO CELULAR, CON TAPA ESTÉRILES, ENVUELTAS INDIVIDUALMENTE. CAJA CON 6 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "873", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE 96 POZOS DE POLIESTIRENO PARA CULTIVO DE ESFEROIDES CON TAPA, FONDO REDONDO, ESTÈRIL, LIBRE DE ENDOTÒXINA, APIROGÉNICAS. 50 CAJAS DE CULTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "874", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE 96 POZOS TRATADAS CON FONDO PLANO CON TAPA, DE POLIESTIRANO, NO PIROGÈNICAS, ESTÈRILES. 50 CAJAS DE CULTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "875", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS PARA LA TÉCNICA DE ELISA DE 96 POZOS CON TAPA. FABRICADAS EN POLIESTIRENO TRANSPARENTE CON EXCELENTE CALIDAD ÓPTICA, IDEAL PARA MEDICIONES ÓPTICAS. PAQUETE CON 6 CAJAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "876", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁMARA DE 8 POZOS DE VIDRIO PARA CULTIVO CELULAR, ESTÉRILES, CON TAPA. CAJA CON 96 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "877", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAMARA PARA CULTIVO 4 POZOS DE POLIESTIRENO. PORTAOBJETOS ESTÉRIL 25 X 75 MM, CON 4 POZOS DE POLIESTIRENO PARA CULTIVO DE CÉLULAS. CAJA CON 16 PORTAOBJETOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "878", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS TRANSWELL DE 12 POZOS CON INSERTOS DE 12MM Y MEMBRANA DE 3µ M, PARA CULTIVO CELULAR, ESTÈRILES. PAQUETE DE 12, CAJA DE 48", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "879", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁMARA DE CONTEO CELULAR, HEMOCITÓMETRO NEUBAUER MEJORADA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "880", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁMARA HÚMEDA OSCURA PARA INMUNOHISTOQUÍMICA (38 X 24 X 4.5 CM)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "881", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "CÁMARAS DE ELECTROFORESIS VERTICAL PARA PROTEÍNAS CON TANQUE, TAPA CON CABLES Y ENSAMBLE DE ELECTRODOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "882", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "CÁMARAS DE TRANSFERENCIA VERTICAL PARA PROTEÍNAS CON TANQUE, TAPA CON CABLES Y ENSAMBLE DE ELECTRODOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "883", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "CAMPO QUIRÚRGICO ADHESIVO CON FENESTRACIÓN DE 7.5 CM DE DIÁMETRO HENDIDO SMS 50X70CM CON ADHESIVO ESTERIL BOLSA C/10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "884", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA DE MICRODIÁLISIS HECHA PARA MOLÉCULAS DE MÁXIMO 6 KDA, MEMBRANA PES CON LONGITUD DE 2 MM, DIÁMETRO EXTERNO DE 0.2 MM, LONGITUD TOTAL DEL EJE 4 MM, PARA MICRODIÁLISIS EN RATÓN, TIPO MAB 8.4.2, 3 PZAS/PQ", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "885", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA DE MICRODIÁLISIS PARA MOLÉCULAS DE MÁXIMO 6 KDA, MEMBRANA PES DE 2 MM, DÍAMETRO EXTERNO 0.6 MM, LONGITUD TOTAL DEL EJE 14 MM, PARA MICRODIÁLISIS EN RATA, TIPO MAB 9.14.2, 3 PZAS/PQ", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "886", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA ESOFÁGICA 7914 CÁNULA ESOFÁGICA DE ACERO INOXIDABLE PARA SUMINISTRO DE MEDICAMENTOS O ALIMENTO, PARA RATÓN DE 100 A 200 G. CURVA CAL. 18 X 3\", MODELO: 7914. MCA. CADENCE SCIENCE, INC. E.U.A.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "887", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA GUÍA FABRICADA EN KEL-F 7.5MM OD Y ACERO INOXIDABLE, 14 MM DE LONGITUD, REUSABLES, CON MECANISMO DE CIERRE 1/4 DE VUELTA COMPATIBLES CON CÁNULAS DE MICRODIÁLISIS MAB 9.14.2, 1 PZA/PAQ", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "888", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA METÁLICA PARA ADMINISTRACIÓN ORAL EN LA RATA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "889", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULAS PARA GUÍA INTRACEREBRAL 10 MM LONGITUD PARA MICRODIÁLISIS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "890", "cucop_code": "25501-0051", "specific_item_code": "25501", "cucop_description": "TUBOS CAPILARES", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.2, I.D. 0.94 LAGO 10 CM, TUBO CON 25", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "891", "cucop_code": "25501-0051", "specific_item_code": "25501", "cucop_description": "TUBOS CAPILARES", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D 1.65, I.D 1.20 LARGO 10 CM, TUBO CON 140", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "892", "cucop_code": "25501-0051", "specific_item_code": "25501", "cucop_description": "TUBOS CAPILARES", "description": "(FB330B 3.0 MM SQUARE BOX FILAMENT, 3.0MM WIDE)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "893", "cucop_code": "25501-0051", "specific_item_code": "25501", "cucop_description": "TUBOS CAPILARES", "description": "CAPILARES DE BOROSILICATO SIN FILAMENTO DE O.D 1.65, I.D 1.20 LARGO 10 CM, TUBO CON 140", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "894", "cucop_code": "25501-0051", "specific_item_code": "25501", "cucop_description": "TUBOS CAPILARES", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.5, I.D. 0.86 LARGO 10 CM, TUBO CON 250", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "895", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CASSETE PARA INCLUSIÓN DE TEJIDOS EN PARAFINA. CAJA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "896", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CASSETES DE INCLUSIÓN PARA MICROPROCESAMIENTO CON 6 COMPARTIMIENTOS, DE POLÍMERO DE ACETAL DE 7 X 12 X 5 MM, CON 3000 ABERTURAS CUADRADAS DE 0,36 MM. CAJA C/100 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "897", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CELDA DE CUARZO DE CUATRO CARAS TRANSPARENTES CON VOLUMEN DE 3.5ML Y LONGITUD DE PASO ÓPTICO DE 10MM, ALTURA 45 MM. CAJA 2 CELDAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "898", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CEPO O CONTENEDOR RATA CONTENEDOR CONTENEDOR DE ACRÍLICO TRANSPARENTE PARA ROEDOR. MODELO: RATÓN, MEDIDAS: 3.6 X 3.3 X 8.8 CM.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "899", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CEPO O CONTENEDOR RATA CONTENEDOR DE ACRÌLICO TRANSPARENTE PARA ROEDOR. MODELO: RATA GDE, MEDIDAS: 7.0X6.0X25.0 CM. (RATAS DE 200 A 250 G.)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "900", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CEPO O CONTENEDOR RATA CONTENEDOR DE ACRÍLICO TRANSPARENTE PARA ROEDOR. MODELO: RATA MEDIANA, MEDIDAS: 6.0X5.5X20 CM. (RATAS DE 125 A 200 G).", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "901", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CINTA TESTIGO PARA MARCAR MATERIAL ESTERILIZADO DE 1.8 CM DE ANCHO Y 50 M DE LARGO", "requested_quantity": "22", "minimum_quantity": "22", "maximum_quantity": "56", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "902", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA C18 PARA CROMATOGRAFÍA DE LÍQUIDOS DE ALTA RESOLUCIÓN : 20% DE CARGA DE CARBONO,TEMPERATURA DE OPERACIÓN IGUAL O MENOR A 70 GRADOS CELSIUS. LXDI: 25 CM X 4.6 MM. GRUPO ACTIVO MATRIZ: FASE C18 (OCTADECILO). TAMAÑO DE PARTÍCULA: 5 µ M. TAMAÑO DE PORO: 70 Å", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "903", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA C18 PARA CROMATOGRAFÍA DE LÍQUIDOS DE ALTA RESOLUCIÓN: CARGA DE CARBONO 10%, DIÁMETRO INTERNO 4.6 MM, LARGO 150 MM. TAMAÑO DE PARTÍCULA DE 3.5 MICRÓMETROS Y PH DE TRABAJO 2.0-9.0 .TEMPERATURAS DE OPERACIÓN : 40°C A PH 6-9, TAMAÑO DE PORO 80ANGSTROMS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "904", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA C18 PARA CROMATOGRAFÍA DE LÍQUIDOS DE ALTA RESOLUCIÓN: CARGA DE CARBONO 10%, DIÁMETRO INTERNO 4.6 MM, LARGO 150 MM. TAMAÑO DE PARTÍCULA DE 5 MICRÓMETROS Y PH DE TRABAJO 0.8-8.0 . TEMPERATURAS DE OPERACIÓN : 40°C A PH 6-8, TAMAÑO DE PORO 80ANGSTROMS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "905", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA PARA CROMATOGRAFÍA DE LÍQUIDOS C18 150 X 3.9 MM, TAMAÑO DE PARTÍCULA 5MICROMETROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "906", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNAS LS PARA SEPARACIÓN POSTITIVA DE CÉLULAS COMPATIBLE CON MICROPERLAS MAGNÉTICAS. 25 PZAS/PQ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "907", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CONECTORES EMBRIDADOS DE TEFLÓN, TRANSPARENTES PARA TUBERÍA DE TEFLÓN FEP PARA MICRODIÁLISIS, DIÁMETRO EXTERNO 0.65 MM X 0.12 MM DIÁMETRO INTERNO. 20/PK", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "908", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRIOTUBOS DE 2 ML DE POLIPROPILENO (ROSCADO)CON TAPA, FONDO REDONDO, ESTÉRIL, SIN PIRÓGENOS. PARA TEMPERATURAS DE -190 ° C. CON ARANDELA DE SILICONA. BOLSA CON 1000 PIEZAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "909", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRIOVIALES CRIOGÉNICOS DE 2 ML MICRO TUBOS DE POLIPROPILENO CLARO, ESTÉRILES, CON GRADUACIÓN Y FALDÓN PARA SOSTENERSE VERTICALES, RESISTENTES TEMPERATURAS HASTA DE -196°C. TAPA DE ROSCA INCLUÍDA, CIERRE HERMÉTICO. BOLSA CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "910", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CRISTALIZADOR DE 150 X 75 MM DE VIDRIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "911", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CRISTALIZADOR DE 190 X 100 MM DE VIDRIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "912", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CRISTALIZADOR DE 90 X 50 MM DE VIDRIO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "913", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBRE OBJETOS DE BOROSILICATO REDONDOS INCOLOROS PARA MICROSCOPIA DE FLUORESCENCIA DE 14MM. CAJA 100", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "914", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBREOBJETOS 24 X 24. CAJA CON 100 PIEZAS", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": "40", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "915", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBREOBJETOS DE 24 X 24 MM. CAJA CON 50 PIEZAS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "916", "cucop_code": "25501-0106", "specific_item_code": "25501", "cucop_description": "CUCHILLAS PARA MICROTOMO", "description": "CUCHILLA DE DIAMANTE ULTRA 45° PARA MICROSCOPÍA ELECTRÓNICA, TAMAÑO 1.5; TIPO ULTRA; ÁNGULO 45° (TESTED WITH CI. ANGLE 6°) SPEED /S NUEVA O A CAMBIO DE LA YA EXISTENTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "917", "cucop_code": "25501-0106", "specific_item_code": "25501", "cucop_description": "CUCHILLAS PARA MICROTOMO", "description": "CUCHILLAS DE ALTO PERFIL DESECHABLE DE ACERO INOXIDABLE PARA ELABORAR CORTES FINOS DE ALTA CALIDAD PARA HISTOTECNOLOGÍA, 80MM DE LARGO X 14MM DE ALTO X 0.35MM DE ESPESOR. CAJA CON 50 UNIDADES, PARA MICROTOMO DE PARAFINA. CAJA CON 50 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "918", "cucop_code": "25501-0106", "specific_item_code": "25501", "cucop_description": "CUCHILLAS PARA MICROTOMO", "description": "CUCHILLAS DESECHABLES DE PERFIL ALTO 80 X 8 MM. CAJA CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "919", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "DISPOSITIVOS DE DIÁLISIS SLIDE-A-LYZER MINI, TAPONES DE POLIPROPILENO DESECHABLES CON MEMBRANAS DE BAJA UNIÓN INTEGRADAS PARA DIÁLISIS Y UNA ALTA RECUPERACIÓN DE PROTEÍNAS Y MACROMOLÉCULAS DE MÁS DE 20 KDA, VOLUMEN DE MUESTRA DE 0.5 ML, PAQ 25 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "920", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "DISPOSITIVOS DE DIÁLISIS SLIDE-A-LYZER MINI, TAPONES DE POLIPROPILENO DESECHABLES CON MEMBRANAS DE BAJA UNIÓN INTEGRADAS PARA DIÁLISIS Y UNA ALTA RECUPERACIÓN DE PROTEÍNAS Y MACROMOLÉCULAS DE MÁS DE 20 KDA, VOLUMEN DE MUESTRA DE 2 ML, PAQ 25 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "921", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "EQUIPO PARA VENOCLISIS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "922", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ESPÁTULA CON PUNTA DE CUCHARA 10 CM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "923", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESPONJA DE GASA10X10CM. BOLSA CON 200PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": "25", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "924", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "ESTACIÓN DE TRABAJO PARA 4 PIPETAS TIPO EPPENFORD CON DISPENSADOR DE PUNTAS CON TAPA DE ACRÍLICO 9 5/8\"W X 9 11/16 \"H X 6 1/2\" L.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "925", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "ESTUCHE DE DISECCIÓN 12 PIEZAS ACERO INOXIDABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "926", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FB215 B 2.1X5 MM. TUBO PAQUETE CON 5", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "927", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTRO DE JERINGA DE PVDF TAMAÑO DE PORO DE 0.45 µM, DIAMETRO 33MM. CAJA CON 1000 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "928", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTRO DE MEMBRANA (PP, PTFE) DE 3µM PARA AUXILIARES DE PIPETEADO, NO ESTÉRIL. BOLSA CON 10 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "929", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE JERINGA DE PVDF 0.22 DE 33 MM. CAJA 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "930", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE JERINGA PARA LABORATORIO (MEMBRANA DE PVDF 0.22 UM Y 13 MM DE DIÁMETRO). ESTÉRILES, PAQUETE CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "931", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE JERINGA PARA LABORATORIO (MEMBRANA DE PVDF 0.22 UM Y 4 MM DE DIÁMETRO). ESTÉRILES, PAQUETE CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "932", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE JERINGA PARA LABORATORIO (MEMBRANA DE PVDF 0.45 UM Y 13 MM DE DIÁMETRO). ESTÉRILES, PAQUETE CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "933", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE NITROCELULOSA CON PORO DE 0.22 MICRAS Y 45 MM DE DIÁMETRO, AUTOCLAVEABLES. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "934", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS ESTÉRILES DE PRE-SEPARACIÓN CELULAR COMPATIBLES CON TUBOS CÓNICOS DE 5, 13 Y 15 ML, COLUMNAS MAGNÉTICAS LS. MS, CON MALLA DE 20 UM, CAJA 50 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "935", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS ESTÉRILES DE PRE-SEPARACIÓN CELULAR COMPATIBLES CON TUBOS CÓNICOS DE 5, 13 Y 15 ML, COLUMNAS MAGNÉTICAS LS. MS, CON MALLA DE 30 UM, CAJA 50 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "936", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS ESTÉRILES DE PRE-SEPARACIÓN CELULAR COMPATIBLES CON TUBOS CÓNICOS DE 5, 13 Y 15 ML, COLUMNAS MAGNÉTICAS LS. MS, CON MALLA DE 70 UM, CAJA 50 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "937", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS PARA CENTRÍFUGA DE 0.5ML , 3K, DE CELULOSA REGENERADA 3000NMWL, CAJA CON 96 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "938", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS PES ESTÉRILES ENROSCABLES EN BOTELLAS DE CUELLO DE 45MM PARA CULTIVO CELULAR, CAJA CON 12 FILTROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "939", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE BOROSILICATO CON TAPON DE ROSCA AZUL 1000 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "940", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE BOROSILICATO CON TAPON DE ROSCA AZUL 2000 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "941", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE CULTIVO CELULAR 25 CM2. FRASCO DE CULTIVO CELULAR ESTÉRIL CON TAPA VENTILADA CON FILTRO 0.2 MICRAST25. CAJA CON 200 PIEZAS (10 FRASCOS POR BOLSA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "942", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCOS DE 25 CM2 PARA CULTIVO CELULAR CON FILTRO EN LA TAPA PRETRATADOS NON-PYROGENICO, LIBRES DE RNASE/DNASE PARA CÉLULAS ADHERENTES, ESTÉRILES. CAJA CON 200 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "943", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO ÁMBAR DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 250ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "944", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO ÁMBAR DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 500ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "945", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO TRANSPARENTES DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 1000ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "946", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO TRANSPARENTES DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 500ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "947", "cucop_code": "25501-0138", "specific_item_code": "25501", "cucop_description": "080.100.0027 BOTELLA DE POLIESTIRENO PARA CULTIVO ESTÉRIL DESECHABLE DE 50 ML. CUELLO CURVO, TRIANGULAR. CAJA CON 500 PIEZAS", "description": "FRASCOS DE VIDRIO ÁMBAR DE BOCA ANCHA CON TAPA DE 50 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "948", "cucop_code": "25501-0525", "specific_item_code": "25501", "cucop_description": "MATERIAL DE LABORATORIO", "description": "FRESAS DE CARBURO SSW HP-1", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "949", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA ENFRIADORAS \"COOLER\" PARA PLACAS DE 96 POZOS PARA USO EN PCR .", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "950", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA MULTITUBOS DE 4 CARAS PARA TUBOS DE 0.5, 1.5, 2, 15 Y 50 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "951", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA REVERSIBLE PARA 64 LUGARES PARA TUBOS DE 0.6. 1.6-2.0 ML. PAQUETE CON 5 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "952", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLAS PARA TUBOS DE 0.6 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "953", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "HERRAMIENTA DE INSTALACIÓN DE TAPONES MICROAMP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "954", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJA DE BISTURÍ NUM. 20 CAJA ESTÉRIL CAJA C/100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "955", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJAS PARA BISTURI # 10", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "956", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJAS PARA BISTURI # 15", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "957", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR PARA TEJIDO TIPO POTTER ELVEHJEM 2ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "958", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR PARA TEJIDO TIPO POTTER ELVEHJEM DE 5 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "959", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 0.1 ML O 100 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "960", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 10 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "961", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 50 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA AFILADA/BISELADA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "962", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 50 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "963", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA TIPO HAMILTON DE 10 UL CON BISEL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "964", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA TIPO HAMILTON DE 10 UL SIN BISEL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "965", "cucop_code": "25501-0536", "specific_item_code": "25501", "cucop_description": "BARRA AGITADORA MAGNÉTICA", "description": "JUEGO DE AGITADORES MAGNÉTICOS BLANCOS DE DIFERENTES MEDIDAS, EN FORMA OCTAGONAL CON ANILLO AL CENTRO Y DOS MEDIDAS DIFERENTES EN FORMA MICRO. ESTUCHE CON 16 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "966", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE BANDEJA/RETENEDOR MICROAMP DE 96 POCILLOS. CAJA DE 10 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "967", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE BARRAS MAGNÉTICAS VARIOS TAMAÑOS. 20 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "968", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE MATRIZ DE MOLDES (KIT ARRAYMOLD) DE 4MM DE DIÁMETRO PARA 15 MUESTRAS (NÚCLEOS). ES UN MOLDE DE CAUCHO PARA REALIZAR INCLUSIÓN DE 15 MICROMUESTRAS DE TEJIDO AL MISMO TIEMPO. ES UTILIZADO PARA ENCONTRAR MARCADORES IHC. EL KIT INCLUYE 10 SACABOCADOS DE 4 MM, 2 NAVAJAS O STYLETES, UNA PLACA DE LATÓN, MOLDE PARA LA INCLUSIÓN DE 15 MUESTRAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "969", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MACROPUNTAS PARA PIPETAS DE 1 A 5 ML . PUNTAS MACRO PARA PIPETA DE VOLUMEN VARIABLE DE 1 A 5 ML DIÁMETRO INTERNO 13.3 MM, AUTOCLAVEABLES, LONGITUD 15 CM. BOLSA CON 200", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "970", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MANGUERA DE LÁTEX CON DIÁMETRO INTERNO DE 6 MM X 9 MM DE GROSOR, 5 M", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "971", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MANGUERA DE LÁTEX CON DIÁMETRO INTERNO DE 8 MM X DIAMETRO EXTERNO 12 MM, 5 M", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "972", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADORES INDELEBLES PARA CRIOVIALES PAQUETE CON 4 (ROJO, AZUL, VERDE Y NEGRO).", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "973", "cucop_code": "25501-0268", "specific_item_code": "25501", "cucop_description": "080.602.0541 MATRACES DE VIDRIO REFRACTARIO CON GRADUACION APROXIMADA Y CON LABIO TIPO ERLENMEYER. PARA VOLUMENES DE: 1000 ML. PIEZA.", "description": "MATRAZ ERLENMEYER DE VIDRIO CON BOCA ESMERILADA DE 1 LITRO.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "974", "cucop_code": "25501-0283", "specific_item_code": "25501", "cucop_description": "080.602.1523 MATRACES ESPECIALES PARA FILTRAR AL VACIO DE VIDRIO REFRACTARIO. TIPO KITASATO. PARA VOLUMENES DE: 1000 ML. PIEZA.", "description": "MATRAZ KITASATO DE VIDRIO REFORZADO 1000 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "975", "cucop_code": "25501-0283", "specific_item_code": "25501", "cucop_description": "080.602.1523 MATRACES ESPECIALES PARA FILTRAR AL VACIO DE VIDRIO REFRACTARIO. TIPO KITASATO. PARA VOLUMENES DE: 1000 ML. PIEZA.", "description": "MATRAZ KITASATO DE VIDRIO REFORZADO 2000 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "976", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 1 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "977", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 10 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "12", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "978", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 2 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "979", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 5 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "980", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "MEMBRANA PARA FILTRACIÓN DE DISOLVENTES ORGÁNICOS (HIDROFÓBICA) TIPO HVLP 0.45 MICRAS DE PORO. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "981", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICRO CLIP PARA ANEURISMA, CURVO, LARGO: 1 CM, ACERO INOXIDABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "982", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROFIL AGUJA FLEXIBLE CALIBRE 28, ID 250, OD 350, LARGO 97", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "983", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROINSERTOS DE VIDRIO COLOR CLARO, DE FONDO CÓNICO CON RESORTE, 5MMX29MM, 0.25 ML PARA CROMATOGRAFÍA, PQ/100", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "984", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROJERINGA DE VIDRIO 10 µL X 51 MM, CALIBRE DE AGUJA DE 26 S PARA MICROINYECCIÓN DE LÍQUIDOS EN ESTEREOTÁXICO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "985", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICRO JERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACIÓN DE 1 MICROLITRO, PUNTA BISELADA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "986", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA CON MEMBRANA TIPO TRANSWELL DE 24 POZOS CON INSERTOS DE 6.5 MM Y MEMBRANA DE 0.4 µM CON TAPA, PARA CULTIVO CELULAR, ESTÈRILES. PAQUETE DE 24, CAJA DE 48", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "987", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA CON MEMBRANA TRANSWELL DE 6.5 MM (8µM) CON 24 POZOS ESTÉRIL. PAQUETE CON 4 PLACAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "988", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA DE 96 POZOS MEDIA ÁREA, ESTÉRIL CON TAPA. PAQUETE CON 20 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "989", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA DE POLIESTIRENO SÓLIDAS DE 96 POZOS DE FONDO PLANO, SIN TRATAMIENTO Y DE COLOR BLANCO Y OPACAS. NO ESTÉRIL Y SIN TAPA . PAQUETE CON 25 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "990", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA DE 96 POZOS NO TRATADA, MEDIA ÁREA, NEGRA CON TAPA FONDO PLANO, ESTÉRIL. PAQUETE CON 25 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "991", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MULTIPLACA PARA CULTIVO CELULAR CON 6 POZOS, DE POLIESTIRENO TRATADA CON TC NO PIRÓGENO O CITOTÓXICO, FONDO PLANO, CON TAPA, ESTERIL, ENVOLTURA INDIVIDUAL. CAJA CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "992", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACA DE POLIESTIRENO DE 96 POZOS CON FONDO EN U, ESTÉRIL, CON TAPA, CON IDENTIFICACIÓN ALFANUMÉRICA, EMPACADA INDIVIDUALMENTE. CAJA CON 50 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "993", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPLACAS PARA CULTIVO CELULAR CON MEMBRANA TRANSWELL DE 24 POZOS, 6.5 MM CON TAMAÑO DE PORO DE 8 µM, ESTÉRIL, CON TAPA, EMPAQUE INDIVIDUAL. CAJA CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "994", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO CON ACTIVADOR DE SUERO, PARA RECOLECCIÓN DE SANGRE (TAPA ROJA), CON CAPACIDAD DE 250 A 500 MICROLITROS. PAQUETE CON 100 TUBOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "995", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO CON EDTA K2, PARA RECOLECCIÓN DE SANGRE (TAPA MORADA), CON CAPACIDAD DE 250 A 500 MICROLITROS. PAQUETE CON 100 TUBOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "996", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO PARA CENTRÍFUGA 1.5 ML DE POLIPROPILENO VIRGEN CON MOLDES DE ALTA CALIDAD, VIENEN CON CERTIFICADO LIBRE DE DNASE, RNASE Y PIRÓGENOS. BOLSA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "997", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO PARA CENTRÍFUGA 2 ML DE POLIPROPILENO VIRGEN CON MOLDES DE ALTA CALIDAD, VIENEN CON CERTIFICADO LIBRE DE DNASE, RNASE Y PIRÓGENOS. BOLSA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "998", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO PARA CENTRÍFUGA 200 µL DE POLIPROPILENO VIRGEN CON MOLDES DE ALTA CALIDAD, VIENEN CON CERTIFICADO LIBRE DE DNASE, RNASE Y PIRÓGENOS. BOLSA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "999", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBO PARA CENTRÍFUGA 600 µL DE POLIPROPILENO VIRGEN CON MOLDES DE ALTA CALIDAD, VIENEN CON CERTIFICADO LIBRE DE DNASE, RNASE Y PIRÓGENOS. BOLSA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1000", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS0.5 ML INCOLORO, POLIPROPILENO, TAPA PLANA, TRANSPARENTES INCOLOROS PARA REACCIÓN EN CADENA DE LA POLIMERASA, BOLSA C/250 MICROTUBOS. BOLSA CON 500 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1001", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 1.5ML DE POLIPROPILENO INCOLORO C/TAPA DE CIERRE SEGURO. RESISTENTES A SOLVENTES Y ALTAS VELOCIDADES DE CENTRIGUCACIÓN (13000RPM). BOLSA DE 1000 TUBOS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1002", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS 2 ML TRANSPARENTE. BOLSA 1000 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1003", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 2.0 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 500 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1004", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 5.0 ML AMBAR . NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 200 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1005", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 5.0 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 200 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1006", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 0.6 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1007", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS DE 1.5 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1008", "cucop_code": "25501-0525", "specific_item_code": "25501", "cucop_description": "MATERIAL DE LABORATORIO", "description": "NAVAJAS DESECHABLES TIPO GILETTE, PAQUETE DE 10 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1009", "cucop_code": "25501-0525", "specific_item_code": "25501", "cucop_description": "MATERIAL DE LABORATORIO", "description": "NAVAJA DE AFEITAR DE DOBLE FILO. CAJA CON 100 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1010", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJA DESECHABLE DE ALTO PERFIL PARA MICROTOMO/CRIOSTATO. CAJA CON 50", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1011", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJAS DESECHABLES DE PERFIL ALTO PARA CRIOSTATO 818", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1012", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CUCHILLAS PARA CRIOSTATO/MICROTOMO DE PERFIL ALTO DE 80 MM DE LARGO X 14 MM DE ALTO X 0,35 MM DE GROSOR. CAJA CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1013", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PALA DE ACERO INOXIDABLE PARA HIELO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1014", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PAPEL ESTRAZA COLOR CAFÉ, ROLLO DE 45 CM X 10 M", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1015", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PAPEL ESTRAZA SIN BLANQUEAR, 18 PULGADAS X 1,100 ', 50 LBS EN ROLLO DE 18 PULGADAS POR 1100 PIES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1016", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAÑOS DE PAPEL PARA TAREAS DELICADAS (LIMPIEZA DE CELDAS DE CUARZO Y LENTES DE MICROSCOPIO), CAJA CON 200-300 PAÑOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1017", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIO BLOCK CON 100 HOJAS DE 10 X 15 CM. BLOCK CON 100 HOJAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1018", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PEINES DE 15 POZOS PARA VIDRIOS DE 1.0 MM DE GROSOR, VOLUMEN 26 µL POR POZO, PARA GELES DE ACRILAMIDA, COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM, PAQUETE DE 5 PIEZAS C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1019", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PEINES DE 15 POZOS PARA VIDRIOS DE 1.5 MM DE GROSOR, VOLUMEN 20 µL POR POZO, PARA GELES DE ACRILAMIDA, COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM, PAQUETE DE 5 PIEZAS C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1020", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PELÍCULA CON ADHESIVO ÓPTICO PARA 48 POCILLOS COMPATIBLE CON EQUIPO DE PCR EN TIEMPO REAL/TERMOCICLADOR STEP ONE. CAJA CON 25 PELÍCULAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1021", "cucop_code": "25501-0526", "specific_item_code": "25501", "cucop_description": "PARRILLA DE CALENTAMIENTO", "description": "PELÍCULA TERMOPLÁSTICA, SEMITRANSPARENTE , PARA LABORATORIO (PARAFILM), ROLLO DE 10 CM X 76 M", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1022", "cucop_code": "25501-0232", "specific_item_code": "25501", "cucop_description": "080.431.0233 FRASCOS DE POLIETILENO CON TUBO LATERAL PIZETA. PARA EXPULSAR LIQUIDOS A PRESION AFORAR LAVAR TEÑIR ETC. PARA VOLUMENES DE: 500 ML.", "description": "PICETAS DE 500ML RESISTENTE, PARA GUARDAR ALCOHOLES, 4 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1023", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZA QUIRÚRGICA GUBIA, DE ACERO INOXIDABLE, QUE EN LA PUNTA NO TENGA FILO, TAMAÑO MEDIANO PARA ROMPER EL CRÁNEO DE RATA Y PODER EXTRAER EL CEREBRO.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1024", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZAS DE DENTISTA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1025", "cucop_code": "25501-0232", "specific_item_code": "25501", "cucop_description": "080.431.0233 FRASCOS DE POLIETILENO CON TUBO LATERAL PIZETA. PARA EXPULSAR LIQUIDOS A PRESION AFORAR LAVAR TEÑIR ETC. PARA VOLUMENES DE: 500 ML.", "description": "PINZAS DE RELOJERO CURVAS NUMERO 7, ACERO INOXIDABLE, LONGITUD 12 CM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1026", "cucop_code": "25501-0232", "specific_item_code": "25501", "cucop_description": "080.431.0233 FRASCOS DE POLIETILENO CON TUBO LATERAL PIZETA. PARA EXPULSAR LIQUIDOS A PRESION AFORAR LAVAR TEÑIR ETC. PARA VOLUMENES DE: 500 ML.", "description": "PINZAS DE SUJECIÓN DE 3 DEDOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1027", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZAS PORTA AGUJA CASTROVIEJO PARA MICROCIRUGIA, LARGO 13 CM, CURVAS, ACERO INOXIDABLE, PARA AGUJA 5-0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1028", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZAS PORTA AGUJA CASTROVIEJO PARA MICROCIRUGIA, LARGO 13 CM, RECTAS, ACERO INOXIDABLE, PARA AGUJA 5-0", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1029", "cucop_code": "25501-0339", "specific_item_code": "25501", "cucop_description": "080.709.2556 PIPETAS DE VIDRIO VOLUMETRICAS CLASE A MANUALES PARA MEDIR VOLUMENES: 1.0 ML. PIEZA.", "description": "PIPETAS DE TRANSFERENCIA DE POLIPROPILENO RESISTENTES A SOLVENTES. ESTÉRILES. VOLUMEN DE TRABAJO 1ML. PAQUETE DE 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1030", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS SEROLÓGICAS ESTÉRILES DESECHABLES DE 2 ML. DESECHABLES DE POLIESTIRENO ENVUELTAS INDIVIDUALMENTE. CAJA CON 200 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1031", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETA SEROLOGICA DE POLIPROPILENO DESECHABLE DE 5 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 200 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1032", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS SEROLÓGICAS ESTÉRILES EMPACADAS INDIVIDUALMENTE LIBRES DE PIROGENOS DE 5 ML. CAJA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1033", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETA SEROLOGICA DE POLIPROPILENO DESECHABLE DE 10 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 200 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "11", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1034", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS SEROLOGICAS ESTÉRILES EMPACADAS INDIVIDUALMENTE LIBRES DE PIROGENOS DE 10 ML. CAJA CON 500 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1035", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA CON 96 POZOS DE POLIESTIRENO, NEGRAS DE FONDO TRANSPARENTE. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA. CAJA CON 50 PIEZAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1036", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA CON 96 POZOS DE POLIESTIRENO, TRANSPARENTES. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA. CAJA CON 50 PIEZAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1037", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE VIDRIO DELGADA PARA PREPARARACIÓN DE GELES VERTICALES DE ACRILAMIDA DE 10 CM X 7.3 CM. CAJA CON 5 VIDRIOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1038", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLATO DE CULTIVO CELULAR DE 90 X 20 MM, ÁREA DE CRECIMIENTO 57.5 CM2, DE POLIESTIRENO, ESTÉRILE. TRATADOS CON TC NO PIRÓGENO O CITÓXICO. CAJA CON 200 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1039", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DE 25MM X 75 MM. CAJA CON 50 LAMINILLAS", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": "35", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1040", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DE CULTIVO CELULAR CON CA´MARA DE POLIESTIRENO, DESECHABLES, ÁREA DE CULTIVO 1,7 CM2, ESTÉRILES, 4 POCILLOS. PAQUETE DE 24 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1041", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DE VIDRIO TRATADO DESLIZANTE CON 8 POCILLOS CON TAPA, ESTÉRIL PARA CULTIVO CELULAR Y MICROSCOPIA DE FLUORESCENCIA. PAQUETE DE 8 LAMINILLAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1042", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DESECHABLES, ESTÉRILES CON ENVOLTURA INDIVIDUAL, PARA CONTEO CELULAR PARA USO CON EL CONTADOR CELUAR AUTOMATIZADO COUNTESS TM. CAJA CON 50 PORTAOBJETOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1043", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS ELECTROCARGADOS DE POLILISINA 25 X 75 CM, CAJA C/50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1044", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS-LAMINILLAS ELECCTROCARGADAS. PARA REALIZAR TÉCNICAS HISTOLÓGICAS ESPECIALES. CAJA CON 144 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1045", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PREFILTROS DE FIBRA DE VIDRIO DE 45 MM DE DIÁMETRO, AUTOCLAVEABLES. CAJA CON 100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1046", "cucop_code": "25501-0419", "specific_item_code": "25501", "cucop_description": "080.735.0202 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 100 µL. BOLSA CON 1000.", "description": "PUNTAS DE JERINGA PARA PIPETAS DE REPETICIÓN DE 0.1 ML, NO ESTÉRILES. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1047", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS DE JERINGA PARA PIPETAS DE REPETICIÓN DE 0.5 ML, NO ESTÉRILES. CAJA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1048", "cucop_code": "25501-0420", "specific_item_code": "25501", "cucop_description": "080.735.0210 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 200 µL. BOLSA CON 1000.", "description": "PUNTAS DE CARGA DE GEL (ESTÁNDAR, REDONDAS). VOLUMEN DE CARGA DE 0,5 - 200 µL. LONGITUD IMPERIAL: 2.75 PULGADAS. LIBRES DE ARNASA NI ADNASA. MATERIAL: POLIPROPILENO. PAQUETE CON 1000 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1049", "cucop_code": "25501-0416", "specific_item_code": "25501", "cucop_description": "080.735.0129 PUNTAS DESECHABLES DE: PLASTICO. PIEZA. SEGUN EL TIPO Y MARCA DE PIPETAS.", "description": "PUNTAS ESTÉRILES LONGITUD 55 MM EN RACKS DE 96 PUNTAS. CAJA CON 10 RACKS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1050", "cucop_code": "25501-0416", "specific_item_code": "25501", "cucop_description": "080.735.0129 PUNTAS DESECHABLES DE: PLASTICO. PIEZA. SEGUN EL TIPO Y MARCA DE PIPETAS.", "description": "PUNTAS PARA MICROPIPETA DE 1 A 5 ML DE 150 MM DE LONGITUD INCOLORAS. NO ESTÉRILES. AUTOCLAVEABLES. BOLSA CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1051", "cucop_code": "25501-0426", "specific_item_code": "25501", "cucop_description": "080.735.1408 PIPETAS PUNTA SIN FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "PUNTAS ESTÁNDAR PARA MICROPIPETA INCOLORAS DE 0.1 A 20 UL. NO ESTÉRILES. AUTOCLAVEABLES. CAJA CON 2 PAQUETES DE 500 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1052", "cucop_code": "25501-0426", "specific_item_code": "25501", "cucop_description": "080.735.1408 PIPETAS PUNTA SIN FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "PUNTAS BLANCAS DE POLIPROPILENO PARA MICROPIPETA CON CAPACIDAD DE 0.5 A 10 MICROLITROS, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS, NO ESTÉRIL. BOLSA CON 1000 PUNTAS", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": "36", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1053", "cucop_code": "25501-0426", "specific_item_code": "25501", "cucop_description": "080.735.1408 PIPETAS PUNTA SIN FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "PUNTAS PARA MICROPIPETA DE 10 µL. FABRICADAS DE POLIPROPILENO, LIBRE DE DNASA Y RNASA. ESTUCHE CON 96 PUNTAS, 50 RACKS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1054", "cucop_code": "25501-0426", "specific_item_code": "25501", "cucop_description": "080.735.1408 PIPETAS PUNTA SIN FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "PUNTAS UNIVERSALES CON FILTRO DE 0 A 10 MICROLITROS. PUNTAS ESTÉRILES EN RACKS DE 96 PUNTAS. CAJA CON 10 RACKS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1055", "cucop_code": "25501-0428", "specific_item_code": "25501", "cucop_description": "080.735.1424 PIPETAS PUNTA SIN FILTRO PARA PIPETA DE 100 A 1000 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "PUNTAS PARA MICROPIPETA DE 1000 UL, FABRICADAS DE POLIPROPILENO. BOLSA CON 1000", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1056", "cucop_code": "25501-0416", "specific_item_code": "25501", "cucop_description": "080.735.0129 PUNTAS DESECHABLES DE: PLASTICO. PIEZA. SEGUN EL TIPO Y MARCA DE PIPETAS.", "description": "PUNTAS PARA PIPETA REPETIDORA DE 2.5 M ESTÉRILES. ESTÉRILES ENVUELTAS INDIVIDUALMENTE. CUERPO DE POLIPROPILENO, ÉMBOLO DE POLIETILENO. COMPATIBLES CON PIPETA REPETIDORA EPPENDORF Y LABNET. CAPACIDAD 2.5 ML. 200 PIEZAS POR CAJA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1057", "cucop_code": "25501-0420", "specific_item_code": "25501", "cucop_description": "080.735.0210 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 200 µL. BOLSA CON 1000.", "description": "PUNTAS AMARILLAS DE POLIPROPILENO PARA MICROPIPETA CON CAPACIDAD DE 1 HASTA 200 MICROLITROS, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS, NO ESTÉRILES. BOLSA CON 1000 PUNTAS", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": "40", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1058", "cucop_code": "25501-0420", "specific_item_code": "25501", "cucop_description": "080.735.0210 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 200 µL. BOLSA CON 1000.", "description": "PUNTAS AMARILLAS PARA MICROPIPETA DE 200µL. FABRICADAS DE POLIPROPILENO, LIBRE DE DNASA Y RNASA. CAJA 10 RACKS, TOTAL 960 PUNTAS DE 200µL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1059", "cucop_code": "25501-0416", "specific_item_code": "25501", "cucop_description": "080.735.0129 PUNTAS DESECHABLES DE: PLASTICO. PIEZA. SEGUN EL TIPO Y MARCA DE PIPETAS.", "description": "PUNTAS DE 50 ML PARA PIPETA REPETIDORA. PUNTAS DE PLÁSTICO TRANSPARENTE COMPATIBLES CON DISPENSADORES DE REPTICIÓN EPPENDORF Y LABNET. CAPACIDAD 50 ML, CAJA CON 100 PUNTAS EN EMPAQUE INDIVIDUAL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1060", "cucop_code": "25501-0527", "specific_item_code": "25501", "cucop_description": "531.153.0108 CAJAS. DE MADERA.CON REJILLA DE ALUMINIO PARA GUARDAR LAMINILLAS. PARA PORTAOBJETOS DE 25 X 75 MM. CON 100 LUGARES. DE 3.12 X 17.31 X 20.13 CM. PIEZA.", "description": "REJILLAS DE COBRE 200 MESH PARA MICROSCOPÍA ELECTRÓNICA, VIAL CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1061", "cucop_code": "25501-0527", "specific_item_code": "25501", "cucop_description": "531.153.0108 CAJAS. DE MADERA.CON REJILLA DE ALUMINIO PARA GUARDAR LAMINILLAS. PARA PORTAOBJETOS DE 25 X 75 MM. CON 100 LUGARES. DE 3.12 X 17.31 X 20.13 CM. PIEZA.", "description": "REJILLAS DE NIQUEL 200 MESH PARA MICROSCOPÍA ELECTRÓNICA, VIAL CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1062", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "REPUESTO DE ELECTRODO PARA ENSAMBLADO A LA FUENTE DE PODER COMPATIBLE CON CÁMARA DE ELECTROFORESIS VERTICAL MINI-PROTEAN TETRA CELL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1063", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "REPUESTO DE VIDRIOS DELGADOS PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA CELL CASTING STAND. PAQUETE DE 5 PIEZAS C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1064", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "REPUESTO DE VIDRIOS GRUESOS DE 1 MM DE SEPARACIÓN PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM. PAQUETE DE 5 PIEZAS C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1065", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "REPUESTO DE VIDRIOS GRUESOS DE 1.5 MM DE SEPARACIÓN PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM. PAQUETE DE 5 PIEZAS C/U", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1066", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS PARA CÁMARA DE ELECTROFORESIS 10X 8CM. CAJA CON 5", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1067", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "REPUESTO PLACA DE PLÁSTICO TRANSPARENTE COMPATIBLE CON CÁMARA DE ELECTROFORESIS VERTICAL MINI-PROTEAN TETRA SYSTEM. PAQUETE DE 2 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1068", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "RESERVORIO DE POLIESTIRENO PARA PIPETAS MULTICANAL 10 ML. PAQUETE DE 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1069", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "RESERVORIO DE POLIESTIRENO PARA PIPETAS MULTICANAL 5 ML. PAQUETE DE 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1070", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SELLADORES DE PLACAS DE ELISA (PLATE SEALER) NO ESTÉRILES. CAJA CON 100 UNIDADES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1071", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SISTEMA DE CARTUCHOS PURIFICADORES (DE DOS CARTUCHOS) COMPATIBLE CON SISTEMA DIRECT-Q-3UV. EL CARTUCHO 1 CON FILTRO , CARBONO ACTIVADO PARA PRETRATAMIENTO Y MEMBRANA DE OSMOSIS REVERSA. EL CARTUCHO 2 CON RESINAS DE INTERCAMBIO IÓNICO DE GRADO ULTRAPURO. 1 SISTEMA CON 2 CARTUCHOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1072", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SISTEMA DE FILTRACIÓN COMPLETO DE VIDRIO BOROSILICATO SARTORIUS. ENTREGADA COMPLETA CON: FRASCO 1 LITRO DE VIDRIO BOROSILICATO BASE Y EMBUDO DE VIDRIO BOROSILICATO SOPORTE-FILTRO: DE VIDRIO, INCLUYENDO UN ANILLO PTFE Y 1 JUNTA TÓRICA VITON (45 X 3 MM) 1 PINZA DE SUJECIÓN DE ALUMINIO ANODIZADO UNIDAD.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1073", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SOPORTE BNC PARA SUCCIÓN DE ALAMBRE RECTO PARA VIDRIO DE 1.5 MM DE DIÁMETRO EXTERIOR, TUBO PAQUETE CON 5", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1074", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SOPORTE BNC PARA SUCCIÓN DE ALAMBRE RECTO PARA VIDRIO DE 1.7 MM DE DIÁMETRO EXTERIOR, TUBO PAQUETE CON 5", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1075", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUCCIONADOR DE PIPETA CON EMBOLO PARA PIPETA, 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1076", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁNULA ESOFÁGICA 7904 CÁNULA ESOFÁGICA DE ACERO INOXIDABLE PARA SUMINISTRO DE MEDICAMENTOS O ALIMENTO, PARA RATÓN DE 25 A 30 G. RECTA CAL. 18 X 1.5\", MODELO: 7904. MCA. CADENCE SCIENCE, INC. E.U.A.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1077", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA CATGUT CRÓMICO 4-0", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1078", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA DE POLIPROPILENO, MONOFILAMENTO, CALIBRE 4/0, AGUJA DE 1/2 CÍRCULO AHUSADA, DOBLE ARMADA DE 26.0 MM (SH MASTER) HEBRA DE 90 CM. CAJA CON 24 UNIDADES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1079", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA HILO DE ÁCIDO POLIGLICÓLICO, CALIBRE 7-0, CON AGUJA AHUSADA REGULAR, 6 MM 3/8 CÍRCULO. CAJA CON 12 PIEZAS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": "20", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1080", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA HILO DE SEDA TRENZADA SILICONIZADA, CALIBRE 0-0, CON AGUJA AHUSADA REGULAR PREMIUM, 26 MM 1/2 CÍRCULO. CAJA CON 12 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": "15", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1081", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA HILO SEDA TRENZADA SILICONIZADA, CALIBRE 3-0, CON AGUJA AHUSADA REGULAR PREMIUM, 26 MM 1/2 CÍRCULO. CAJA CON 12 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": "15", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1082", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA MONOFILAMENTO DE NYLON 45 CM 3-0, AGUJA CORTANTE CT-19 3/8 CORTANTE, CAJA CON 24 SUTURAS ENVUELTAS INDIVIDUALMENTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1083", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURAS PARA MODELOS DE ACCIDENTES CEREBRO VASCULARES EN ROEDORES POR OCLUSIÓN DE LA ARTERIA CEREBRAL MEDIA . PARA RATÓN DE 21 A 25 GR/CON CABEZA DE SILICÓN: LONGITUD DE 3-4 MM Y DIÁMETRO DE 0.20 MM X 0.21 M/ DIÁMETRO DEL CUERPO DE LA SUTURA 0.12 MM Y LONGITUD TOTAL 30 MM. CAJA CON 50 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1084", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURAS PARA MODELOS DE ACCIDENTES CEREBRO VASCULARES EN ROEDORESPOR OCLUSIÓN DE LA ARTERIA CEREBRAL MEDIA . PARA RATA DE 281 A 330 GR/CON CABEZA DE SILICÓN: LONGITUD DE 5-6 MM Y DIÁMETRO DE 0.38 MM X 0.4 M/ DIÁMETRO DEL CUERPO DE LA SUTURA 0.2 MM Y LONGITUD TOTAL 50 MM. CAJA CON 50 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1085", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 100 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1086", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 40 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1087", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 70 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1088", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "TELA ADHESIVA DE ACETATO PARA FIJAR CURACIONES DE 2.5CM X 10M CAJA CAJA CON 12PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1089", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "TELA ADHESIVA DE ACETATO PARA FIJAR CURACIONES DE 5CMX 10M CAJA CON 6 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1090", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO PARA LABORATORIO DE -20 A 100 °C.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1091", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "TIJERA VANNAS PARA MICROCIRUGIA FILO: 2-3 MM. DIÁMETRO DE LA PUNTAS: 0.05 MM, LONGITUD: 8 CM, ALEACIÓN: ACERO INOXIDABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1092", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "TIJERAS DE CIRUGÍA RECTAS 14 CM, ACERO INOXIDABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1093", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TIRAS DE 8 TUBOS DE 0.2 ML PARA PCR CON TAPONES INDIVIDUALES ADJUNTOS. CAJA CON 120 TIRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1094", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBERÍA DE LÁTEX CALIBRE 5.55 X 1.53 MM, 5 METROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1095", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "TUBO DE DIÁLISIS 5 MM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1096", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "TUBO DE DIÁLISIS DE 13.5 MM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1097", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "TUBO DE DIÁLISIS DE 9 MM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1098", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBOS DE PLÁSTICO PARA TOMA DE MUESTRA SANGUÍNEA SIN ANTICOAGULANTE PARA SEPARAR SUERO CON RECUBRIMIENTO DE SILICIO SE UTILIZAN PARA LAS DETERMINACIONES DE SUERO EN LA QUÍMICA. 10ML, TAPÓN ROJO. PAQUETE CON 100 TUBOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1099", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBOS PARA HEMATOLOGÍA EN PLÁSTICO TRASPARENTE CON TAPA, CON 7.2MG K2 EDTA, 4ML, 13X100MM. CAJA CON 100", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1100", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO CÓNICO DE PLÁSTICO DE 15 ML CON TAPA, PARA CENTRIFUGA, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 500 TUBOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1101", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO P/CENTRÍFUGA, DE 15 ML CON TAPÓN DE ROSCA DE POLIPROPILENO, FONDO REDONDO, NO ESTÉRIL. PAQUETE CON 20 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1102", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBOS CÓNICOS DE 15.0 ML AMBAR CON TAPAROSCA. PROLIPROPILENO. GRADUADOS. PAQUETE CON 50 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1103", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO CÓNICO PARA CENTRÍFUGA DE 15ML DE POLIPROPILENO RADUADO QUE AGUANTE ALTAS VELOCIDADES DE CENTRIFUGACIÓN Y SOLVENTES. ESTÉRIL PAQUUTE C/50 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": "15", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1104", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO CÓNICO DE POLIPROPILENO CON TAPA DE ROSCA PARA USO EN CENTRIFUGA, CON CAPACIDAD DE 50 ML, CON GRADUACIONES IMPRESAS. NO ESTÉRIL. BOLSA CON 25 TUBOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1105", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO CÓNICO PARA CENTRÍFUGA DE 50MLDE POLIPROPILENO GRADUADO QUE AGUANTE ALTAS VELOCIDADES DE CENTRIFUGACIÓN Y SOLVENTES, ESTÉRIL. PAQUETE C/500 PIEZAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "7", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1106", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO P/CENTRÍFUGA, DE 50 ML CON TAPÓN DE ROSCA DE POLIPROPILENO, FONDO REDONDO, NO ESTÉRIL. PAQUETE CON 20 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1107", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE 0.6 ML. BOLSA/500", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1108", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS CÓNICO DE POLIPROPILENO DE 1.5 ML CON TAPA, CLAROS, AUTOCLAVEABLES, LIBRES DE PIRÓGENOS. BOLSA CON 500 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1109", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE PLÁSTICO TRANSPARENTE CON TAPA PARA CENTRÍFUGA CÓNICO DE 1.5 ML, BOLSA CON 250 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "12", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1110", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE POLIPROPILENO CON TAPA COLOR AMBAR DE 1.5 ML. BOLSA 1000 PZS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1111", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE 1.5 ML CENTRIFUGABLES CON TAPA. PAQUETE DE 1000 TUBOS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1112", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE CENTRIFUGA DE POLIPROPILENO PARA CONCENTRACIÓN DE PLASMA/FLUIDOS BIOLÓGICOS DE 2ML CON MEMBRANA DE CELULOSA REGENERADA DE BAJA UNIÓN PARA LÍMITE DE PESO MOLECULAR 10,000. LARGO 117MM DIAMETRO 15.9 MM ÁREA DE FILTRACIÓN 1 CM², 24 PIEZAS/PAQUETE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "10", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1113", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE CENTRIFUGA DE POLIPROPILENO PARA CONCENTRACIÓN DE PLASMA/FLUIDOS BIOLÓGICOS DE 4ML CON MEMBRANA D CELULOSA REGENERADA DE BAJA UNIÓN PARA LÍMITE DE PESO MOLECULAR 10,000. LARGO 124MM DIAMETRO 17.3 MM ÁREA DE FILTRACIÓN 3 CM², 24 PIEZAS/PAQUETE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1114", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE 5 ML CON TAPA. PAQUETE DE 1000 TUBOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1115", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE PAREDES 2 ML. BOLSA 1000 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1116", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE PAREDES FINAS PARA PCR P/PIPETAS DE 0.5 ML. ESTÉRIL, LIBRES DE DNASA Y RNASA. BOLSA CON 500 UNIDADES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1117", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS PARA MICRORECOLECCIÓN DE SANGRE.MEDIDAS 10 MM DE DIÁMETRO X 45 MM DE ALTURA. ESTÉRILES CON CAPACIDAD DE 0.25 A 0.5 ML. CUBIERTOS CON SILICONA. BOLSA CON 200 UNIDADES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "6", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1118", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRACIÓN 500 ML DE POLISULFONA CON UNIDAD RECEPTORA DE 1000 ML REUSABLE 47 MM. AUTOCLAVEABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1119", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRACIÓN DESECHABLE DE 500 ML , DE PORO 0.22µM ,CON ADAPTADOR PARA VACÍO, ESTÉRIL, CON TAPA Y RESERVORIO GRADUADO. EMPAQUETADO INDIVIDUALMENTE, LIBRE DE PIRÓGENOS. CAJA CON 12", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1120", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRO DE JERINGA GV PORO 0.22 MICROMETROS, ESTÉRILES, CON ENVOLTURA INDIVIDUAL. CAJA CON 100 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1121", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDADES DE FILTRACIÓN POR VACÍO, DE LIBERACIÓN RÁPIDA, DESECHABLES, CON MATRAZ RECEPTOR Y TAPÓN PARA PROCESAMIENTO Y ALMACENAMIENTO, CON MEMBRANAS DE FLUORURO DE POLIVINILIDENO (PVDF) DE MUY BAJA ADSORCIÓN DE PROTEÍNAS DE 0,22 µM PARA FILTRACIÓN ESTERILIZANTE, VOLUMEN DE 150 ML. PAQUETE DE 12 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "8", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1122", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 20 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1123", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 2L (2000ML)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1124", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO DE 100 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1125", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 250 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "5", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1126", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADO DE VIDRIO TRANSPARENTE DE BAJA EXPANSIÓN TÉRMICA 50 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "7", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1127", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO DE 10 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": "18", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1128", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADO DE VIDRIO 2 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "12", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1129", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADO DE VIDRIO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1130", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VIALES ÁMBAR DE VIDRIO TIPO II PARA LIOFILIZAR, CON CAPACIDAD DE 20 ML Y TAPÓN DE GOMA. CAJA CON 100 UNIDADES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1131", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS CORTOS DE 10.1 X 7.3 CM PARA PREPARAR GELES DE ELECTROFORISIS WESTERN BLOT. CAJA 10 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "1", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1132", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS DE TAMAÑO 10 X 8.3 CM APROXIMADAMENTE PARA GEL DE ELECROFORESIS DE ACRILAMIDA, CON ESPACIADOR DE 1.5MM INTEGRADO PARA CÁMARA MINI-PROTEAN. CAJA 5 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "4", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1133", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS ESPACIADORES DE 0.75 MM PARA WESTERN BLOT. CAJA 5 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "3", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1134", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS ESPACIADORES DE 1.5 MM PARA WESTERN BLOT. CAJA 5 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null }, { "number": "1135", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS ESPACIADORES DE 1.5 MM PARA WESTERN BLOT. CAJA 5 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": "2", "unit": "UNIDAD", "minimum_amount": null, "maximum_amount": null } ] } ], "awards": [ { "id": "C-2026-00076375", "internal_reference": "INNN-DG-DA-SRM-LP-085-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "CIENTIFICA SENNA SA DE CV", "normalized_name": "CIENTIFICA SENNA", "rfc_type": null, "slug": "cientifica-senna" }, "contract_period": { "published_at": "2026-08-06T21:22:30.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "1076882.17", "tax": "172301.15", "total": "1249183.32", "maximum_subtotal": "1541721.32", "maximum_total": "1788396.7692", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO CÍTRICO MONOHIDRATADO. FRASCO 500G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2575", "subtotal": "2575", "tax": "412", "other_taxes": null, "total": "2987" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO =98%, PELLETS (ANHIDRO). FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "410", "subtotal": "410", "tax": "65.6", "other_taxes": null, "total": "475.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO ANTI-ANEXINA V CONJUGADO A ALEXA FLUOR 488 CON EXCITACIÓN/EMISIÓN: 495/519 PARA CITOMETRÍA DE FLUJO EN UNA SOLUCIÓN CON 25 MM HEPES, 140 MM NACL, 1 MM EDTA, PH 7.4, CON ALBÚMINA DE SUERO BOVINO (BSA) AL 0.1%  EN UNA SOLUCIÓN CON 25 MM HEPES, 140 MM NACL, 1 MM EDTA, PH 7.4, CON ALBÚMINA DE SUERO BOVINO (BSA) AL 0.1% (500 µL)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8745", "subtotal": "8745", "tax": "1399.2", "other_taxes": null, "total": "10144.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-ß-ACTINA ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN. IDENTIFICAN: RATA Y RATÓN, PARA WB E IHC. VIAL CON 200 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7634.03", "subtotal": "7634.03", "tax": "1221.44", "other_taxes": null, "total": "8855.47" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-BETA ACTINA, PRODUCIDO EN RATÓN, PARA RATÓN, RATA, HUMANO Y AVE 200 µG/ML EN PBS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7634.03", "subtotal": "7634.03", "tax": "1221.44", "other_taxes": null, "total": "8855.47" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA BDNF. REACCIONA/DETECTA A LA PROTEÍNA BDNF DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9790.2", "subtotal": "9790.2", "tax": "1566.43", "other_taxes": null, "total": "11356.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CASPASA-3 ESCINDIDA (ASP175) HECHO EN CONEJO CON REACTIVIDAD EN HUMANO, RATA Y RATÓN. VIAL CON 300 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9790.2", "subtotal": "9790.2", "tax": "1566.43", "other_taxes": null, "total": "11356.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "CASPASA 9 ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA EN TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA. CONCENTRACIÓN 1 MG/ML. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14198.18", "subtotal": "14198.18", "tax": "2271.71", "other_taxes": null, "total": "16469.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO CATALASA (ANTI-CATALASE).ESPECIE HUÉSPED: CONEJO  ESPECIES REACTIVAS:RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13801.79", "subtotal": "13801.79", "tax": "2208.29", "other_taxes": null, "total": "16010.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD4 ANTI-HUMANO MARCADO CON APC/CYANINE7. VIAL PARA 100 TEST", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8877.23", "subtotal": "8877.23", "tax": "1420.36", "other_taxes": null, "total": "10297.59" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO DE CONEJO PARA FACTOR NUCLEAR TIPO ERITORIDE 2 (INMUNOHISTOQUÍMICA) REACTIVO CON RATÓN, HUMANOS Y RATA. VIAL CON 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9654.23", "subtotal": "9654.23", "tax": "1544.68", "other_taxes": null, "total": "11198.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI FERRITINA MONOCLONAL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9790.2", "subtotal": "9790.2", "tax": "1566.43", "other_taxes": null, "total": "11356.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-GALECTINA 3 ANTICUERPO MONOCLONAL, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9712.5", "subtotal": "9712.5", "tax": "1554", "other_taxes": null, "total": "11266.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEÍNA GLIAL FIBRILAR ACÍDICA ANTICUERPO POLICLONAL DE CONEJO PARA UTILIZARSE EN INMUNOHISTOQUIMICA PARA TEJIDOS FIJADOS EN FORMOL AL 10% E INCLUIDOS EN PARAFINA. DEBE REACCIONAR CON RATÓN, PRIMATES NO HUMANOS Y RATA,. VIAL CON 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11732.7", "subtotal": "11732.7", "tax": "1877.23", "other_taxes": null, "total": "13609.93" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HCN4", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9867.9", "subtotal": "9867.9", "tax": "1578.86", "other_taxes": null, "total": "11446.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-IBA1/AIF-1, PRODUCIDO EN CABRA, PARA HUMANO, RATÓN, RATA, PERRO, CERDO, CABALLO Y GATO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984.45", "subtotal": "9984.45", "tax": "1597.51", "other_taxes": null, "total": "11581.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-IDO1, PRODUCIDO EN CONEJO, ISOTIPO IGG1, PARA RATÓN Y HUMANO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10334.1", "subtotal": "10334.1", "tax": "1653.46", "other_taxes": null, "total": "11987.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 488 RABBIT ANTI-GOAT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2350.43", "subtotal": "2350.43", "tax": "376.07", "other_taxes": null, "total": "2726.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO DE CABRA CONJUGADO CON ALEXA FLUOR 546, 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6779.33", "subtotal": "6779.33", "tax": "1084.69", "other_taxes": null, "total": "7864.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO (H+L), FRAGMENTO F(AB')2 DE IGG, CONJUGADO AL FLUOROCROMO ALEXA FLUOR 555, PRODUCIDO EN CABRA, DIRIGIDO A CONEJO, ÚTIL PARA INMUNOFLUORESCENCIA, CITOMETRÍA DE FLUJO. FRASCO 250 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5810", "subtotal": "5810", "tax": "929.6", "other_taxes": null, "total": "6739.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO DE CABRA ANTI IG-G HUMANA. VIAL DE 100 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6585.08", "subtotal": "6585.08", "tax": "1053.61", "other_taxes": null, "total": "7638.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-HUMAN", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6779.33", "subtotal": "6779.33", "tax": "1084.69", "other_taxes": null, "total": "7864.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO IGG ANTI-RATA (MOLECULA COMPLETA)–ACOPLADA A FOSFATASA ALCALINA, PRODUCIDA EN CONEJO. VIAL CON 0.5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3127.43", "subtotal": "3127.43", "tax": "500.39", "other_taxes": null, "total": "3627.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN (H+L), DE ADSORCIÓN CRUZADA DE IGG DE CABRA, ACOPLADO AL FLUOROCROMO CIANINA 5 (CY5). PRODUCIDO EN CABRA, DIRIGIDO A RATÓN, ÚTIL PARA WESTERN BLOT, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA. FRASCO 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5769.23", "subtotal": "5769.23", "tax": "923.08", "other_taxes": null, "total": "6692.31" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-MOUSE", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7847.7", "subtotal": "7847.7", "tax": "1255.63", "other_taxes": null, "total": "9103.33" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG1, ¿ RATÓN MARCADO CON PE. VIAL CON 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3380", "subtotal": "3380", "tax": "540.8", "other_taxes": null, "total": "3920.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CONTROL DE ISOTIPO IGG2B, ¿ RATÓN MARCADO CON BRILLIANT VIOLET 421. VIAL CON 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4933.95", "subtotal": "4933.95", "tax": "789.43", "other_taxes": null, "total": "5723.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO IGM DE CABRA ANTI-RATÓN (H+L), FITC", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6585.08", "subtotal": "6585.08", "tax": "1053.61", "other_taxes": null, "total": "7638.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI MOTOFUSINA-2 (MFN2) PRODUCIDO EN CONEJO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9867.9", "subtotal": "9867.9", "tax": "1578.86", "other_taxes": null, "total": "11446.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-SUPEROXIDE DISMUTASE (MNSOD) REACTIVIDAD CON RATA Y RATON PARA WB E IHC. VIAL CON 200 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9867.9", "subtotal": "9867.9", "tax": "1578.86", "other_taxes": null, "total": "11446.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO CONTRA 3-MERCAPTOPIRUVATO (MPST) SULFURTRANSFERASA HECHO EN CONEJO PARA USO EN RATA PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10916.85", "subtotal": "10916.85", "tax": "1746.7", "other_taxes": null, "total": "12663.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUEPO ANTI-NEUN (FOXO3) ANTICUERPO MONOCLONAL HECHO EN RATÓN, PARA IF, WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10916.85", "subtotal": "10916.85", "tax": "1746.7", "other_taxes": null, "total": "12663.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA NRF2. REACCIONA/DETECTA A LA PROTEÍNA NRF2 DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984.45", "subtotal": "9984.45", "tax": "1597.51", "other_taxes": null, "total": "11581.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO FACTOR NUCLEAR TIPO ERITROIDE 2 (ANTI-NRF2). ESPECIE HUÉSPED: CONEJO ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984.45", "subtotal": "9984.45", "tax": "1597.51", "other_taxes": null, "total": "11581.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO ANTI P21 HECHO EN RATÓN MONOCLONAL, PARA USO EN RATÓN, RATA Y HUMANO PARA WESTERN BLOT E INMUNOFLUORESCENCIA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984.45", "subtotal": "9984.45", "tax": "1597.51", "other_taxes": null, "total": "11581.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI PROHIBITINA-2, PRODUCIDO EN CONEJO, REACTIVIDAD CONTRA HUMANO, RATA, RATÓN, PARA CORTES DE TEJIDO INCLUIDO EN PARAFINA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10178.7", "subtotal": "10178.7", "tax": "1628.59", "other_taxes": null, "total": "11807.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-PSD95 HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATÓN, Y RATA PARA USO EN WESTERN BLOT, INMUNOHISTOQUÍMICA, E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9576.53", "subtotal": "9576.53", "tax": "1532.24", "other_taxes": null, "total": "11108.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI PSD-95 DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9576.53", "subtotal": "9576.53", "tax": "1532.24", "other_taxes": null, "total": "11108.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO SUPERÓXIDO DISMUTASA 1 (ANTI-SUPEROXIDE DISMUTASE 1). ESPECIE HUÉSPED: CONEJO ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA INMUNOHISTOQUÍMICA, EN TEJIDOS INCLUIDOS EN PARAFINA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10916.85", "subtotal": "10916.85", "tax": "1746.7", "other_taxes": null, "total": "12663.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL ANTI-TBR-1 DE RATÓN, HUMANO Y RATA OBTENIDO EN CONEJO, PARA USO EN WESTERN BLOT E INMUNOHISTOQUIMICA. VIAL CON 100 µG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9867.9", "subtotal": "9867.9", "tax": "1578.86", "other_taxes": null, "total": "11446.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PURIFICADO POR AFINIDAD ANTI-TIROSINA HIDROXILASA HECHO EN CONEJO, PRESENTACIÓN LÍQUIDA EN BUFFER CON 10 MM HEPES, 150 MM NACL, PH 7.5, 100 µG POR ML BSA Y 50% GLICEROL. VIAL CON150 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10916.85", "subtotal": "10916.85", "tax": "1746.7", "other_taxes": null, "total": "12663.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN CONEJO, ANTI-ZEB1 DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACOINES EN INMUNOHISTOQUÍMICA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984.45", "subtotal": "9984.45", "tax": "1597.51", "other_taxes": null, "total": "11581.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO (ACOPLADO A FLURÓFORO VERDE), 200 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6585.08", "subtotal": "6585.08", "tax": "1053.61", "other_taxes": null, "total": "7638.69" }, { "number": "0", "cucop_code": "25101-0037", "description": "CONJUGADO DE ESTREPTOAVIDINA-PEROXIDASA DE RÁBANO. VIAL CON 2 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "27855.45", "subtotal": "27855.45", "tax": "4456.87", "other_taxes": null, "total": "32312.32" }, { "number": "0", "cucop_code": "25901-1853", "description": "AGAROSA DE BAJO PUNTO DE FUSIÓN, 50 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6676.26", "subtotal": "6676.26", "tax": "1068.2", "other_taxes": null, "total": "7744.46" }, { "number": "0", "cucop_code": "25901-1862", "description": "SOLUCIÓN DE BROMURO DE ETIDIO (10 MG/ML)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2450", "subtotal": "2450", "tax": "392", "other_taxes": null, "total": "2842" }, { "number": "0", "cucop_code": "25101-0037", "description": "CÉLULAS DE E.COLI QUÍMICAMENTE COMPETENTES CEPA STBL3 (STBL3 COMPETENT CELLS), ALTA EFICIENCIA, LÍQUIDO. 21 X 50 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9693.08", "subtotal": "9693.08", "tax": "1550.89", "other_taxes": null, "total": "11243.97" }, { "number": "0", "cucop_code": "25901-1565", "description": "ENZIMA DE RESTRICCIÓN HINDIII (HINDIII RESTRICTION ENZYME), LÍQUIDO A 10 U/µL. 10,000 UNIDADES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1840.52", "subtotal": "1840.52", "tax": "294.48", "other_taxes": null, "total": "2135" }, { "number": "0", "cucop_code": "25901-1928", "description": "REACTIVO DE FENOL DE FOLIN Y CIOCALTEU. ADECUADO PARA LA DETERMINACIÓN DE PROTEÍNA TOTAL POR EL MÉTODO DE LOWRY 2N. 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5444.6", "subtotal": "5444.6", "tax": "871.14", "other_taxes": null, "total": "6315.74" }, { "number": "0", "cucop_code": "25901-1928", "description": "SOLUCIÓN MONOFÁSICA DE FENOL E ISOTIOCIANATO DE GUANIDINA DISEÑADA PARA AISLAR FRACCIONES SEPARADAS DE ARN, ADN Y PROTEÍNAS A PARTIR DE MUESTRAS DE CÉLULAS Y TEJIDOS DE ORIGEN HUMANO, ANIMAL, VEGETAL, BACTERIANO O PROCEDENTES DE LEVADURA, EN EL PLAZO DE UNA HORA. PURIFICA DE FORMA FIABLE EL ARN A PARTIR DE MÚLTIPLES FUENTES Y VOLÚMENES DE MUESTRA COMO CON PEQUEÑAS CANTIDADES DE TEJIDO (50–100 MG) Y CÉLULAS (5 × 106), ASÍ COMO CON GRANDES CANTIDADES DE TEJIDO (=1 G) Y CÉLULAS (>107). REACTIVO QUE MANTIENE LA INTEGRIDAD DEL ARN GRACIAS A LA INHIBICIÓN ALTAMENTE EFICAZ DE LA ACTIVIDAD DE ARNASA, AL TIEMPO QUE DESTRUYE LAS CÉLULAS Y DISUELVE LOS COMPONENTES CELULARES DURANTE LA HOMOGENEIZACIÓN DE MUESTRAS. FRASCO 100 ML.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5128.3", "subtotal": "5128.3", "tax": "820.53", "other_taxes": null, "total": "5948.83" }, { "number": "0", "cucop_code": "25901-1928", "description": "SOLUCIÓN FENOLICA FOLIN-CIOCALTEU 2M. FRASCO DE 500ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3020.5", "subtotal": "3020.5", "tax": "483.28", "other_taxes": null, "total": "3503.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "GEL ROJO PARA TINCIÓN DE ÁCIDOS NUCLEICOS EN GEL 10, 000X, 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4760", "subtotal": "4760", "tax": "761.6", "other_taxes": null, "total": "5521.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "COCKTAIL INHIBIDOR DE PROTEASAS EN TABLETAS COMPRIMIDAS CON EDTA 1MM. CAJA CON 30 TABLETAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3826.73", "subtotal": "3826.73", "tax": "612.28", "other_taxes": null, "total": "4439.01" }, { "number": "0", "cucop_code": "25901-1921", "description": "PERCOLL, 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5883.92", "subtotal": "5883.92", "tax": "941.43", "other_taxes": null, "total": "6825.35" }, { "number": "0", "cucop_code": "25901-1921", "description": "PERCOLL, MEDIO CLÁSICO PARA CENTRIFUGACIÓN EN GRADIENTE DE DENSIDAD DE CÉLULAS, VIRUS Y PARTÍCULAS CELULARES. PERCOLL CONSISTE EN PARTÍCULAS DE SÍLICE COLOIDAL DE 15– 30 NM DE DIÁMETRO (23% P/P EN AGUA) QUE HAN SIDO RECUBIERTAS CON POLIVINILPIRROLIDONA (PVP). LA PVP HACE QUE EL PRODUCTO SEA COMPLETAMENTE ATÓXICO E IDEAL PARA UTILIZAR CON MATERIALES BIOLÓGICOS. FRASCO DE 25 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5883.92", "subtotal": "5883.92", "tax": "941.43", "other_taxes": null, "total": "6825.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERLAS MAGNÉTICAS DE ESTREPTAVIDINA (STREPTAVIDIN MAGNETIC BEADS), LÍQUIDO, 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10781.68", "subtotal": "10781.68", "tax": "1725.07", "other_taxes": null, "total": "12506.75" }, { "number": "0", "cucop_code": "25901-1865", "description": "PERSULFATO DE AMONIO, 10 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "750", "subtotal": "750", "tax": "120", "other_taxes": null, "total": "870" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRANSCRIPTASA INVERSA, LÍQUIDO A 200 U/µL. 10,000 UNIDADES (10,000 U)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3515.93", "subtotal": "3515.93", "tax": "562.55", "other_taxes": null, "total": "4078.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZOL, REACTIVO PARA EXTRACCIÓN DE RNA, 200 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9945.6", "subtotal": "9945.6", "tax": "1591.3", "other_taxes": null, "total": "11536.9" }, { "number": "0", "cucop_code": "25101-0039", "description": "X-GAL (5-BROMO-4-CHLORO-3-INDOLYL ß-D-GALACTOPYRANOSIDE ), 1 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2105", "subtotal": "2105", "tax": "336.8", "other_taxes": null, "total": "2441.8" }, { "number": "0", "cucop_code": "25101-0049", "description": "MEZCLA DE AMINOÁCIDOS NO ESENCIALES PARA CULTIVO CELULAR. FRASCO CON 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "565", "subtotal": "565", "tax": "90.4", "other_taxes": null, "total": "655.4" }, { "number": "0", "cucop_code": "25901-0844", "description": "ALBÚMINA DE SUERO DE BOVINO, POLVO LIOFILIZADO,ESENCIALMENTE LIBRE DE IGG, BAJO EN ENDOTOXINAS, APTO PATA CULTIVO CELULAR. FRASCO CON 100 GR", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4650.75", "subtotal": "9301.5", "tax": "1488.24", "other_taxes": null, "total": "10789.74" }, { "number": "0", "cucop_code": "25101-0049", "description": "SOLUCIÓN DE ANTIBIÓTICO Y ANTIMICÓTICO (10,000 U/ML DE PENICILINA, 10,000 µG/ML DE ESTREPTOMICINA Y 25 µG/ML DE ANFOTERICINA B), ESTÉRIL, CONGELADO (100X). 100 ML", "unit": "UNIDAD", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1170.36", "subtotal": "11703.6", "tax": "1872.58", "other_taxes": null, "total": "13576.18" }, { "number": "0", "cucop_code": "25101-0039", "description": "COLORANTE DE VIABILIDAD DE CALCEÍNA AM. CAJA 20 X 50 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9460", "subtotal": "9460", "tax": "1513.6", "other_taxes": null, "total": "10973.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DIFERENCIACIÓN DE NEURONAS DOPAMINÉRGICAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "76534.5", "subtotal": "76534.5", "tax": "12245.52", "other_taxes": null, "total": "88780.02" }, { "number": "0", "cucop_code": "25101-0049", "description": "DIHIDROCLORURO DE PUROMICINA DE STREPTOMYCES ALBONIGER. FRASCO 25 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3219", "subtotal": "3219", "tax": "515.04", "other_taxes": null, "total": "3734.04" }, { "number": "0", "cucop_code": "25901-1906", "description": "L-GLUTAMINA (200 MM, 100X), LÍQUIDO PARA CULTIVO CELULAR, 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "210", "subtotal": "210", "tax": "33.6", "other_taxes": null, "total": "243.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "LÍNEA CELULAR, CÉLULAS PROGENITORAS NEURONALES DERIVADAS BYS012, NORMAL; HUMANO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "60123.26", "subtotal": "60123.26", "tax": "9619.72", "other_taxes": null, "total": "69742.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "NEURONAS CORTICALES DE HUMANO HCN-2 (HCN2)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "39839", "subtotal": "39839", "tax": "6374.24", "other_taxes": null, "total": "46213.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO EN POLVO DMEM BAJO EN GLUCOSA. CAJA CON 20 SOBRES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1243.2", "subtotal": "1243.2", "tax": "198.91", "other_taxes": null, "total": "1442.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM BAJO EN GLUCOSA EN POLVO. CON 1 G/L DE GLUCOSA, GLUTAMINA Y PIRUVATO DE SODIO SIN BICARBONATO DE SODIO NI HEPES. 1 PAQUETE CON 10 SOBRES (= 10 LITROS)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "648", "subtotal": "648", "tax": "103.68", "other_taxes": null, "total": "751.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO CELULAR DMEM/F-12, POLVO ESTÉRIL EN SOBRES, ADICIONADO CON L-GLUTAMINA Y ROJO DE FENOL. CAJA CON 10 SOBRES (1X10L)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "396", "subtotal": "396", "tax": "63.36", "other_taxes": null, "total": "459.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEM, MEDIO ESENCIAL MÍNIMO EAGLE. CON SALES EARLE'S, L-GLUTAMINA SIN BICARBONATO DE SODIO. EN POLVO, CAJA CON 10 SOBRES (10L)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "958.82", "subtotal": "958.82", "tax": "153.41", "other_taxes": null, "total": "1112.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO EAGLE MODIFICADO DE DULBECCO)/F-12 (DMEM/F12). EN POLVO, CAJA CON 10 SOBRES (10L)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1981.35", "subtotal": "1981.35", "tax": "317.02", "other_taxes": null, "total": "2298.37" }, { "number": "0", "cucop_code": "25901-1244", "description": "SOLUCIÓN PIRUVATO DE SODIO 100 MM, 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "340", "subtotal": "340", "tax": "54.4", "other_taxes": null, "total": "394.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "DETERGENTE CONCENTRADO PH 12.00 PARA LIMPIEZA DE MATERIAL DE VIDRIO, PLÁSTICO, ACERO INOXIDABLE Y PORCELANA. 4 L", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "397.6", "subtotal": "1590.4", "tax": "254.46", "other_taxes": null, "total": "1844.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "DETERGENTE NEUTRO CONCENTRADO LIBRE DE FOSFATOS PH 7.0 PARA LAVADO DE MATERIAL DE VIDRIO, PLÁSTICO Y PORCELANA. 4 L", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "397.6", "subtotal": "1590.4", "tax": "254.46", "other_taxes": null, "total": "1844.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 PARA BIOLOGÍA MOLECULAR; EXTRACCIÓN DE PROTEÍNAS, BUFFER, LAVADOS, WESTERNBLOT, ELISA. FRASCO DE 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "465.5", "subtotal": "465.5", "tax": "74.48", "other_taxes": null, "total": "539.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20, LÍQUIDO VISCOSO. FRASCO CON 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "745.5", "subtotal": "745.5", "tax": "119.28", "other_taxes": null, "total": "864.78" }, { "number": "0", "cucop_code": "25901-1762", "description": "TWEEN 80, LÍQUIDO VISCOSO. FRASCO CON 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1103.9", "subtotal": "1103.9", "tax": "176.62", "other_taxes": null, "total": "1280.52" }, { "number": "0", "cucop_code": "25901-1791", "description": "TRITON X100. FRASCO 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "730", "subtotal": "730", "tax": "116.8", "other_taxes": null, "total": "846.8" }, { "number": "0", "cucop_code": "25901-1622", "description": "DIGITONINA. FRASCO DE 1 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10365.5", "subtotal": "10365.5", "tax": "1658.48", "other_taxes": null, "total": "12023.98" }, { "number": "0", "cucop_code": "25501-0090", "description": "CASSETES DE INCLUSIÓN PARA MICROPROCESAMIENTO CON 6 COMPARTIMIENTOS, DE POLÍMERO DE ACETAL DE 7 X 12 X 5 MM, CON 3000 ABERTURAS CUADRADAS DE 0,36 MM. CAJA C/50 PZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5240", "subtotal": "5240", "tax": "838.4", "other_taxes": null, "total": "6078.4" }, { "number": "0", "cucop_code": "25501-0298", "description": "PAPEL SEDA, UTILIZADO PARA LIMPIAR LENTES DE MICROSCOPIO SIN RAYARLOS. BLOCK CON 100 HOJAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "55.5", "subtotal": "111", "tax": "17.76", "other_taxes": null, "total": "128.76" }, { "number": "0", "cucop_code": "25101-0049", "description": "PERÓXIDO DE HIDRÓGENO 3%. FRASCO SOLUCIÓN 200 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "309.4", "subtotal": "618.8", "tax": "99.01", "other_taxes": null, "total": "717.81" }, { "number": "0", "cucop_code": "25501-0411", "description": "PORTA OBJETOS DE 25MM X 75 MM. CAJA C/50 PZAS", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "30", "subtotal": "120", "tax": "19.2", "other_taxes": null, "total": "139.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT EN BASE DE COLUMNAS PARA PURIFICACIÓN DE RNA TOTAL Y RNA INTEREFERENCIA. CAJA CON 50 COLUMNAS.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5808.08", "subtotal": "5808.08", "tax": "929.29", "other_taxes": null, "total": "6737.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ETIQUETADO DE CÉLULAS MULTICOLOR. SOLUCIONES DE LOS COLORANTES DIL, DID, Y DIO PARA EL MARCAJE FLUORESCENTE DE CÉLULAS. CAJA CON 1 ML DE CADA SOLUCIÓN", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8974.35", "subtotal": "8974.35", "tax": "1435.9", "other_taxes": null, "total": "10410.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA FAGOCITOSIS, PARTÍCULAS DE ZYMOSAN ACOPLADAS A PHRODO VERDE, 5 X 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11111.1", "subtotal": "11111.1", "tax": "1777.78", "other_taxes": null, "total": "12888.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA DETERMINACION DE IL-6 HUMANO POR ELISA. KIT PARA 5 PLACAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14234.22", "subtotal": "14234.22", "tax": "2277.48", "other_taxes": null, "total": "16511.7" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE PURIFICACIÓN DE ADN MICROBIANO DE UNA VARIEDAD DE MUESTRAS DE ENTRADA QUE ESTÁ INMEDIATAMENTE LISTO PARA ANÁLISIS DE MICROBIOMA O METAGENOMA (ZYMOBIOMICS DNA MINIPREP). 50 REACTIVOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8840", "subtotal": "8840", "tax": "1414.4", "other_taxes": null, "total": "10254.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA DETERMINACIÓN DE TNF-A HUMANO POR ELISA. KIT PARA 5 PLACAS.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "21178.8", "subtotal": "21178.8", "tax": "3388.61", "other_taxes": null, "total": "24567.41" }, { "number": "0", "cucop_code": "25101-0049", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 4.0, FRASCO 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "163.52", "subtotal": "163.52", "tax": "26.16", "other_taxes": null, "total": "189.68" }, { "number": "0", "cucop_code": "25901-1228", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 7.0, FRASCO 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "154.74", "subtotal": "154.74", "tax": "24.76", "other_taxes": null, "total": "179.5" }, { "number": "0", "cucop_code": "25101-0049", "description": "SOLUCIÒN AMORTIGUADRA DE REFERENCIA PH 10.0, FRASCO 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "156.35", "subtotal": "156.35", "tax": "25.02", "other_taxes": null, "total": "181.37" }, { "number": "0", "cucop_code": "25101-0049", "description": "CLORURO DE COBRE (II) 99%. FRASCO 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1826.16", "subtotal": "1826.16", "tax": "292.19", "other_taxes": null, "total": "2118.35" }, { "number": "0", "cucop_code": "25101-0049", "description": "FOSFATO MONOBÁSICO DE POTASIO ACS, =99,0%. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "623.88", "subtotal": "623.88", "tax": "99.82", "other_taxes": null, "total": "723.7" }, { "number": "0", "cucop_code": "25101-0049", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS ACS, =99,0%. FRASCO 500 GR", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1038.16", "subtotal": "1038.16", "tax": "166.11", "other_taxes": null, "total": "1204.27" }, { "number": "0", "cucop_code": "25101-0049", "description": "FOSFATO DE SODIO DIBÁSICO ( NA2HPO4) ANHIDRO. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "747.97", "subtotal": "747.97", "tax": "119.68", "other_taxes": null, "total": "867.65" }, { "number": "0", "cucop_code": "25101-0049", "description": "FOSFATO DE SODIO MONOBÁSICO. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "605.62", "subtotal": "605.62", "tax": "96.9", "other_taxes": null, "total": "702.52" }, { "number": "0", "cucop_code": "25101-0049", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO ACS, =99,0%. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "605.62", "subtotal": "605.62", "tax": "96.9", "other_taxes": null, "total": "702.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCOSA. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "390", "subtotal": "390", "tax": "62.4", "other_taxes": null, "total": "452.4" }, { "number": "0", "cucop_code": "25901-1823", "description": "OXIDO DE MERCURIO ROJO (HGO) ACS. POLVO. FRASCO DE 50 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1627.94", "subtotal": "1627.94", "tax": "260.47", "other_taxes": null, "total": "1888.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE POTASIO ACS, =99,0%. FRASCO DE 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "765.4", "subtotal": "765.4", "tax": "122.46", "other_taxes": null, "total": "887.86" }, { "number": "0", "cucop_code": "25901-1416", "description": "METABISULFITO DE SODIO, 98-100.5%, 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "360", "subtotal": "360", "tax": "57.6", "other_taxes": null, "total": "417.6" }, { "number": "0", "cucop_code": "25901-1850", "description": "CLORURO DE MAGNESIO HEXAHIDRATADO, 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "578.04", "subtotal": "578.04", "tax": "92.49", "other_taxes": null, "total": "670.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "BROMURO DE 3-(4,5-DIMETILTIAZOL-2-IL)-2,5-DIFENILTETRAZOLIO (MTT), 5 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5540", "subtotal": "5540", "tax": "886.4", "other_taxes": null, "total": "6426.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "BROMURO DE AZUL DE TIAZOLILO DE TETRAZOLIO (MTT) (ADECUADO PARA CULTIVO CELULAR), 1 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1850", "subtotal": "1850", "tax": "296", "other_taxes": null, "total": "2146" }, { "number": "0", "cucop_code": "25101-0049", "description": "CLORURO DE SODIO GRADO ACS =99,0%. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "19", "awarded_quantity": null, "unit_price": "235", "subtotal": "4465", "tax": "714.4", "other_taxes": null, "total": "5179.4" }, { "number": "0", "cucop_code": "25901-1781", "description": "YODURO DE SODIO. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1088.31", "subtotal": "1088.31", "tax": "174.13", "other_taxes": null, "total": "1262.44" }, { "number": "0", "cucop_code": "25101-0049", "description": "NITRITO DE SODIO GRADO REACTIVO =99.0%. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "893.6", "subtotal": "893.6", "tax": "142.98", "other_taxes": null, "total": "1036.58" }, { "number": "0", "cucop_code": "25101-0049", "description": "SAL DISÓDICA DE CARBENICILINA GRADO USP DE 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5780", "subtotal": "5780", "tax": "924.8", "other_taxes": null, "total": "6704.8" }, { "number": "0", "cucop_code": "25101-0049", "description": "SULFATO DE ALUMINIO Y AMONIO. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1245.73", "subtotal": "1245.73", "tax": "199.32", "other_taxes": null, "total": "1445.05" }, { "number": "0", "cucop_code": "25901-1710", "description": "SULFATO DE ALUMINIO Y POTASIO. REACTIVO ACS. POLVO. FRASCO 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "813.15", "subtotal": "813.15", "tax": "130.1", "other_taxes": null, "total": "943.25" }, { "number": "0", "cucop_code": "25101-0057", "description": "SULFATO DE ZINC HEPTAHIDRATADO 99.5-100.5%, FRASCO DE 100 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "248.59", "subtotal": "248.59", "tax": "39.77", "other_taxes": null, "total": "288.36" }, { "number": "0", "cucop_code": "25901-1746", "description": "PORRÓN DE ALCOHOL ABSOLUTO. PORRÓN DE 20 L", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4406.29", "subtotal": "8812.58", "tax": "1410.01", "other_taxes": null, "total": "10222.59" }, { "number": "0", "cucop_code": "25901-1746", "description": "ETANOL ABSOLUTO, 19 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4406.29", "subtotal": "4406.29", "tax": "705.01", "other_taxes": null, "total": "5111.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICEROL Ó 1,2,3-PROPANOTRIOL PARA BIOLOGÍA MOLECULAR, PUREZA MAYOR AL 99%, 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1070", "subtotal": "1070", "tax": "171.2", "other_taxes": null, "total": "1241.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOPROPANOL. BOTELLA DE 1 L", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "556.85", "subtotal": "1113.7", "tax": "178.19", "other_taxes": null, "total": "1291.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOPROPOXIDO DE TITANIO (IV) PUREZA MAYOR AL 97%, 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2705", "subtotal": "2705", "tax": "432.8", "other_taxes": null, "total": "3137.8" }, { "number": "0", "cucop_code": "25901-1604", "description": "HIDRÓXIDO DE AMONIO , PUREZA 30-33% NH3 EN AGUA. FRASCO 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "493", "subtotal": "493", "tax": "78.88", "other_taxes": null, "total": "571.88" }, { "number": "0", "cucop_code": "25101-0049", "description": "N,N-DIMETILFORMAMIDA. FRASCO 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "791.5", "subtotal": "791.5", "tax": "126.64", "other_taxes": null, "total": "918.14" }, { "number": "0", "cucop_code": "25101-0049", "description": "SUDAN NEGRO. FRASCO 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "950", "subtotal": "950", "tax": "152", "other_taxes": null, "total": "1102" }, { "number": "0", "cucop_code": "25501-0104", "description": "LÁPIZ PUNTA DIAMANTE TIPO PLUMA PARA MARCAJE DE MATERIAL DE VIDRIO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "354.38", "subtotal": "354.38", "tax": "56.7", "other_taxes": null, "total": "411.08" }, { "number": "0", "cucop_code": "25101-0049", "description": "MEDIO DE MONTAJE BASADO EN GLICEROL ACUOSO QUE NO SE SOLIDIFIQUE, SINO SEA LÍQUIDO VISCOSO EN LA LAMINILLA, QUE NO SE SEQUE FÁCILMENTE AL MANTENER LA LAMINILLA SELLADA, MEZCLADO CON DAPI PARA TEÑIR LOS NÚCLEOS. FRASCO DE 10 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2292.15", "subtotal": "2292.15", "tax": "366.74", "other_taxes": null, "total": "2658.89" }, { "number": "0", "cucop_code": "25901-1437", "description": "RODAMINA FALOIDINA. FRASCO PARA 300 PRUEBAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6755", "subtotal": "6755", "tax": "1080.8", "other_taxes": null, "total": "7835.8" }, { "number": "0", "cucop_code": "25901-1479", "description": "GLICINA EN POLVO (GRADO BIOLOGIA MOLECULAR), ADECUADA PARA SU USO EN ELECTROFORESIS. FRASCO CON 2 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2155", "subtotal": "2155", "tax": "344.8", "other_taxes": null, "total": "2499.8" }, { "number": "0", "cucop_code": "25901-1479", "description": "GLICINA EN POLVO, ADECUADA PARA SU USO EN ELECTROFORESIS. FRASCO CON 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1312", "subtotal": "1312", "tax": "209.92", "other_taxes": null, "total": "1521.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE PARA MEMBRANAS DE PVDF Y NITROCELULOSA. KIT CON 2 BOTELLAS DE 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3011", "subtotal": "3011", "tax": "481.76", "other_taxes": null, "total": "3492.76" }, { "number": "0", "cucop_code": "25101-0049", "description": "LECHE EN POLVO DESCREMADA (LIBRE DE GRASA) PARA APLICACIONES DE WESTERN BLOT. FRASCO DE 300 G", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "980", "subtotal": "2940", "tax": "470.4", "other_taxes": null, "total": "3410.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEMBRANA DE NITROCELULOSA DE 0.45 µM PARA APLICACIONES DE WESTERN BLOT. ROLLO DE 3 METROS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4160", "subtotal": "8320", "tax": "1331.2", "other_taxes": null, "total": "9651.2" }, { "number": "0", "cucop_code": "25501-0092", "description": "ALAMBRE DE PLATA DE 0.01 PULGADAS CORTADO A LA MEDIDA Y ENROLLADO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1613.56", "subtotal": "1613.56", "tax": "258.17", "other_taxes": null, "total": "1871.73" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOMBA DE JERINGA. MODO DE TRABAJO: INFUSION, PARA UNA JERINGA, 10 µL-60 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "77752", "subtotal": "77752", "tax": "12440.32", "other_taxes": null, "total": "90192.32" }, { "number": "0", "cucop_code": "25501-0018", "description": "BOTELLA DE BOROSILICATO DE VIDRIO AMBAR, CUELLO ROSCADO ANCHO CON TAPAROSCA (GL 45 COLOR AZUL Y ANILLO DE VERTIDO EN POLIPROPILENO). 1 LITRO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "768.59", "subtotal": "768.59", "tax": "122.97", "other_taxes": null, "total": "891.56" }, { "number": "0", "cucop_code": "25501-0097", "description": "BROCHA DE 1/2 PULGADA PARA LIMPIAR BALANZA ANALÍTICA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "410.12", "subtotal": "410.12", "tax": "65.62", "other_taxes": null, "total": "475.74" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA AUTOCLAVABLE PARA ALMACENAMIENTO DE MICROTUBOS CON 100 ESPACIOS DE 12.3 MM DE DIÁMETRO, COMPATIBLE CON TUBOS DE 1.5 Y 2 ML O VIALES CRIOGÉNICOS, RANGO DE TEMPERATURA DE -80 A 121 °C Y UTILIZARSE EN ULTRACONGELADOR. PAQUETE DE 5 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "425", "subtotal": "425", "tax": "68", "other_taxes": null, "total": "493" }, { "number": "0", "cucop_code": "25501-0183", "description": "CAJA PARA ALMACENAR PORTAOBJETOS (LAMINILLAS). CON CAPACIDAD PARA ALMACENAR 100 LAMINILLAS", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "370", "subtotal": "1480", "tax": "236.8", "other_taxes": null, "total": "1716.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA REFRIGERANTE (NEVERA) PARA 12 MICROTUBOS DE 1.5 ML. BASE Y TAPA DE POLICARBONATO. ARREGLO DE 3X4. MANTIENE TEMPERATURAS INFERIORES A -15°C HASTA POR 1 HORA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8032.81", "subtotal": "8032.81", "tax": "1285.25", "other_taxes": null, "total": "9318.06" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS DE CULTIVO ESTÉRILES DE 6 POZOS SIN TRATAMIENTO (ULTRA BAJA RETENCIÓN) PLACA DE 6 POZOS NO TRATADA, FONDO PLANO CON TAPA, ESTÉRIL, ENVUELTA INDIVIDUALMENTE. CAJA CON 60 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2135.36", "subtotal": "2135.36", "tax": "341.66", "other_taxes": null, "total": "2477.02" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS DE CULTIVO ESTÉRILES DE 96 POZOS SIN TRATAMIENTO (ULTRA BAJA RETENCIÓN) PLACAS DE POLIESTIRENO, ESTÉRILES NO TRATADAS PARA CULTIVO CELULAR, CON TAPA ESTÉRILES, ENVUELTAS INDIVIDUALMENTE. CAJA CON 6 PIEZAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2260", "subtotal": "4520", "tax": "723.2", "other_taxes": null, "total": "5243.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS PARA LA TÉCNICA DE ELISA DE 96 POZOS CON TAPA. FABRICADAS EN POLIESTIRENO TRANSPARENTE CON EXCELENTE CALIDAD ÓPTICA, IDEAL PARA MEDICIONES ÓPTICAS. PAQUETE CON 6 CAJAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2905.27", "subtotal": "5810.54", "tax": "929.69", "other_taxes": null, "total": "6740.23" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS TRANSWELL DE 12 POZOS CON INSERTOS DE 12MM Y MEMBRANA DE 3µ M, PARA CULTIVO CELULAR, ESTÈRILES. PAQUETE DE 12, CAJA DE 48", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3318.5", "subtotal": "3318.5", "tax": "530.96", "other_taxes": null, "total": "3849.46" }, { "number": "0", "cucop_code": "25501-0089", "description": "CÁMARA DE CONTEO CELULAR, HEMOCITÓMETRO NEUBAUER MEJORADA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3650", "subtotal": "3650", "tax": "584", "other_taxes": null, "total": "4234" }, { "number": "0", "cucop_code": "25501-0051", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.2, I.D. 0.94 LAGO 10 CM, TUBO CON 25", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "78.75", "subtotal": "78.75", "tax": "12.6", "other_taxes": null, "total": "91.35" }, { "number": "0", "cucop_code": "25501-0051", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D 1.65, I.D 1.20 LARGO 10 CM, TUBO CON 140", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "178.87", "subtotal": "178.87", "tax": "28.62", "other_taxes": null, "total": "207.49" }, { "number": "0", "cucop_code": "25501-0051", "description": "CAPILARES DE BOROSILICATO SIN FILAMENTO DE O.D 1.65, I.D 1.20 LARGO 10 CM, TUBO CON 140", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "178.87", "subtotal": "178.87", "tax": "28.62", "other_taxes": null, "total": "207.49" }, { "number": "0", "cucop_code": "25501-0051", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.5, I.D. 0.86 LARGO 10 CM, TUBO CON 250", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "195.5", "subtotal": "195.5", "tax": "31.28", "other_taxes": null, "total": "226.78" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRIOVIALES CRIOGÉNICOS DE 2 ML MICRO TUBOS DE POLIPROPILENO CLARO, ESTÉRILES, CON GRADUACIÓN Y FALDÓN PARA SOSTENERSE VERTICALES, RESISTENTES TEMPERATURAS HASTA DE -196°C. TAPA DE ROSCA INCLUÍDA, CIERRE HERMÉTICO. BOLSA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2600.2", "subtotal": "2600.2", "tax": "416.03", "other_taxes": null, "total": "3016.23" }, { "number": "0", "cucop_code": "25501-0089", "description": "CUBRE OBJETOS DE BOROSILICATO REDONDOS INCOLOROS PARA MICROSCOPIA DE FLUORESCENCIA DE 14MM. CAJA 100", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "410.56", "subtotal": "410.56", "tax": "65.69", "other_taxes": null, "total": "476.25" }, { "number": "0", "cucop_code": "25501-0089", "description": "CUBREOBJETOS 24 X 24. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "28", "subtotal": "448", "tax": "71.68", "other_taxes": null, "total": "519.68" }, { "number": "0", "cucop_code": "25501-0089", "description": "CUBREOBJETOS DE 24 X 24 MM. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "28", "subtotal": "224", "tax": "35.84", "other_taxes": null, "total": "259.84" }, { "number": "0", "cucop_code": "25501-0026", "description": "ESTACIÓN DE TRABAJO PARA 4 PIPETAS TIPO EPPENFORD CON DISPENSADOR DE PUNTAS CON TAPA DE ACRÍLICO 9 5/8\"W X 9 11/16 \"H X 6 1/2\" L.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4935", "subtotal": "4935", "tax": "789.6", "other_taxes": null, "total": "5724.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS ESTÉRILES DE PRE-SEPARACIÓN CELULAR COMPATIBLES CON TUBOS CÓNICOS DE 5, 13 Y 15 ML, COLUMNAS MAGNÉTICAS LS. MS, CON MALLA DE 20 UM, CAJA 50 FILTROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1368.77", "subtotal": "1368.77", "tax": "219", "other_taxes": null, "total": "1587.77" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS ESTÉRILES DE PRE-SEPARACIÓN CELULAR COMPATIBLES CON TUBOS CÓNICOS DE 5, 13 Y 15 ML, COLUMNAS MAGNÉTICAS LS. MS, CON MALLA DE 30 UM, CAJA 50 FILTROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1368.77", "subtotal": "1368.77", "tax": "219", "other_taxes": null, "total": "1587.77" }, { "number": "0", "cucop_code": "25501-0089", "description": "FILTROS PES ESTÉRILES ENROSCABLES EN BOTELLAS DE CUELLO DE 45MM PARA CULTIVO CELULAR, CAJA CON 12 FILTROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3020.69", "subtotal": "3020.69", "tax": "483.31", "other_taxes": null, "total": "3504" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE CULTIVO CELULAR 25 CM2. FRASCO DE CULTIVO CELULAR ESTÉRIL CON TAPA VENTILADA CON FILTRO 0.2 MICRAST25. CAJA CON 200 PIEZAS (10 FRASCOS POR BOLSA)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4378.08", "subtotal": "4378.08", "tax": "700.49", "other_taxes": null, "total": "5078.57" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO TRANSPARENTES DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 500ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "34.29", "subtotal": "68.58", "tax": "10.97", "other_taxes": null, "total": "79.55" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA ENFRIADORAS \"COOLER\" PARA PLACAS DE 96 POZOS PARA USO EN PCR .", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2623.07", "subtotal": "2623.07", "tax": "419.69", "other_taxes": null, "total": "3042.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA REVERSIBLE PARA 64 LUGARES PARA TUBOS DE 0.6. 1.6-2.0 ML. PAQUETE CON 5 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "375", "subtotal": "375", "tax": "60", "other_taxes": null, "total": "435" }, { "number": "0", "cucop_code": "25501-0090", "description": "HERRAMIENTA DE INSTALACIÓN DE TAPONES MICROAMP", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1350", "subtotal": "1350", "tax": "216", "other_taxes": null, "total": "1566" }, { "number": "0", "cucop_code": "25501-0092", "description": "HOJA DE BISTURÍ NUM. 20 CAJA ESTÉRIL CAJA C/100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "149.48", "subtotal": "298.96", "tax": "47.83", "other_taxes": null, "total": "346.79" }, { "number": "0", "cucop_code": "25501-0092", "description": "HOJAS PARA BISTURI # 10", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "149.48", "subtotal": "149.48", "tax": "23.92", "other_taxes": null, "total": "173.4" }, { "number": "0", "cucop_code": "25501-0092", "description": "HOMOGENEIZADOR PARA TEJIDO TIPO POTTER ELVEHJEM 2ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5917", "subtotal": "11834", "tax": "1893.44", "other_taxes": null, "total": "13727.44" }, { "number": "0", "cucop_code": "25501-0092", "description": "HOMOGENEIZADOR PARA TEJIDO TIPO POTTER ELVEHJEM DE 5 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5991.5", "subtotal": "11983", "tax": "1917.28", "other_taxes": null, "total": "13900.28" }, { "number": "0", "cucop_code": "25501-0536", "description": "JUEGO DE AGITADORES MAGNÉTICOS BLANCOS DE DIFERENTES MEDIDAS, EN FORMA OCTAGONAL CON ANILLO AL CENTRO Y DOS MEDIDAS DIFERENTES EN FORMA MICRO. ESTUCHE CON 16 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3558.41", "subtotal": "3558.41", "tax": "569.35", "other_taxes": null, "total": "4127.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "JUEGO DE BANDEJA/RETENEDOR MICROAMP DE 96 POCILLOS. CAJA DE 10 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2470", "subtotal": "2470", "tax": "395.2", "other_taxes": null, "total": "2865.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "MARCADORES INDELEBLES PARA CRIOVIALES PAQUETE CON 4 (ROJO, AZUL, VERDE Y NEGRO).", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1070", "subtotal": "1070", "tax": "171.2", "other_taxes": null, "total": "1241.2" }, { "number": "0", "cucop_code": "25501-0098", "description": "MEMBRANA PARA FILTRACIÓN DE DISOLVENTES ORGÁNICOS (HIDROFÓBICA) TIPO HVLP 0.45 MICRAS DE PORO. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12520", "subtotal": "12520", "tax": "2003.2", "other_taxes": null, "total": "14523.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROPLACA DE 96 POZOS NO TRATADA, MEDIA ÁREA, NEGRA CON TAPA FONDO PLANO, ESTÉRIL. PAQUETE CON 25 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5403.31", "subtotal": "5403.31", "tax": "864.53", "other_taxes": null, "total": "6267.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROTUBOS 2 ML TRANSPARENTE. BOLSA 1000 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "280", "subtotal": "280", "tax": "44.8", "other_taxes": null, "total": "324.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "PAÑOS DE PAPEL PARA TAREAS DELICADAS (LIMPIEZA DE CELDAS DE CUARZO Y LENTES DE MICROSCOPIO), CAJA CON 200-300 PAÑOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "53.31", "subtotal": "53.31", "tax": "8.53", "other_taxes": null, "total": "61.84" }, { "number": "0", "cucop_code": "25501-0092", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIO BLOCK CON 100 HOJAS DE 10 X 15 CM. BLOCK CON 100 HOJAS.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "53.31", "subtotal": "53.31", "tax": "8.53", "other_taxes": null, "total": "61.84" }, { "number": "0", "cucop_code": "25501-0526", "description": "PELÍCULA TERMOPLÁSTICA, SEMITRANSPARENTE , PARA LABORATORIO (PARAFILM), ROLLO DE 10 CM X 76 M", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1040", "subtotal": "2080", "tax": "332.8", "other_taxes": null, "total": "2412.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETAS SEROLOGICAS ESTÉRILES EMPACADAS INDIVIDUALMENTE LIBRES DE PIROGENOS DE 10 ML. CAJA CON 500 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1045", "subtotal": "1045", "tax": "167.2", "other_taxes": null, "total": "1212.2" }, { "number": "0", "cucop_code": "25501-0419", "description": "PUNTAS DE JERINGA PARA PIPETAS DE REPETICIÓN DE 0.1 ML, NO ESTÉRILES. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2574.34", "subtotal": "2574.34", "tax": "411.89", "other_taxes": null, "total": "2986.23" }, { "number": "0", "cucop_code": "25501-0420", "description": "PUNTAS DE CARGA DE GEL (ESTÁNDAR, REDONDAS). VOLUMEN DE CARGA DE 0,5 - 200 µL. LONGITUD IMPERIAL: 2.75 PULGADAS. LIBRES DE ARNASA NI ADNASA. MATERIAL: POLIPROPILENO. PAQUETE CON 1000 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "699", "subtotal": "699", "tax": "111.84", "other_taxes": null, "total": "810.84" }, { "number": "0", "cucop_code": "25501-0426", "description": "PUNTAS ESTÁNDAR PARA MICROPIPETA INCOLORAS DE 0.1 A 20 UL. NO ESTÉRILES. AUTOCLAVEABLES. CAJA CON 2 PAQUETES DE 500 PZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2" }, { "number": "0", "cucop_code": "25501-0426", "description": "PUNTAS PARA MICROPIPETA DE 10 µL. FABRICADAS DE POLIPROPILENO, LIBRE DE DNASA Y RNASA. ESTUCHE CON 96 PUNTAS, 50 RACKS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "581.02", "subtotal": "1162.04", "tax": "185.93", "other_taxes": null, "total": "1347.97" }, { "number": "0", "cucop_code": "25501-0428", "description": "PUNTAS PARA MICROPIPETA DE 1000 UL, FABRICADAS DE POLIPROPILENO. BOLSA CON 1000", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "172.5", "subtotal": "517.5", "tax": "82.8", "other_taxes": null, "total": "600.3" }, { "number": "0", "cucop_code": "25501-0416", "description": "PUNTAS DE 50 ML PARA PIPETA REPETIDORA. PUNTAS DE PLÁSTICO TRANSPARENTE COMPATIBLES CON DISPENSADORES DE REPTICIÓN EPPENDORF Y LABNET. CAPACIDAD 50 ML, CAJA CON 100 PUNTAS EN EMPAQUE INDIVIDUAL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6095.58", "subtotal": "6095.58", "tax": "975.29", "other_taxes": null, "total": "7070.87" }, { "number": "0", "cucop_code": "25501-0089", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 100 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1324.62", "subtotal": "1324.62", "tax": "211.94", "other_taxes": null, "total": "1536.56" }, { "number": "0", "cucop_code": "25501-0089", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 40 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1324.62", "subtotal": "1324.62", "tax": "211.94", "other_taxes": null, "total": "1536.56" }, { "number": "0", "cucop_code": "25501-0089", "description": "TAMICES CELULARES CON FILTROS DESECHABLES CON AJUSTE A TUBOS CÓNICOS DE 50 ML, MALLA DE NYLON 70 UM, POLIPROPILENO, ESTÉRILES. CAJA 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1324.62", "subtotal": "1324.62", "tax": "211.94", "other_taxes": null, "total": "1536.56" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO PARA LABORATORIO DE -20 A 100 °C.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "116.25", "subtotal": "116.25", "tax": "18.6", "other_taxes": null, "total": "134.85" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBERÍA DE LÁTEX CALIBRE 5.55 X 1.53 MM, 5 METROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "41.91", "subtotal": "41.91", "tax": "6.71", "other_taxes": null, "total": "48.62" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO P/CENTRÍFUGA, DE 50 ML CON TAPÓN DE ROSCA DE POLIPROPILENO, FONDO REDONDO, NO ESTÉRIL. PAQUETE CON 20 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "420.62", "subtotal": "420.62", "tax": "67.3", "other_taxes": null, "total": "487.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE POLIPROPILENO DE PAREDES 2 ML. BOLSA 1000 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "381.13", "subtotal": "381.13", "tax": "60.98", "other_taxes": null, "total": "442.11" }, { "number": "0", "cucop_code": "25501-0089", "description": "UNIDAD DE FILTRACIÓN DESECHABLE DE 500 ML , DE PORO 0.22µM ,CON ADAPTADOR PARA VACÍO, ESTÉRIL, CON TAPA Y RESERVORIO GRADUADO. EMPAQUETADO INDIVIDUALMENTE, LIBRE DE PIRÓGENOS. CAJA CON 12", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1497.78", "subtotal": "2995.56", "tax": "479.29", "other_taxes": null, "total": "3474.85" }, { "number": "0", "cucop_code": "25501-0089", "description": "UNIDAD DE FILTRO DE JERINGA GV PORO 0.22 MICROMETROS, ESTÉRILES, CON ENVOLTURA INDIVIDUAL. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2640.71", "subtotal": "7922.13", "tax": "1267.54", "other_taxes": null, "total": "9189.67" }, { "number": "0", "cucop_code": "25501-0089", "description": "UNIDADES DE FILTRACIÓN POR VACÍO, DE LIBERACIÓN RÁPIDA, DESECHABLES, CON MATRAZ RECEPTOR Y TAPÓN PARA PROCESAMIENTO Y ALMACENAMIENTO, CON MEMBRANAS DE FLUORURO DE POLIVINILIDENO (PVDF) DE MUY BAJA ADSORCIÓN DE PROTEÍNAS DE 0,22 µM PARA FILTRACIÓN ESTERILIZANTE, VOLUMEN DE 150 ML. PAQUETE DE 12 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1562.72", "subtotal": "1562.72", "tax": "250.04", "other_taxes": null, "total": "1812.76" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 250 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "64.87", "subtotal": "64.87", "tax": "10.38", "other_taxes": null, "total": "75.25" } ] }, { "id": "C-2026-00076377", "internal_reference": "INNN-DG-DA-SRM-LP-086-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "normalized_name": "CONTROL TECNICO Y REPRESENTACIONES", "rfc_type": null, "slug": "control-tecnico-y-representaciones" }, "contract_period": { "published_at": "2026-08-06T21:22:08.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "1801768", "tax": "288282.88", "total": "2090050.88", "maximum_subtotal": "3062216", "maximum_total": "3552170.560000003", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "TRIS BASE. FRASCO 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3262", "subtotal": "3262", "tax": "521.92", "other_taxes": null, "total": "3783.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS-HCL. FRASCO 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3155", "subtotal": "3155", "tax": "504.8", "other_taxes": null, "total": "3659.8" }, { "number": "0", "cucop_code": "25101-0049", "description": "ANANDAMIDA. 25 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8101", "subtotal": "8101", "tax": "1296.16", "other_taxes": null, "total": "9397.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLLAGENASA B (0.195 U/MG LYO). 500 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7116", "subtotal": "7116", "tax": "1138.56", "other_taxes": null, "total": "8254.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MALATO DE HIDRÓGENO MK-801. 50 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11626", "subtotal": "11626", "tax": "1860.16", "other_taxes": null, "total": "13486.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI-S100B DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-5HT1A ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO PARA WB. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6798", "subtotal": "6798", "tax": "1087.68", "other_taxes": null, "total": "7885.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-5-HT-1B ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATA, RATÓN, HUMANO PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7132", "subtotal": "7132", "tax": "1141.12", "other_taxes": null, "total": "8273.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL DE CONEJO ANTI-A1R (RECEPTOR DE ADENOSINA 1). VIAL CON 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9202", "subtotal": "9202", "tax": "1472.32", "other_taxes": null, "total": "10674.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-A2AR (RECEPTOR DE ADENOSINA 2A). VIAL CON 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8562", "subtotal": "8562", "tax": "1369.92", "other_taxes": null, "total": "9931.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO, ANTI-ABHD6 DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACIONES EN INMUNIHISTOQUIMICA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8909", "subtotal": "8909", "tax": "1425.44", "other_taxes": null, "total": "10334.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-ACMSD, PRODUCIDO EN CONEJO, REACTIVIDAD PARA HUMANO Y RATÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11709", "subtotal": "11709", "tax": "1873.44", "other_taxes": null, "total": "13582.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-ACTINA RATÓN 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI- ALFA SINUCLEÍNA ( 211) HUMANA HECHO EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA LOS RESIDUOS DE AMINOÁCIDOS 121-125 DE ALFASINUCLEINA HUMANA. VIAL CON 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7463", "subtotal": "7463", "tax": "1194.08", "other_taxes": null, "total": "8657.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-ALFA SINUCLEINA FOSFORILADA (SERINA 129) HUMANA HECHA EN CONEJO (CLONA JB22-44, ISOTIPO IGG) QUE RECONOZC LA SERINA 129 (M-P-S(P)-E-E) DERIVADA DE LA ALFASINUCLEÍNA HUMANA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9393", "subtotal": "9393", "tax": "1502.88", "other_taxes": null, "total": "10895.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-ALFA-SINUCLEINA 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9035", "subtotal": "9035", "tax": "1445.6", "other_taxes": null, "total": "10480.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-ATF4 (ACTIVATING TRANSCRIPTION FACTOR- 4). ANTICUERPO ANTI-ATF4 (ACTIVATING TRANSCRIPTION FACTOR- 4) ANTICUERPO MONOCLONAL HECHO EN RATÓN, PARA LA DETECCIÓN DE LA PROTEÍNA ACTIVATING TRANSCRIPTION FACTOR 4. PARA IF, WB, IP, IHC (P) Y ELISA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10060", "subtotal": "10060", "tax": "1609.6", "other_taxes": null, "total": "11669.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI BECLINA-1 POLICLONAL DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7374", "subtotal": "7374", "tax": "1179.84", "other_taxes": null, "total": "8553.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI BETA CATENINA DE HUMANO Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCIA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI-B- GALACTOSIDASA DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CAMK2, C-TERMINAL PRODUCIDO EN CONEJO, POLICLONAL, IDENTIFICAN: RATA, RATÓN Y HUMANO, PARA WB E IHC. VIAL CON 1000 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7869", "subtotal": "7869", "tax": "1259.04", "other_taxes": null, "total": "9128.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CASPASA 9 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6088", "subtotal": "6088", "tax": "974.08", "other_taxes": null, "total": "7062.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI- CD127 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA HIL-7R-M21 (RUO)) ACOPLADO A FICOERITRINA-CIANINA 7 (PE-CY7). VIAL PARA 100 TEST", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7275", "subtotal": "7275", "tax": "1164", "other_taxes": null, "total": "8439" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CD25 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K, CLONA BC96 (RUO)) ACOPLADO A FICOERITRINA (PE). VIAL PARA 100 TEST", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9895", "subtotal": "9895", "tax": "1583.2", "other_taxes": null, "total": "11478.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD8 ANTI-HUMANO MARCADO CON PE. VIAL PARA 100 TEST", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4853", "subtotal": "4853", "tax": "776.48", "other_taxes": null, "total": "5629.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRODUCIDO EN CONEJO, ANTI- CDKN2A DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13060", "subtotal": "13060", "tax": "2089.6", "other_taxes": null, "total": "15149.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-CFOS, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN 1 MG /ML, LÍQUIDO EN BUFFER PBS 50% + GLICEROL 50%, ADICIONADO CON 0.035% DE AZIDA DE SODIO 1 MG /ML, LÍQUIDO EN BUFFER PBS 50% + GLICEROL 50%, ADICIONADO CON 0.035% DE AZIDA DE SODIO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7432", "subtotal": "7432", "tax": "1189.12", "other_taxes": null, "total": "8621.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "CMYC ANTIBODY 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI COX IV DE HUMANO, RATA Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCI Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN, ANTI EAAT1 DE ORIGEN HUMANO, DE RATÓN Y DE RATA CON APLICACIONES EN INMUNOFLUORESENCIA, WESTERN BLOT Y ELISA. VIAL CON 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7605", "subtotal": "7605", "tax": "1216.8", "other_taxes": null, "total": "8821.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-EAAT1/GLAST, PRODUCIDO EN CONEJO, PARA RATA Y RATÓN, CONCENTRACIÓN APROX. 0.28 MG/ML, EN BUFFER PBS 1% Y GLICEROL 20% Y CONSERVADOR PROCLIN (0.025%) 300 CONCENTRACIÓN APROX. 0.28 MG/ML, EN BUFFER PBS 1% Y GLICEROL 20% Y CONSERVADOR PROCLIN (0.025%) 300. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7605", "subtotal": "7605", "tax": "1216.8", "other_taxes": null, "total": "8821.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI FLUORESCEINA ALEXA FLUOR 488", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8919", "subtotal": "8919", "tax": "1427.04", "other_taxes": null, "total": "10346.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-FOSFOTIROSINA (Y1068) DEL RECEPTOR DE CRECIMIENTO EPIDÉRMICO (EGFR) DE CONEJO O RATÓN, MONOCLONAL, CON REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL GENERADO EN RATÓN DIRIGIDO A LA PROTEÍNA ÁCIDA FIBRILAR GLIAL (GFAP) DE HUMANO, RATA Y CONEJO. APLICACIÓN EN WB-WESTERN BLOTTING, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA Y CITOMETRÍA DE FLUJO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8383", "subtotal": "8383", "tax": "1341.28", "other_taxes": null, "total": "9724.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-PROTEINA GLIAL FIBRILAR (GFAP), PRODUCIDO EN RATÓN, PARA HUMANO, RATÓN Y RATA, ACOPLADO A ALEXA FLUOR 488. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10528", "subtotal": "10528", "tax": "1684.48", "other_taxes": null, "total": "12212.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-GFAP¿, ANTICUERPO POLICLONAL PRODUCIDO EN POLLO, DIRIDO A DETECTAR GFAP EN RATA Y RATÓN, ÚTTIL EN WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA) E INMUNOFLUORESCENCIA.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9847", "subtotal": "9847", "tax": "1575.52", "other_taxes": null, "total": "11422.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HIF-1 ALFA (HIPOXIC INDUCIBLE FACTOR -1 ALFA). ANTICUERPO MONOCLONAL PRODUCIDO EN RATÓN PARA USO EN ICC/ IF, WB, IHC-F, IHC-P, ELISA, PARA DETECTAR LA PROTEÍNA HIF-1ALFA DE ORIGEN HUMANO, DE RATÓN Y DE RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8562", "subtotal": "8562", "tax": "1369.92", "other_taxes": null, "total": "9931.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA HO-1. REACCIONA/DETECTA A LA PROTEÍNA HO-1 DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOFLUORESCENCIA, INMUNOHISTOQUÍMICA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10158", "subtotal": "10158", "tax": "1625.28", "other_taxes": null, "total": "11783.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI IBA-1 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-IBA1 IGG, PRODUCIDO EN CONEJO, DIRIDO A DETECTAR IBA1 EN RATA Y RATÓN, SE UTILIZA EN WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA) E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL GENERADO EN EL CONEJO, DIRIGIDO A LA PROTEÍNA IBA1/AIF-1 DE HUMANO, RATA Y CONEJO. APLICACIÓN EN WB-WESTERN BLOTTING, INMUNOHISTOQUÍMICA, INMUNOFLUORESCENCIA Y CITOMETRÍA DE FLUJO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 568 RABBIT ANTI-GOAT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4871", "subtotal": "4871", "tax": "779.36", "other_taxes": null, "total": "5650.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A HRP, 0.15 MG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3835", "subtotal": "3835", "tax": "613.6", "other_taxes": null, "total": "4448.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), DE ADSORCIÓN CRUZADA, PRODUCIDO EN POLLO, ACOPLADO A ALEXA FLUOR 594", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6417", "subtotal": "6417", "tax": "1026.72", "other_taxes": null, "total": "7443.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL ANTI CONEJO ACOPLADO A FITC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4871", "subtotal": "4871", "tax": "779.36", "other_taxes": null, "total": "5650.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO PARA FLUORESCENCIA ANTI-CONEJO HECHO EN DONKEY LONGITUD DE ONDA 488", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2902", "subtotal": "2902", "tax": "464.32", "other_taxes": null, "total": "3366.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR PLUS 647, 1MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2695", "subtotal": "2695", "tax": "431.2", "other_taxes": null, "total": "3126.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 405, 1MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 488, 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-RABBIT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1969", "subtotal": "1969", "tax": "315.04", "other_taxes": null, "total": "2284.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A HRP LÍQUIDO EN PBS CON 0.75% BSA, 50% GLICEROL, PH7.3; VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE CONEJO CONJUGADO CON PEROXIDASA DE RABANO. APLICACIÒN EN WESTERN BLOT. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO HRP PARA WESTERN BLOT IGG H+L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL ANTI CONEJO ACOPLADO A CY3. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5804", "subtotal": "5804", "tax": "928.64", "other_taxes": null, "total": "6732.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN POLLO, ACOPLADO A ALEXA FLUOR 594, 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6417", "subtotal": "6417", "tax": "1026.72", "other_taxes": null, "total": "7443.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-IGG (H+L) DE CONEJO HECHO EN BURRO (ISOTIPO IGG1 ) ACOPLADO A PEROXIDASA DE RÁBANO PICANTE (HRP) PURIFICADO POR AFINIDAD,1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5286", "subtotal": "5286", "tax": "845.76", "other_taxes": null, "total": "6131.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO IGG ANTI-HUMANA (MOLÉCULA COMPLETA) MARCADA CON FOSFATASA ALCALINA, PRODUCIDA EN CABRA, 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5390", "subtotal": "5390", "tax": "862.4", "other_taxes": null, "total": "6252.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-HUMAN", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5390", "subtotal": "5390", "tax": "862.4", "other_taxes": null, "total": "6252.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-POLLO IGY H&L, ACOPLADO AL FLUROCROMO ALEXA FLUOR 488 PREADSORBIDA. PRODUCIO EN CABRA, DIRIDO A POLLO, ÚTIL PARA WESTERN BLOT, INMUNOHISTOQUÍMICA (PARAFINA), INMUNOFLUORESCENCIA. FRASCO 500 µG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3938", "subtotal": "3938", "tax": "630.08", "other_taxes": null, "total": "4568.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE POLLO CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.5 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3938", "subtotal": "3938", "tax": "630.08", "other_taxes": null, "total": "4568.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE POLLO CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3938", "subtotal": "3938", "tax": "630.08", "other_taxes": null, "total": "4568.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO IGG DE CABRA ANTI-RATA (H+L), FITC", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5390", "subtotal": "5390", "tax": "862.4", "other_taxes": null, "total": "6252.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 488 GOAT ANTI-RAT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2695", "subtotal": "2695", "tax": "431.2", "other_taxes": null, "total": "3126.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR™ PLUS 568 GOAT ANTI-RAT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3835", "subtotal": "3835", "tax": "613.6", "other_taxes": null, "total": "4448.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR 350, 1MG, DYLIGHT350", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3914", "subtotal": "3914", "tax": "626.24", "other_taxes": null, "total": "4540.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN DE CABALLO, PEROXIDASA DE RÁBANO, 1 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4560", "subtotal": "4560", "tax": "729.6", "other_taxes": null, "total": "5289.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG, ACOPLADO A CY3, PRODUCIDO EN CABRA, DIRIGIDO A RATÓN, ÚTIL PARA ESTUDIOS DE INMUNOFLUORESCENCIA. FRASCO 2 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4560", "subtotal": "4560", "tax": "729.6", "other_taxes": null, "total": "5289.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO HECHO EN CABRA ANTI RATÓN PARA WB, 500 UG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3005", "subtotal": "3005", "tax": "480.8", "other_taxes": null, "total": "3485.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE RATÓN CONJUGADO CON ALEXA FLUOR 488. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DE CABRA O BURRO ANTI IGG (H+L) DE RATÓN CONJUGADO CON ALEXA FLUOR 594. APLICACIÓN EN INMUNOFLUORESCENCIA. VIAL CON 0.75 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2902", "subtotal": "2902", "tax": "464.32", "other_taxes": null, "total": "3366.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN CONEJO, ACOPLADO A ALEXA FLUOR 568, 1MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5286", "subtotal": "5286", "tax": "845.76", "other_taxes": null, "total": "6131.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "IL-1 BETA ANTICUERPO POLICLONAL, IDENTIFICAN: RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI IL-6ANTICUERPO MONOCLONAL, ESPECIE REACTIVA: RATA, RATÓN PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7489", "subtotal": "7489", "tax": "1198.24", "other_taxes": null, "total": "8687.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO ANTI OXIDO NÍTRICO SINTASA INDUCIBLE (INOS) HECHO EN RATÓN MONOCLONAL, PARA USO EN RATÓN, RATA Y HUMANO PARA WESTERN BLOT E INMUNOFLUORESCENCIA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7489", "subtotal": "7489", "tax": "1198.24", "other_taxes": null, "total": "8687.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO, ANTI-MAGL DE ORIGEN HUMANO, RATÓN Y RATA CON APLICACIONES EN INMUNIHISTOQUIMICA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8292", "subtotal": "8292", "tax": "1326.72", "other_taxes": null, "total": "9618.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO ANTI PROTEÍNA ASOCIADA A MICROTUBULOS 2 NEURONALES (MAP2) HECHO EN RATÓN PARA USO EN RATÓN, RATA Y HUMANO PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7668", "subtotal": "7668", "tax": "1226.88", "other_taxes": null, "total": "8894.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO CONTRA PROTEÍNA BÁSICA DE MIELINA (MBP) HECHO EN CONEJO PARA USO EN RATÓN, RATA Y HUMANO PARA INMUNOFLUORESCENCIAS Y WESTERN BLOT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8740", "subtotal": "8740", "tax": "1398.4", "other_taxes": null, "total": "10138.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI PROTEINA BÁSICA DE MIELINA DE HUMANO, RATA Y RATÓN. MONOCLONAL PRODUCIDO EN CONEJO.USOS: INMUNOFLUORESCENCIA Y WESTERN BLOT. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11418", "subtotal": "11418", "tax": "1826.88", "other_taxes": null, "total": "13244.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-MEGF10, PRODUCIDO EN CONEJO, PARA RATA, RATÓN Y HUMANO DIRIGIDO A LA SECUENCIA DE AMINOÁCIDOS 26-160 DE LA PROTEÍNA HUMANA MEGF10, EN BUFFER PBS CON 0.09% DE AZIDA DE SODIO + GLICEROL 50%. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9202", "subtotal": "9202", "tax": "1472.32", "other_taxes": null, "total": "10674.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI NEUN MONOCLONAL ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC. VIAL DE 200 µG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO ANTI NUCLEO NEURONAL (NEUN) HECHO EN CONEJO PARA USO EN RATÓN, HUMANO Y RATA PARA INMUNOFLUORESCENCIAS Y WESTERN BOT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8499", "subtotal": "8499", "tax": "1359.84", "other_taxes": null, "total": "9858.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-NF¿B P65 (C-TERMINAL), PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN EN BUFFER DE FOSFATOS CON 0.09% DE AZIDA DE SODIO Y 0.2% DE GELATINA EN BUFFER DE FOSFATOS CON 0.09% DE AZIDA DE SODIO Y 0.2% DE GELATINA. VIAL CON 200 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8778", "subtotal": "8778", "tax": "1404.48", "other_taxes": null, "total": "10182.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-NMDAR2B (REGIÓN C-TERMINAL), PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN LIOFILIZADO, FROMULADO EN BUFFER 10MM HEPES (PH 7.5), 0.15M NACL, 0.1 MG/ML BSA Y 50% GLICEROL. LIOFILIZADO, FROMULADO EN BUFFER 10MM HEPES (PH 7.5), 0.15M NACL, 0.1 MG/ML BSA Y 50% GLICEROL. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7132", "subtotal": "7132", "tax": "1141.12", "other_taxes": null, "total": "8273.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-RECEPTOR NMDAR1 ANTICUERPO POLYCLONAL, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10261", "subtotal": "10261", "tax": "1641.76", "other_taxes": null, "total": "11902.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI NOS 1 NEURONAL, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10676", "subtotal": "10676", "tax": "1708.16", "other_taxes": null, "total": "12384.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI NOS 2 INDUCIBLE, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8096", "subtotal": "8096", "tax": "1295.36", "other_taxes": null, "total": "9391.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI NOS 3 ENDOTELIAL, ESPECIES REACTIVAS RATA, RATÓN PARA WB E IHC, 100UG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7550", "subtotal": "7550", "tax": "1208", "other_taxes": null, "total": "8758" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-RECEPTOR NMDAR2A (NR2A) ANTICUERPO POLICLONAL, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10572", "subtotal": "10572", "tax": "1691.52", "other_taxes": null, "total": "12263.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI ORNITINA DESCARBOXILASA PRODUCIDO EN CONEJO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7359", "subtotal": "7359", "tax": "1177.44", "other_taxes": null, "total": "8536.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL ANTI-PAX-6 HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATA, Y RATÓN, PARA USO EN WESTERN BLOT, INMUNOFLUORESCENCIA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9847", "subtotal": "9847", "tax": "1575.52", "other_taxes": null, "total": "11422.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HUMANO CD279 (PD-1) MARCADO CON PERCP. VIAL CON 500 UL (100 PRUEBAS)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11025", "subtotal": "11025", "tax": "1764", "other_taxes": null, "total": "12789" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-PGC1A, PRODUCIDO EN CONEJO, PARA HUMANO, RATA, RATÓN, CERDO, CABRA, HAMSTER, OVEJA, ARDILLA, PERRO, CABALLO Y PRIMATES NO-HUMANOS. 1 MG/ML, LIBRE DE BSA, PRODUCIDO PARA DETECTAR LA PORCIÓN INTERNA (RESIDUOS 400-500) DE LA PROTEÍNA HUMANA PGC1-ALFA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8298", "subtotal": "8298", "tax": "1327.68", "other_taxes": null, "total": "9625.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-PSD95 ANTICUERPO MONOCLONAL, ESPECIE REACTIVAS: RATA, RATÓN, PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-PSD95, PRODUCIDO EN CONEJO, PARA RATA, RATÓN Y HUMANO LÍQUIDO, EN AMORTIGUADOR 98.98% PBS, 1% BSA CON 0.02% DE AZIDA DE SODIO, PH: 7.4, 1 TUBO CON 0.9 - 1 MG/ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-SINAPTOFISINA (CLONA YE269) HECHO EN CONEJO DIRIGIDO CONTRA HUMANO, RATÓN, Y RATA PARA USO EN WESTERN BLOT, INMUNOHISTOQUÍMICA, E INMUNOFLUORESCENCIA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14304", "subtotal": "14304", "tax": "2288.64", "other_taxes": null, "total": "16592.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA SOD-MN (SOD2). REACCIONA/DETECTA A LA PROTEÍNA SOD-MN (SOD2) DE RATA, RATÓN Y HUMANO PARA USO EN INMUNOHISTOQUÍMICA, ELISA, WESTERN BLOT E INMUNOPRECIPITACIÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8987", "subtotal": "8987", "tax": "1437.92", "other_taxes": null, "total": "10424.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-SQSTM1/P62 POLICLONAL DE CONEJO REACTIVO PARA HUMANO Y RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7259", "subtotal": "7259", "tax": "1161.44", "other_taxes": null, "total": "8420.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-TNF-A ANTICUERPO MONOCLONAL, ESPECIES REACTIVAS: RATA, RATÓN, HUMANO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8395", "subtotal": "8395", "tax": "1343.2", "other_taxes": null, "total": "9738.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA DE CABRA ANTI-IGG DE RATÓN (H+L), 1.5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25901-1853", "description": "AGAROSA REACTIVO, PARA BIOLOGÍA MOLECULAR. FRASCO 100 G", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4876", "subtotal": "9752", "tax": "1560.32", "other_taxes": null, "total": "11312.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE CARGA PARA ADN CON COLORANTE AZUL DE BROMOFENOL 10X. CAJA CON TRES TUBOS DE 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1461", "subtotal": "1461", "tax": "233.76", "other_taxes": null, "total": "1694.76" }, { "number": "0", "cucop_code": "25101-0049", "description": "COLLAGENASA B (0.195 U/MG LYO), 500 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7116", "subtotal": "7116", "tax": "1138.56", "other_taxes": null, "total": "8254.56" }, { "number": "0", "cucop_code": "25101-0049", "description": "DISULFURO DE 3-CARBOXI-4-NITROFENILO. =98% GRADO REACTIVO, 1 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "970", "subtotal": "970", "tax": "155.2", "other_taxes": null, "total": "1125.2" }, { "number": "0", "cucop_code": "25901-1954", "description": "DNA POLIMERASA TIPO PWO. ENZIMA CON ALTA PROCESIVIDAD 5´- 3´. SIN ACTIVIDAD ENDONUCLEASA 5´-3´. ENZIMA COMPATIBLE CON NUCLEÓTIDOS MODIFICADOS. VIAL 100U.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1643", "subtotal": "1643", "tax": "262.88", "other_taxes": null, "total": "1905.88" }, { "number": "0", "cucop_code": "25101-0049", "description": "HISTIDINA =99% (TLC). 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "989", "subtotal": "989", "tax": "158.24", "other_taxes": null, "total": "1147.24" }, { "number": "0", "cucop_code": "25101-0049", "description": "L-HISTIDINA. FRASCO 25 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3605", "subtotal": "3605", "tax": "576.8", "other_taxes": null, "total": "4181.8" }, { "number": "0", "cucop_code": "25901-1434", "description": "HOECHST 33258, SOLUCIÓN ACUOSA 1 MG/ML, <98%. VIAL CON 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2025", "subtotal": "2025", "tax": "324", "other_taxes": null, "total": "2349" }, { "number": "0", "cucop_code": "25101-0037", "description": "COCTEL INHIBIDOR DE FOSFATASAS EN TABLETAS. FRASCO CON 20 PASTILLAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4499", "subtotal": "4499", "tax": "719.84", "other_taxes": null, "total": "5218.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "COCTEL DE INHIBIDORES DE PROTEASAS, SOLUCIÓN EN DMSO, PARA LA INHIBICIÓN DE SERIN PROTEASAS, CISTEIN PROTEASAS, PROTEASAS ACIDAS Y AMINOPEPTIDASAS, PARA SU USO EN CÉLULAS DE MAMÍFEROS Y EXTRACTOS DE TEJIDO. FRASCO CON 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3005", "subtotal": "3005", "tax": "480.8", "other_taxes": null, "total": "3485.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA). VIAL CON 20 µG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4033", "subtotal": "4033", "tax": "645.28", "other_taxes": null, "total": "4678.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTANDÀR DE PESO MOLECULAR DE DNA DE 1KB, 500 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4284", "subtotal": "4284", "tax": "685.44", "other_taxes": null, "total": "4969.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR DE DNA, DE 100 A 2000 PARES DE BASES, 100 APLICACIONES. VIAL DE 250 µG (1 µG/µL)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1989", "subtotal": "1989", "tax": "318.24", "other_taxes": null, "total": "2307.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA PCR MEZCLA MAESTRA, 200 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1935", "subtotal": "1935", "tax": "309.6", "other_taxes": null, "total": "2244.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA UNIVERSAL TAQMAN PARA PCR, 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14318", "subtotal": "14318", "tax": "2290.88", "other_taxes": null, "total": "16608.88" }, { "number": "0", "cucop_code": "25101-0039", "description": "NICOTINA 99% LÍQUIDA, 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11587", "subtotal": "11587", "tax": "1853.92", "other_taxes": null, "total": "13440.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "CEBADOR OLIGO 5'D PO4 [(T)12-18] 3', (0.5 µG/µL), 50 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1821", "subtotal": "1821", "tax": "291.36", "other_taxes": null, "total": "2112.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENCIA DE OLIGONUCLEÓTIDO (27-MERO) TOMM40F: 5´-GTTTTAGGGTAGAAGGATAGGTAAAGG-3´", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1779", "subtotal": "1779", "tax": "284.64", "other_taxes": null, "total": "2063.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENCIA DE OLIGONUCLEÓTIDO (25-MERO) TOMM40R: 5´-AACACTCTAAAAAAAACCAACACTT-3´* MARCADO CON BIOTINA.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5385", "subtotal": "5385", "tax": "861.6", "other_taxes": null, "total": "6246.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC PARA SECUENCIAR LA METILACIÓN DE CPG EN PROMOTOR DEL GEN HUMANO TOMM40 MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. SECUENIA DE OLIGONUCLEÓTIDO PARA SECUENCIAR (16-MERO) TOM-S1:5´- TTTGGTTAGGAGTAGT-3´", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1505", "subtotal": "1505", "tax": "240.8", "other_taxes": null, "total": "1745.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONCULEÓTIDO (20MERO) F-RS10542523:5´FAM-TGA CCT CAA GCTGTC CTC TT-3´", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2294", "subtotal": "2294", "tax": "367.04", "other_taxes": null, "total": "2661.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONCULEÓTIDO (18MERO) R-RS10542523:5´-TGG GCT GCC TTT TCAAGC-3, CT", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "169", "subtotal": "169", "tax": "27.04", "other_taxes": null, "total": "196.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERLAS MAGNÉTICAS PARA SELECCIÓN DE ADN POR TAMAÑOS (SPRI MAGNETIC SIZE SELECTION BEADS), 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4589", "subtotal": "4589", "tax": "734.24", "other_taxes": null, "total": "5323.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA PCR CUANTITATIVA EN TIEMPO (RT-QPCR SYB) DE UN SOLO PASO CON MMLV Y ADN POLIMERASA TAQ DE ARRANQUE. KIT PARA MUESTRAS DE 5 X 24", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5832", "subtotal": "5832", "tax": "933.12", "other_taxes": null, "total": "6765.12" }, { "number": "0", "cucop_code": "25101-0038", "description": "RNASA A, 100 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "999", "subtotal": "999", "tax": "159.84", "other_taxes": null, "total": "1158.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE PERMEABILIZACIÓN 10X PARA USO EXCLUSIVO DE CITOMETRÍA (SOLUCIÓN DE <15% FORMALDEHIDO AND <50% DIETILENGLICOL Y AGENTE PERMEABILIZANTE), 500 PRUEBAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2617", "subtotal": "2617", "tax": "418.72", "other_taxes": null, "total": "3035.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE RESGUARDO DE RNA, 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11258", "subtotal": "11258", "tax": "1801.28", "other_taxes": null, "total": "13059.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA TAQMAN PARA ABHD6 ESPECIE: RATA. VIAL CON 250 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5303", "subtotal": "5303", "tax": "848.48", "other_taxes": null, "total": "6151.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA TAQMMAN PARA DNMT1, ESPECIE: RATA. VIAL CON 250 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5303", "subtotal": "5303", "tax": "848.48", "other_taxes": null, "total": "6151.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA TAQMMAN PARA DNMT3B, ESPECIE: RATA. VIAL CON 250 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5303", "subtotal": "5303", "tax": "848.48", "other_taxes": null, "total": "6151.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA TAQMMAN PARA TET1, ESPECIE: RATA. VIAL CON 250 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5303", "subtotal": "5303", "tax": "848.48", "other_taxes": null, "total": "6151.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONDA TAQMMAN PARA TET2, ESPECIE: RATA. VIAL CON 250 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5303", "subtotal": "5303", "tax": "848.48", "other_taxes": null, "total": "6151.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TINCIÓN DE ÁCIDO NUCLEICO FLUORESCENTE VERDE SYTO 9. COMPUESTO FLUORESCENTE CON UN PICO DE EXCITACIÓN A 483 NM Y UN PICO DE EMISIÓN A 500 NM. VIAL 100UL.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7529", "subtotal": "7529", "tax": "1204.64", "other_taxes": null, "total": "8733.64" }, { "number": "0", "cucop_code": "25901-1954", "description": "ADN POLIMERASA TAQ, RECOMBINANTE (5 U/µ L), 500 UNIDADES", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2085", "subtotal": "4170", "tax": "667.2", "other_taxes": null, "total": "4837.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE CDNA DE REVERSA TRANSCRIPCIÓN DE ALTA CAPACIDAD, 50 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7081", "subtotal": "7081", "tax": "1132.96", "other_taxes": null, "total": "8213.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE TRANSCRIPTASA INVERSA M-MLV (200 U/µ L); TAMPÓN DE PRIMERA CADENA 5X, 1 ML; DTT, 500 µL (100 MM). CAJA/ 200 REACCIONES", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "8291", "subtotal": "16582", "tax": "2653.12", "other_taxes": null, "total": "19235.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT TRANSCRIPTOR COMPLETO PARA SÍNTESIS DE ADNC DE ALTA FIDELIDAD. 100 ENSAYOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23018", "subtotal": "23018", "tax": "3682.88", "other_taxes": null, "total": "26700.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZOL, 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3258", "subtotal": "3258", "tax": "521.28", "other_taxes": null, "total": "3779.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZINC EN POLVO <10 µM, =98%, 100 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1687", "subtotal": "1687", "tax": "269.92", "other_taxes": null, "total": "1956.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE BLASTICIDINA, 10 MG/ML (20 MM HEPES), FILTRADA POR 0.22 µM, 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19970", "subtotal": "19970", "tax": "3195.2", "other_taxes": null, "total": "23165.2" }, { "number": "0", "cucop_code": "25101-0049", "description": "B-27 MINUS INSULIN (50X). FRASCO CON 10 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6435", "subtotal": "6435", "tax": "1029.6", "other_taxes": null, "total": "7464.6" }, { "number": "0", "cucop_code": "25101-0049", "description": "SUPLEMENTO B-27 PLUS (50X) ESTÈRIL,LIBRE DE ENDOTOXINAS. FRASCO CON 10 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3477", "subtotal": "3477", "tax": "556.32", "other_taxes": null, "total": "4033.32" }, { "number": "0", "cucop_code": "25101-0049", "description": "SUPLEMENTO B-27 (50X), SIN SUERO. FRASCO CON 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "27535", "subtotal": "27535", "tax": "4405.6", "other_taxes": null, "total": "31940.6" }, { "number": "0", "cucop_code": "25101-0039", "description": "CITOSINA ß-D-ARABINOFURANOSIDE. FRASCO 100 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1686", "subtotal": "1686", "tax": "269.76", "other_taxes": null, "total": "1955.76" }, { "number": "0", "cucop_code": "25101-0039", "description": "COLÁGENA TIPO 1 DE COLA DE RATA. SOLUCIÓN 3 MG/ML. FRASCO 20 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2097", "subtotal": "2097", "tax": "335.52", "other_taxes": null, "total": "2432.52" }, { "number": "0", "cucop_code": "25101-0049", "description": "DIMETIL SULFOXIDO PARA CULTIVO CELULAR, 50 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1716", "subtotal": "3432", "tax": "549.12", "other_taxes": null, "total": "3981.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPLEMENTO DEL FACTOR DE CRECIMIENTO ENDOTELIAL 100X, LÍQUIDO, ESTÉRIL, LIBRE DE ENDOTOXINAS, 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2740", "subtotal": "2740", "tax": "438.4", "other_taxes": null, "total": "3178.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "FIBRONECTINA DE PLASMA HUMANO, LIQUIDA, SOLUCIÓN AL 0.1% ADECUADA PARA CULTIVO CELULAR. VIAL CON 5 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3473", "subtotal": "3473", "tax": "555.68", "other_taxes": null, "total": "4028.68" }, { "number": "0", "cucop_code": "25101-0039", "description": "HIGROMICINA B, POLVO, PUREZA MAYOR AL 98% PARA CULTIVO CELULAR, 100 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2989", "subtotal": "2989", "tax": "478.24", "other_taxes": null, "total": "3467.24" }, { "number": "0", "cucop_code": "25901-1906", "description": "SOLUCIÓN 200 MM DE DIPÉPTIDO DE L-ALANIL-L-GLUTAMINA EN 0.85 % DE NACL, CONGELADO (GLUTAMAX), 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "609", "subtotal": "609", "tax": "97.44", "other_taxes": null, "total": "706.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "MATRIGEL, MATRIZ DE MEMBRANA BASAL CALIFICADO PARA CRECIMIENTO DE CÉLULAS TRONCALES EMBRIONARIAS HUMANAS. FRASCO CON 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3358", "subtotal": "3358", "tax": "537.28", "other_taxes": null, "total": "3895.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO NEUROBASAL LÍQUIDO SIN SUERO, SIN L-GLUTAMINA Y CON ROJO FENOL PARA EL MANTENIMIENTO A LARGO PLAZO Y LA MADURACIÓN DE NEURONAS PRENATALES Y EMBRIONARIAS. FRASCO CON 500 ML", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2061", "subtotal": "6183", "tax": "989.28", "other_taxes": null, "total": "7172.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO DMEM ALTA GLUCOSA CON PIRUVATO DE SODIO, EN POLVO PARA 10L. CAJA CON 10 SOBRES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "696", "subtotal": "696", "tax": "111.36", "other_taxes": null, "total": "807.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM SIN GLUCOSA. MEDIO DMEM LÍQUIDO CON ROJO DE FENOL Y GLUTAMINA, SIN GLUCOSA, SIN HEPES, SIN PIRUVTO DE SODIO. FRASCO CON 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "673", "subtotal": "673", "tax": "107.68", "other_taxes": null, "total": "780.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM/ MEZCLA DE NUTRIENTES F-12, EN POLVO, CON L-GLUTAMINA, CON PIRIDOXINA CLORHIDRATO. 10 SOBRES X 1 L POLVO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2366", "subtotal": "2366", "tax": "378.56", "other_taxes": null, "total": "2744.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO F12, EN POLVO PARA 10L. FRASCO O CAJA CON 10 SOBRES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1828", "subtotal": "1828", "tax": "292.48", "other_taxes": null, "total": "2120.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO CELULAR RPMI 1640, POLVO ESTÉRIL EN SOBRES, ADICIONADO CON L-GLUTAMINA Y ROJO DE FENOL. SOBRE PARA 10L C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1031", "subtotal": "1031", "tax": "164.96", "other_taxes": null, "total": "1195.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE DIFERENCIACIÓN DE CÉLULAS MADRE NEURONALES HUMANAS. BOTELLA 250 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "7762", "subtotal": "31048", "tax": "4967.68", "other_taxes": null, "total": "36015.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO NEUROBASAL  ESTÉRIL, LIBRE DE ENDOTOXINAS, 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2097", "subtotal": "2097", "tax": "335.52", "other_taxes": null, "total": "2432.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE POLI-L-LISINA (0.1 % (W/V) EN AGUA) PARA TÉCNICA DE HISTOLOGÍA, 100 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4321", "subtotal": "8642", "tax": "1382.72", "other_taxes": null, "total": "10024.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO, FILTRADO ESTÉRIL, LIBRE DE MICOPLASMA, ENDOTOXINAS Y ANTIBIÓTICO, 500 ML", "unit": "UNIDAD", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "7500", "subtotal": "105000", "tax": "16800", "other_taxes": null, "total": "121800" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO DE CABRA. FRASCO 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1243", "subtotal": "1243", "tax": "198.88", "other_taxes": null, "total": "1441.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPLEMENTO N-2 (100X)SIN SUERO DEFINIDO QUÍMICAMENTE BASADO EN LA FORMULACIÓN BOTTENSTEIN N-1. FRASCO CON 50 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23735", "subtotal": "23735", "tax": "3797.6", "other_taxes": null, "total": "27532.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPSINA DE PÁNCREAS PORCINO. FRASCO CON 25 GR", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8515", "subtotal": "8515", "tax": "1362.4", "other_taxes": null, "total": "9877.4" }, { "number": "0", "cucop_code": "25101-0049", "description": "SODIO DODECIL SULFATO SDS, 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5969", "subtotal": "5969", "tax": "955.04", "other_taxes": null, "total": "6924.04" }, { "number": "0", "cucop_code": "25101-0049", "description": "SOLUCIÓN DAPI. VIAL 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2563", "subtotal": "2563", "tax": "410.08", "other_taxes": null, "total": "2973.08" }, { "number": "0", "cucop_code": "25101-0049", "description": "DAPI (4',6-DIAMIDINO-2-FENILINDOL, DIHIDROCLORURO). FRASCO 10 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2194", "subtotal": "2194", "tax": "351.04", "other_taxes": null, "total": "2545.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "PARAFINA EN POLVO. PUNTO DE SOLIDIFICACIÓN 56-58°C. AGENTE INCLUSIÓN PARA HISTOLOGÍA. BOLSA 1 KG", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "172", "subtotal": "344", "tax": "55.04", "other_taxes": null, "total": "399.04" }, { "number": "0", "cucop_code": "25101-0049", "description": "PARAFORMALDEHIDO EN POLVO. FRASCO DE 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1406", "subtotal": "1406", "tax": "224.96", "other_taxes": null, "total": "1630.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA ÁCIDO QUINOLÍNICO. REACTIVIDAD: HUMANO, RATA Y RATÓN, (TODAS LAS ESPECIES). SENSIBILIDAD: 0.58 NG/ML. RANGO: 1.23-100 NG/ML, 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14222", "subtotal": "14222", "tax": "2275.52", "other_taxes": null, "total": "16497.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ENSAYO DE ACTIVIDAD DE LA ACIL-COA SINTETASA, 100 ENSAYOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14200", "subtotal": "14200", "tax": "2272", "other_taxes": null, "total": "16472" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC ANNEXIN V APOPTOSIS DETECTION KIT WITH 7-AAD. KIT CON 300 PRUEBAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4581", "subtotal": "4581", "tax": "732.96", "other_taxes": null, "total": "5313.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ANTICUERPO SECUNDARIO BIOTINILADO, ACOPLADO AL COMPLEJO AVIDINA-ESTREPTAVIDINA. LA PROTEÍNA MARCADA QUE SE VISUALICE POR INCUBACIÓN EN PEROXIDASA Y REACCIONE CON ANTICUERPOS PRIMARIOS HECHO EN CONEJO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7566", "subtotal": "7566", "tax": "1210.56", "other_taxes": null, "total": "8776.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA BNDF. REACTIVIDAD: HUMANO, RATA Y RATÓN.SENSIBILIDAD: 1.35 PG/ML. RANGO: 15.6 - 10000 PG/ML, 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11033", "subtotal": "11033", "tax": "1765.28", "other_taxes": null, "total": "12798.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA CORTICOSTERONA PARA ROEDORES. DETECCIÓN COLORIMÉTRICA, CON UNA SENSIBILIDAD DE DETECCIÓN DE 32-20000 PG/ML LIMITE DE DETECCION 27 PG/ML, 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7625", "subtotal": "7625", "tax": "1220", "other_taxes": null, "total": "8845" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA PARA DETERMINACIÓN DE CORTICOSTERONA DE RATA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7625", "subtotal": "7625", "tax": "1220", "other_taxes": null, "total": "8845" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE LA PROTEÍNA C REACTIVA (PCR) DE RATA EN SUERO Y PLASMA. MÉTODO DE DETECCIÓN ESPECTROFOTOMÉTRICO/COLORIMÉTRICO. KIT PARA 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14126", "subtotal": "14126", "tax": "2260.16", "other_taxes": null, "total": "16386.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE CUANTIFICACIÓN DE PROTEÍNAS-BCA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7981", "subtotal": "7981", "tax": "1276.96", "other_taxes": null, "total": "9257.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE SDMA (DIMETIL ARGININA SIMÉTRICA) DE RATA EN SUERO Y PLASMA. KIT PARA 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16488", "subtotal": "16488", "tax": "2638.08", "other_taxes": null, "total": "19126.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA LA CUANTIFICACIÓN DE TROPONINA I DE RATA EN SUERO Y PLASMA. KIT PARA 96 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13415", "subtotal": "13415", "tax": "2146.4", "other_taxes": null, "total": "15561.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CROMÓGENO BETAZOIDE-DIAMINOBENCIDINA (DAB). CROMÓGENO PARA LA TINCIÓN DE TEJIDOS FIJADOS CON FORMALINA E INCLUIDOS EN PARAFINA, COMO PARTE DE LA TÉCNICA DE INMUNOHISTOQUÍMICA (IHC) QUE UTILIZA UN SISTEMA DE DETECCIÓN DE PEROXIDASA DE RÁBANO PICANTE (HRP). KIT CON CROMÓGENO (2 X 20 ML) Y BUFFER DE SUSTRATO (1 X 1 ML)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4548", "subtotal": "4548", "tax": "727.68", "other_taxes": null, "total": "5275.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT SISTEMA CROMÓGENO DE DETECCIÓN DE DIAMINOBENCIDINA (DAB) PARA INMUNOHISTOQUÍMICA CONSTA DE 2-COMPONENTES. 1) PAQUETE DE 2 BOTELLAS CON 5 ML CADA UNA DE CROMÓGENO DAB; 2) AMORTIGUADOR DAB ESTABLE (STABLE DAB BUFFER) 1 BOTELLA CON 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4548", "subtotal": "4548", "tax": "727.68", "other_taxes": null, "total": "5275.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA PARA DETERMINACIÓN DE IL-13", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13060", "subtotal": "13060", "tax": "2089.6", "other_taxes": null, "total": "15149.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA PARA DETERMINACIÓN DE IL-1 BETA RATA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12705", "subtotal": "12705", "tax": "2032.8", "other_taxes": null, "total": "14737.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT ELISA PARA DETERMINACIÓN DE IL-4 RATA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13682", "subtotal": "13682", "tax": "2189.12", "other_taxes": null, "total": "15871.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOUSE IL-6 ELISA KIT, KIT PARA 96 PRUEBAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13948", "subtotal": "13948", "tax": "2231.68", "other_taxes": null, "total": "16179.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA PARA DETERMINACIÓN DE IL-6 RATA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12971", "subtotal": "12971", "tax": "2075.36", "other_taxes": null, "total": "15046.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ENSAYO DE POTENCIAL DE MEMBRANA MITOCONDRIAL JC-1. KIT PARA 100 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7152", "subtotal": "7152", "tax": "1144.32", "other_taxes": null, "total": "8296.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIPOFECTAMINA. KIT CON UN VIAL DE 1 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12441", "subtotal": "12441", "tax": "1990.56", "other_taxes": null, "total": "14431.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DNA METILACIÓN DIRECTO POR QUÍMICA DE CONVERSIÓN DEL BISULFITO UTILIZANDO COLUMNAS, 100 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12333", "subtotal": "12333", "tax": "1973.28", "other_taxes": null, "total": "14306.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PCR PUNTO FINAL. 500 X 20 µL RXNS, 5 ML (5 X 1 ML)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7421", "subtotal": "7421", "tax": "1187.36", "other_taxes": null, "total": "8608.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA DE RT-PCR DE UN PASO CON ADN POLIMERASA. KIT CON 100 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19504", "subtotal": "19504", "tax": "3120.64", "other_taxes": null, "total": "22624.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DETECCION DE SENESENCIA POR TINCION HISTOQUIMICA BASADO EN B-GALACTOSIDASA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12438", "subtotal": "12438", "tax": "1990.08", "other_taxes": null, "total": "14428.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "50 X TAE BUFFER. FRASCO 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2402", "subtotal": "2402", "tax": "384.32", "other_taxes": null, "total": "2786.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA PARA DETERMINACIÓN DETNF-ALFA RATA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14570", "subtotal": "14570", "tax": "2331.2", "other_taxes": null, "total": "16901.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOUSE TNF ALPHA ELISA KIT, HIGH SENSITIVITY. KIT PARA 96 PRUEBAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11763", "subtotal": "11763", "tax": "1882.08", "other_taxes": null, "total": "13645.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "PAQUETE COMERCIAL PARA AISLAR DNA GENÓMICO Y RNA TOTAL A PARTIR DE PEQUEÑAS CANTIDADES DE PLASMA O SUERO DE HUMANOS,SALIVA, RASPADO BUCAL. CON ESTE KIT SE PROCESAN EFICAZMENTE CÉLULAS BUCALES Y UNA VARIEDAD DE LÍQUIDOS BIOLÓGICOS. INCLUYE COLUMNAS Y DIGESTIÓN CON PROTEINASA K. COMPATIBLE CON PAQUETE COMERCIAL DE TOMA DE MUESTRA DE SALIVA PARA DNA Y RNA. RENDIMIENTO DE = 5 µG DNA AND = 10 µG RNA. PAQUETE PARA 50 REACCIONES", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7224", "subtotal": "7224", "tax": "1155.84", "other_taxes": null, "total": "8379.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA PAR PCR DE PUNTO FINAL EN UNA CONCENTRACIÓN 2X. CONTIENE DNTPS, MGCL2 Y TAMPÓN DE REACCIÓN EN CONCENTRACIONES ÓPTIMAS PARA UNA AMPLIFICACIÓN EFICIENTE DE PLANTILLAS DE ADN MEDIANTE PCR, TAMBIÉN CONTIENE ADN POLIMERASA DE ALTA FIDELIDAD Y CON ALTA VELOCIDAD DE ELONGACIÓN: 1 SEG PARA <1 KB 5 SEG/KB PARA <10 KB 10 SEG/KB PARA ~10 KB. VIAL PARA 500 REACCIONES (1 ML)", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "7421", "subtotal": "14842", "tax": "2374.72", "other_taxes": null, "total": "17216.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS2075650 DEL GEN HUMANO TOMM40 MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: GAGATGAGAGTTGGTGTGGGGTTGG[A/G]GTGGAGTGTGACAGCGTTTCTCTTC", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10341", "subtotal": "10341", "tax": "1654.56", "other_taxes": null, "total": "11995.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA PARA PCR CUANTITATIVO EN TIEMPO REAL (QPCR), PARA USARSE CON SONDAS DE HIDRÓLISIS O SONDAS TAQMAN. COMPATIBLE CON TERMOCICLADORES DE TIEMPO REAL: QUANTSTUDIO Y STEPONE. ESTA MEZCLA MAESTRA PROPORCIONA RESULTADOS RÁPIDOS (<40 MINUTOS POR ADN POLIMERASA RECOMBINANTE MEJORADA) Y REPRODUCIBLES PARA TODAS LAS APLICACIONES DE QPCR BASADAS EN SONDAS. FRASCO DE 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12287", "subtotal": "12287", "tax": "1965.92", "other_taxes": null, "total": "14252.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA LIMPIAR REACCIONES DE PCR A PARTIR DE GEL DE AGAROSA O EN SOLUCIÓN POR COLUMNA. CONTIENE SOLUCIONES DE UNIÓN, LAVADO Y ELUCIÓN. PAQUETE DE 50 REACCIONES", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2348", "subtotal": "4696", "tax": "751.36", "other_taxes": null, "total": "5447.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA UNIVERSAL PARA SONDAS DE HIDRÓLISIS (2X), NO UNG AMPERASA, QUE OFREZCA RESULTADOS EN 40 MINUTOS PARA 40 CICLOS DE PCR EN TIEMPO REAL. DEBE CONTENER COLORANTE DE REFERENCIA PASIVA ROX Y SER COMPATIBLE CON EQUIPOS STEP ONE Y QUANTSTUDIO5. MEZCLA PARA LA IDENTIFICACIÓN DE GENOTIPOS DE ALTO RENDIMIENTO. 5ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12159", "subtotal": "24318", "tax": "3890.88", "other_taxes": null, "total": "28208.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETATO DE TALIO. FRASCO 25 GR", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5812", "subtotal": "5812", "tax": "929.92", "other_taxes": null, "total": "6741.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-AP5. FRASCO 10 MG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5285", "subtotal": "5285", "tax": "845.6", "other_taxes": null, "total": "6130.6" }, { "number": "0", "cucop_code": "25901-1920", "description": "NITROAZUL DE TETRAZOLIO EN CRISTALES. FRASCO DE 5 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "18064", "subtotal": "18064", "tax": "2890.24", "other_taxes": null, "total": "20954.24" }, { "number": "0", "cucop_code": "25101-0049", "description": "SR-95531 S106-50MG. VIAL CON 50", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13916", "subtotal": "13916", "tax": "2226.56", "other_taxes": null, "total": "16142.56" }, { "number": "0", "cucop_code": "25101-0001", "description": "CICLOHEXANO GRADO HPLC =99.9%, FRASCO 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6132", "subtotal": "6132", "tax": "981.12", "other_taxes": null, "total": "7113.12" }, { "number": "0", "cucop_code": "25901-0007", "description": "HEMATOXILINA, POLVO. FRASCO 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2283", "subtotal": "2283", "tax": "365.28", "other_taxes": null, "total": "2648.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "LÁPIZ HIDROFÓBICO PARA INMUNOTINCIÓN", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4477", "subtotal": "13431", "tax": "2148.96", "other_taxes": null, "total": "15579.96" }, { "number": "0", "cucop_code": "25101-0049", "description": "SOLUCIÓN AZUL DE TRIPANO 0.4 % EN PBS (0.4% TRYPAN BLUE SOLUTION), 100 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "445", "subtotal": "445", "tax": "71.2", "other_taxes": null, "total": "516.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS DE 10 A 180 KDA (MARCADOR DE PESO MOLECULAR) PARA SU USO EN GELES DE POLIACRILAMIDA. PAQUETE CON 2 TUBOS DE 250 MICROLITROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3101", "subtotal": "3101", "tax": "496.16", "other_taxes": null, "total": "3597.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "PIERCE ECL WESTERN BLOTTING SUBSTRATE", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5844", "subtotal": "5844", "tax": "935.04", "other_taxes": null, "total": "6779.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "REFERENCIA ESTANDAR DE PESO MOLECULAR PARA GELES DE ELECTROFORESIS. MEZCLA DE 10 PROTEÍNAS RECOMBINANTES (10–250 KD), 8 BANDAS TEÑIDAS DE AZUL Y 2 BANDAS DE REFERENCIA ROSADAS (25 Y 75 KD), 50 APLICACIONES", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "3728", "subtotal": "14912", "tax": "2385.92", "other_taxes": null, "total": "17297.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO ECL PARA WESTERN BLOTTING. FRASCO DE 250 ML DE SOLUCIÓN DE PERÓXIDO Y UN FRASCO DE 250 ML SOLUCIÓN LUMINOL ENHANCER", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5844", "subtotal": "17532", "tax": "2805.12", "other_taxes": null, "total": "20337.12" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA DE PLACAS INDIVIDUALES DE 96 POZOS DE POLIESTIRENO DE MITAD DE ÁREA CON TAPA, FONDO PLANO, PRECARGADAS, NO PIROGÉNICAS, ESTÉRILES PARA CULTIVO CELULAR. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2788", "subtotal": "5576", "tax": "892.16", "other_taxes": null, "total": "6468.16" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA DE PLACAS PARA CULTIVO CELULAR DE 24 POZOS DE POLIESTIRENO CON FONDO PLANO, NO PIROGÉNICAS, ESTÉRILES, EMPACADAS INDIVIDUALMENTE. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2854", "subtotal": "2854", "tax": "456.64", "other_taxes": null, "total": "3310.64" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE 6 POZOS TRATADAS CON FONDO PLANO, NO PIROGÈNICAS, ESTÈRILES. 100 CAJAS DE CULTIVO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2885", "subtotal": "2885", "tax": "461.6", "other_taxes": null, "total": "3346.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE 96 POZOS TRATADAS CON FONDO PLANO CON TAPA, DE POLIESTIRANO, NO PIROGÈNICAS, ESTÈRILES. 50 CAJAS DE CULTIVO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1543", "subtotal": "1543", "tax": "246.88", "other_taxes": null, "total": "1789.88" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAMARA PARA CULTIVO 4 POZOS DE POLIESTIRENO. PORTAOBJETOS ESTÉRIL 25 X 75 MM, CON 4 POZOS DE POLIESTIRENO PARA CULTIVO DE CÉLULAS. CAJA CON 16 PORTAOBJETOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4239", "subtotal": "4239", "tax": "678.24", "other_taxes": null, "total": "4917.24" }, { "number": "0", "cucop_code": "25501-0089", "description": "COLUMNA C18 PARA CROMATOGRAFÍA DE LÍQUIDOS DE ALTA RESOLUCIÓN : 20% DE CARGA DE CARBONO,TEMPERATURA DE OPERACIÓN IGUAL O MENOR A 70 GRADOS CELSIUS. LXDI: 25 CM X 4.6 MM. GRUPO ACTIVO MATRIZ: FASE C18 (OCTADECILO). TAMAÑO DE PARTÍCULA: 5 µ M. TAMAÑO DE PORO: 70 Å", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "29330", "subtotal": "29330", "tax": "4692.8", "other_taxes": null, "total": "34022.8" }, { "number": "0", "cucop_code": "25501-0089", "description": "COLUMNA PARA CROMATOGRAFÍA DE LÍQUIDOS C18 150 X 3.9 MM, TAMAÑO DE PARTÍCULA 5MICROMETROS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "25830", "subtotal": "25830", "tax": "4132.8", "other_taxes": null, "total": "29962.8" }, { "number": "0", "cucop_code": "25501-0089", "description": "CRISTALIZADOR DE 150 X 75 MM DE VIDRIO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "515", "subtotal": "515", "tax": "82.4", "other_taxes": null, "total": "597.4" }, { "number": "0", "cucop_code": "25501-0089", "description": "CRISTALIZADOR DE 190 X 100 MM DE VIDRIO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "847", "subtotal": "847", "tax": "135.52", "other_taxes": null, "total": "982.52" }, { "number": "0", "cucop_code": "25501-0089", "description": "CRISTALIZADOR DE 90 X 50 MM DE VIDRIO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "269", "subtotal": "269", "tax": "43.04", "other_taxes": null, "total": "312.04" }, { "number": "0", "cucop_code": "25501-0106", "description": "CUCHILLAS DESECHABLES DE PERFIL ALTO 80 X 8 MM. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1352", "subtotal": "1352", "tax": "216.32", "other_taxes": null, "total": "1568.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS DE NITROCELULOSA CON PORO DE 0.22 MICRAS Y 45 MM DE DIÁMETRO, AUTOCLAVEABLES. CAJA CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5920", "subtotal": "5920", "tax": "947.2", "other_taxes": null, "total": "6867.2" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE BOROSILICATO CON TAPON DE ROSCA AZUL 1000 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "171", "subtotal": "171", "tax": "27.36", "other_taxes": null, "total": "198.36" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE BOROSILICATO CON TAPON DE ROSCA AZUL 2000 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "438", "subtotal": "438", "tax": "70.08", "other_taxes": null, "total": "508.08" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO ÁMBAR DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 250ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "30", "subtotal": "60", "tax": "9.6", "other_taxes": null, "total": "69.6" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO ÁMBAR DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 500ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "48", "subtotal": "96", "tax": "15.36", "other_taxes": null, "total": "111.36" }, { "number": "0", "cucop_code": "25501-0138", "description": "FRASCO DE VIDRIO SÓDICO-CÁLCICO TRANSPARENTES DE CUELLO ROSCADO CON CUELLO INTEGRADO Y TAPARROSCA 1000ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "67", "subtotal": "134", "tax": "21.44", "other_taxes": null, "total": "155.44" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 0.1 ML O 100 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1240", "subtotal": "1240", "tax": "198.4", "other_taxes": null, "total": "1438.4" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 10 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "589", "subtotal": "589", "tax": "94.24", "other_taxes": null, "total": "683.24" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 50 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA AFILADA/BISELADA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1073", "subtotal": "1073", "tax": "171.68", "other_taxes": null, "total": "1244.68" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA DE VIDRIO PARA CROMATOGRAFÍA DE VOLUMEN DE 50 µL. AGUJA FIJA Y CEMENTADADE DE 51 MM DE ACERO INOXIDABLE CON PUNTA ROMO/ELECTROPULIDO (SIN BISEL)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1058", "subtotal": "1058", "tax": "169.28", "other_taxes": null, "total": "1227.28" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA TIPO HAMILTON DE 10 UL CON BISEL", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "589", "subtotal": "1178", "tax": "188.48", "other_taxes": null, "total": "1366.48" }, { "number": "0", "cucop_code": "25501-0089", "description": "JERINGA TIPO HAMILTON DE 10 UL SIN BISEL", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "589", "subtotal": "1178", "tax": "188.48", "other_taxes": null, "total": "1366.48" }, { "number": "0", "cucop_code": "25501-0268", "description": "MATRAZ ERLENMEYER DE VIDRIO CON BOCA ESMERILADA DE 1 LITRO.", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "454", "subtotal": "908", "tax": "145.28", "other_taxes": null, "total": "1053.28" }, { "number": "0", "cucop_code": "25501-0283", "description": "MATRAZ KITASATO DE VIDRIO REFORZADO 1000 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "643", "subtotal": "643", "tax": "102.88", "other_taxes": null, "total": "745.88" }, { "number": "0", "cucop_code": "25501-0283", "description": "MATRAZ KITASATO DE VIDRIO REFORZADO 2000 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1679", "subtotal": "1679", "tax": "268.64", "other_taxes": null, "total": "1947.64" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 1 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "352", "subtotal": "1408", "tax": "225.28", "other_taxes": null, "total": "1633.28" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 2 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "328", "subtotal": "656", "tax": "104.96", "other_taxes": null, "total": "760.96" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 5 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "210", "subtotal": "840", "tax": "134.4", "other_taxes": null, "total": "974.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICRO JERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACIÓN DE 1 MICROLITRO, PUNTA BISELADA.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "589", "subtotal": "589", "tax": "94.24", "other_taxes": null, "total": "683.24" }, { "number": "0", "cucop_code": "25501-0090", "description": "MULTIPLACA PARA CULTIVO CELULAR CON 6 POZOS, DE POLIESTIRENO TRATADA CON TC NO PIRÓGENO O CITOTÓXICO, FONDO PLANO, CON TAPA, ESTERIL, ENVOLTURA INDIVIDUAL. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1623", "subtotal": "1623", "tax": "259.68", "other_taxes": null, "total": "1882.68" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROPLACA DE POLIESTIRENO DE 96 POZOS CON FONDO EN U, ESTÉRIL, CON TAPA, CON IDENTIFICACIÓN ALFANUMÉRICA, EMPACADA INDIVIDUALMENTE. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1620", "subtotal": "4860", "tax": "777.6", "other_taxes": null, "total": "5637.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROTUBOS DE 5.0 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 200 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "561", "subtotal": "561", "tax": "89.76", "other_taxes": null, "total": "650.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROTUBOS DE 0.6 ML TRANSPARENTES. NO ESTÉRILES DE POLIPROPILENO, GRADUADOS CON TAPA A PRESIÓN Y FONDO CÓNICO. A PRUEBA DE EBULLICIÓN. LIBRES DE ARNASA NI ADNASA. PAQUETE CON 500 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "488", "subtotal": "488", "tax": "78.08", "other_taxes": null, "total": "566.08" }, { "number": "0", "cucop_code": "25501-0092", "description": "NAVAJA DESECHABLE DE ALTO PERFIL PARA MICROTOMO/CRIOSTATO. CAJA CON 50", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1352", "subtotal": "1352", "tax": "216.32", "other_taxes": null, "total": "1568.32" }, { "number": "0", "cucop_code": "25501-0092", "description": "CUCHILLAS PARA CRIOSTATO/MICROTOMO DE PERFIL ALTO DE 80 MM DE LARGO X 14 MM DE ALTO X 0,35 MM DE GROSOR. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1352", "subtotal": "1352", "tax": "216.32", "other_taxes": null, "total": "1568.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETAS SEROLÓGICAS ESTÉRILES DESECHABLES DE 2 ML. DESECHABLES DE POLIESTIRENO ENVUELTAS INDIVIDUALMENTE. CAJA CON 200 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "928", "subtotal": "928", "tax": "148.48", "other_taxes": null, "total": "1076.48" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETA SEROLOGICA DE POLIPROPILENO DESECHABLE DE 5 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 200 PIEZAS", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "931", "subtotal": "2793", "tax": "446.88", "other_taxes": null, "total": "3239.88" }, { "number": "0", "cucop_code": "25501-0089", "description": "PORTAOBJETOS DE 25MM X 75 MM. CAJA CON 50 LAMINILLAS", "unit": "UNIDAD", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "29", "subtotal": "406", "tax": "64.96", "other_taxes": null, "total": "470.96" }, { "number": "0", "cucop_code": "25501-0090", "description": "PORTAOBJETOS DE CULTIVO CELULAR CON CA´MARA DE POLIESTIRENO, DESECHABLES, ÁREA DE CULTIVO 1,7 CM2, ESTÉRILES, 4 POCILLOS. PAQUETE DE 24 PZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4239", "subtotal": "4239", "tax": "678.24", "other_taxes": null, "total": "4917.24" }, { "number": "0", "cucop_code": "25501-0089", "description": "PORTAOBJETOS ELECTROCARGADOS DE POLILISINA 25 X 75 CM, CAJA C/50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1296", "subtotal": "1296", "tax": "207.36", "other_taxes": null, "total": "1503.36" }, { "number": "0", "cucop_code": "25501-0416", "description": "PUNTAS PARA PIPETA REPETIDORA DE 2.5 M ESTÉRILES. ESTÉRILES ENVUELTAS INDIVIDUALMENTE. CUERPO DE POLIPROPILENO, ÉMBOLO DE POLIETILENO. COMPATIBLES CON PIPETA REPETIDORA EPPENDORF Y LABNET. CAPACIDAD 2.5 ML. 200 PIEZAS POR CAJA", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5769", "subtotal": "5769", "tax": "923.04", "other_taxes": null, "total": "6692.04" }, { "number": "0", "cucop_code": "25501-0090", "description": "SELLADORES DE PLACAS DE ELISA (PLATE SEALER) NO ESTÉRILES. CAJA CON 100 UNIDADES.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2370", "subtotal": "2370", "tax": "379.2", "other_taxes": null, "total": "2749.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "TIRAS DE 8 TUBOS DE 0.2 ML PARA PCR CON TAPONES INDIVIDUALES ADJUNTOS. CAJA CON 120 TIRAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "948", "subtotal": "948", "tax": "151.68", "other_taxes": null, "total": "1099.68" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO CÓNICO PARA CENTRÍFUGA DE 15ML DE POLIPROPILENO RADUADO QUE AGUANTE ALTAS VELOCIDADES DE CENTRIFUGACIÓN Y SOLVENTES. ESTÉRIL PAQUUTE C/50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "258", "subtotal": "1548", "tax": "247.68", "other_taxes": null, "total": "1795.68" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO CÓNICO DE POLIPROPILENO CON TAPA DE ROSCA PARA USO EN CENTRIFUGA, CON CAPACIDAD DE 50 ML, CON GRADUACIONES IMPRESAS. NO ESTÉRIL. BOLSA CON 25 TUBOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "154", "subtotal": "154", "tax": "24.64", "other_taxes": null, "total": "178.64" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE POLIPROPILENO DE 0.6 ML. BOLSA/500", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "488", "subtotal": "1952", "tax": "312.32", "other_taxes": null, "total": "2264.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE POLIPROPILENO DE PAREDES FINAS PARA PCR P/PIPETAS DE 0.5 ML. ESTÉRIL, LIBRES DE DNASA Y RNASA. BOLSA CON 500 UNIDADES", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1118", "subtotal": "2236", "tax": "357.76", "other_taxes": null, "total": "2593.76" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 20 ML", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "56", "subtotal": "168", "tax": "26.88", "other_taxes": null, "total": "194.88" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO 2L (2000ML)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "295", "subtotal": "295", "tax": "47.2", "other_taxes": null, "total": "342.2" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO DE 100 ML", "unit": "UNIDAD", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "51", "subtotal": "153", "tax": "24.48", "other_taxes": null, "total": "177.48" }, { "number": "0", "cucop_code": "25501-0090", "description": "VASO DE PRECIPITADO DE VIDRIO TRANSPARENTE DE BAJA EXPANSIÓN TÉRMICA 50 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "47", "subtotal": "188", "tax": "30.08", "other_taxes": null, "total": "218.08" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS DE PRECIPITADO DE VIDRIO 2 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "295", "subtotal": "295", "tax": "47.2", "other_taxes": null, "total": "342.2" } ] }, { "id": "C-2026-00076386", "internal_reference": "INNN-DG-DA-SRM-LP-087-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "EQUIVER SA DE CV", "normalized_name": "EQUIVER", "rfc_type": null, "slug": "equiver" }, "contract_period": { "published_at": "2026-08-06T21:21:44.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "69600", "tax": "11136", "total": "80736", "maximum_subtotal": "111876", "maximum_total": "129776.16", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-1868", "description": "TEMED, 5 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "336", "subtotal": "336", "tax": "53.76", "other_taxes": null, "total": "389.76" }, { "number": "0", "cucop_code": "25101-0049", "description": "DUECIL SULFATO DE SODIO (SDS) GRADO ELECTROFORESIS. FRASCO 1 KG", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5832", "subtotal": "5832", "tax": "933.12", "other_taxes": null, "total": "6765.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALMOHADILLAS DE ESPUMA NEGRAS PARA CAMARA DE WESTERN BLOT 8 X11 CM. CAJA CON 4", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "972", "subtotal": "972", "tax": "155.52", "other_taxes": null, "total": "1127.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR DE PROTEÍNAS PRETEÑIDO DE 2 A 250 KDA. VIAL 500 UL", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3096", "subtotal": "6192", "tax": "990.72", "other_taxes": null, "total": "7182.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PRE-TEÑIDO CON MEZCLA DE DIEZ PROTEÍNAS RECOMBINANTES MULTICOLORES PARA PROTEÍNAS DE 10 A 250 KDA, PARA 250 USOS, COMPATIBLE PARA WESTERN BLOT Y FLUORESCENCIA. VIAL 500 UL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEMBRANA NITROCELULOSA PARA TRANSFERIR ÁCIDO NUCLEICO Y PROTEÍNAS. TAMAÑO DE PORO DE 0,2 µM, ROLLO DE 30 CM X 3,5 M.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8406", "subtotal": "8406", "tax": "1344.96", "other_taxes": null, "total": "9750.96" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO DELGADO PARA WESTERN BLOT 7.5 X 10 CM. CAJA DE 60 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1584", "subtotal": "1584", "tax": "253.44", "other_taxes": null, "total": "1837.44" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO EXTRA GRUESO PARA TRANSFERENCIA CON TURBO TRANSFER, TAMAÑO 7.5 X 10 CM. CAJA DE 60 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1584", "subtotal": "1584", "tax": "253.44", "other_taxes": null, "total": "1837.44" }, { "number": "0", "cucop_code": "25501-0037", "description": "CÁMARAS DE ELECTROFORESIS VERTICAL PARA PROTEÍNAS CON TANQUE, TAPA CON CABLES Y ENSAMBLE DE ELECTRODOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13266", "subtotal": "13266", "tax": "2122.56", "other_taxes": null, "total": "15388.56" }, { "number": "0", "cucop_code": "25501-0037", "description": "CÁMARAS DE TRANSFERENCIA VERTICAL PARA PROTEÍNAS CON TANQUE, TAPA CON CABLES Y ENSAMBLE DE ELECTRODOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13266", "subtotal": "13266", "tax": "2122.56", "other_taxes": null, "total": "15388.56" }, { "number": "0", "cucop_code": "25501-0090", "description": "PEINES DE 15 POZOS PARA VIDRIOS DE 1.0 MM DE GROSOR, VOLUMEN 26 µL POR POZO, PARA GELES DE ACRILAMIDA, COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM, PAQUETE DE 5 PIEZAS C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "792", "subtotal": "792", "tax": "126.72", "other_taxes": null, "total": "918.72" }, { "number": "0", "cucop_code": "25501-0090", "description": "PEINES DE 15 POZOS PARA VIDRIOS DE 1.5 MM DE GROSOR, VOLUMEN 20 µL POR POZO, PARA GELES DE ACRILAMIDA, COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM, PAQUETE DE 5 PIEZAS C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "792", "subtotal": "792", "tax": "126.72", "other_taxes": null, "total": "918.72" }, { "number": "0", "cucop_code": "25501-0089", "description": "PLACA DE VIDRIO DELGADA PARA PREPARARACIÓN DE GELES VERTICALES DE ACRILAMIDA DE 10 CM X 7.3 CM. CAJA CON 5 VIDRIOS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "558", "subtotal": "558", "tax": "89.28", "other_taxes": null, "total": "647.28" }, { "number": "0", "cucop_code": "25501-0092", "description": "REPUESTO DE ELECTRODO PARA ENSAMBLADO A LA FUENTE DE PODER COMPATIBLE CON CÁMARA DE ELECTROFORESIS VERTICAL MINI-PROTEAN TETRA CELL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4050", "subtotal": "4050", "tax": "648", "other_taxes": null, "total": "4698" }, { "number": "0", "cucop_code": "25501-0089", "description": "REPUESTO DE VIDRIOS DELGADOS PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA CELL CASTING STAND. PAQUETE DE 5 PIEZAS C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "558", "subtotal": "558", "tax": "89.28", "other_taxes": null, "total": "647.28" }, { "number": "0", "cucop_code": "25501-0089", "description": "REPUESTO DE VIDRIOS GRUESOS DE 1 MM DE SEPARACIÓN PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM. PAQUETE DE 5 PIEZAS C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1188", "subtotal": "1188", "tax": "190.08", "other_taxes": null, "total": "1378.08" }, { "number": "0", "cucop_code": "25501-0089", "description": "REPUESTO DE VIDRIOS GRUESOS DE 1.5 MM DE SEPARACIÓN PARA GELES DE ELECTROFORESIS COMPATIBLES CON EL MÓDULO MINIPROTEAN TETRA SYSTEM. PAQUETE DE 5 PIEZAS C/U", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1206", "subtotal": "1206", "tax": "192.96", "other_taxes": null, "total": "1398.96" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS PARA CÁMARA DE ELECTROFORESIS 10X 8CM. CAJA CON 5", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "558", "subtotal": "558", "tax": "89.28", "other_taxes": null, "total": "647.28" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS DE TAMAÑO 10 X 8.3 CM APROXIMADAMENTE PARA GEL DE ELECROFORESIS DE ACRILAMIDA, CON ESPACIADOR DE 1.5MM INTEGRADO PARA CÁMARA MINI-PROTEAN. CAJA 5 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1206", "subtotal": "1206", "tax": "192.96", "other_taxes": null, "total": "1398.96" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS ESPACIADORES DE 0.75 MM PARA WESTERN BLOT. CAJA 5 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1422", "subtotal": "1422", "tax": "227.52", "other_taxes": null, "total": "1649.52" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS ESPACIADORES DE 1.5 MM PARA WESTERN BLOT. CAJA 5 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1206", "subtotal": "1206", "tax": "192.96", "other_taxes": null, "total": "1398.96" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS ESPACIADORES DE 1.5 MM PARA WESTERN BLOT. CAJA 5 PZS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1206", "subtotal": "1206", "tax": "192.96", "other_taxes": null, "total": "1398.96" } ] }, { "id": "C-2026-00076396", "internal_reference": "INNN-DG-DA-SRM-LP-088-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "R.G. REPRESENTACIONES PARA LABORATORIOS SA DE CV", "normalized_name": "RG REPRESENTACIONES PARA LABORATORIOS", "rfc_type": null, "slug": "rg-representaciones-para-laboratorios" }, "contract_period": { "published_at": "2026-08-06T21:21:22.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "110916.65", "tax": "17746.66", "total": "128663.31", "maximum_subtotal": "293401.88", "maximum_total": "340346.18", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0809", "description": "DNTP MEZCLA. CAJA C/10 MM C/UNO", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3144.6", "subtotal": "6289.2", "tax": "1006.27", "other_taxes": null, "total": "7295.47" }, { "number": "0", "cucop_code": "25101-0037", "description": "COCTEIL INHIBIDOR DE PROTEASAS 100X, 5 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9583.2", "subtotal": "19166.4", "tax": "3066.62", "other_taxes": null, "total": "22233.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-KINURENINA (PUREZA MAYOR A 98% GRADO HPLC), 1 G", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12434.4", "subtotal": "24868.8", "tax": "3979.01", "other_taxes": null, "total": "28847.81" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE ADN DE 100 PARES DE BASES CON 1 ML TAMPÓN DE CARGA 10X, 500 µL", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2876.4", "subtotal": "11505.6", "tax": "1840.9", "other_taxes": null, "total": "13346.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN ESTABILIZADORA Y DE ALMACENAMIENTO DE RNA Y PARA COLECCIÓN DE TEJIDOS. REACTIVO PARA ALMACENAMIENTO ACUOSO DE TEJIDOS, PARA ESTABILIZAR Y PROTEGER RNA DE ESPECÍMENES FRESCOS, EVITANDO DEGRADACIÓN DEL RNA. FRASCO 250ML (RNA/LATER)", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2523.6", "subtotal": "10094.4", "tax": "1615.1", "other_taxes": null, "total": "11709.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM/F-12 LÍQUIDO CON GLUTAMAX, CON ROJO FENOL, SIN HEPES, ESTÉRIL. FRASCO CON 500 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1145.7", "subtotal": "2291.4", "tax": "366.62", "other_taxes": null, "total": "2658.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO F-12K, 500 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "894.6", "subtotal": "1789.2", "tax": "286.27", "other_taxes": null, "total": "2075.47" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPSINA-EDTA (0,25%) CON ROJO DE FENOL, LÍQUIDO, ESTÉRIL PARA CULTIVO CELULAR, 100 ML", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "390.6", "subtotal": "781.2", "tax": "124.99", "other_taxes": null, "total": "906.19" }, { "number": "0", "cucop_code": "25101-0049", "description": "ACETONITRILO GRADO HPLC, 1 GALÓN", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "996.69", "subtotal": "996.69", "tax": "159.47", "other_taxes": null, "total": "1156.16" }, { "number": "0", "cucop_code": "25901-1746", "description": "ALCOHOL AL 96% REACTIVO ANALÍTICO. PORRÓN DE 20 L", "unit": "UNIDAD", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "2240", "subtotal": "13440", "tax": "2150.41", "other_taxes": null, "total": "15590.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL RA ACS, 99.8% O ALCOHOL METÍLICO ACS, 4 L", "unit": "UNIDAD", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "398", "subtotal": "1990", "tax": "318.4", "other_taxes": null, "total": "2308.4" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 10 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "278.6", "subtotal": "1114.4", "tax": "178.3", "other_taxes": null, "total": "1292.7" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETA SEROLOGICA DE POLIPROPILENO DESECHABLE DE 10 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 200 PIEZAS", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1040", "subtotal": "4160", "tax": "665.6", "other_taxes": null, "total": "4825.6" }, { "number": "0", "cucop_code": "25501-0426", "description": "PUNTAS BLANCAS DE POLIPROPILENO PARA MICROPIPETA CON CAPACIDAD DE 0.5 A 10 MICROLITROS, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS, NO ESTÉRIL. BOLSA CON 1000 PUNTAS", "unit": "UNIDAD", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "220", "subtotal": "3080", "tax": "492.8", "other_taxes": null, "total": "3572.8" }, { "number": "0", "cucop_code": "25501-0420", "description": "PUNTAS AMARILLAS DE POLIPROPILENO PARA MICROPIPETA CON CAPACIDAD DE 1 HASTA 200 MICROLITROS, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS, NO ESTÉRILES. BOLSA CON 1000 PUNTAS", "unit": "UNIDAD", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "135", "subtotal": "2160", "tax": "345.6", "other_taxes": null, "total": "2505.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO CÓNICO DE PLÁSTICO DE 15 ML CON TAPA, PARA CENTRIFUGA, ESTÉRIL, LIBRE DE PIRÓGENOS. CAJA CON 500 TUBOS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1300", "subtotal": "2600", "tax": "416", "other_taxes": null, "total": "3016" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO CÓNICO PARA CENTRÍFUGA DE 50MLDE POLIPROPILENO GRADUADO QUE AGUANTE ALTAS VELOCIDADES DE CENTRIFUGACIÓN Y SOLVENTES, ESTÉRIL. PAQUETE C/500 PIEZAS.", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2200", "subtotal": "4400", "tax": "704", "other_taxes": null, "total": "5104" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPAITADO DE VIDRIO TEMPLADO DE 10 ML", "unit": "UNIDAD", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "47.34", "subtotal": "189.36", "tax": "30.3", "other_taxes": null, "total": "219.66" } ] }, { "id": "C-2026-00076401", "internal_reference": "INNN-DG-DA-SRM-LP-089-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "TECROM SA DE CV", "normalized_name": "TECROM", "rfc_type": null, "slug": "tecrom" }, "contract_period": { "published_at": "2026-08-06T21:21:03.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "14320", "tax": "2291.2", "total": "16611.2", "maximum_subtotal": "31967", "maximum_total": "37081.72", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "CALDO LB CON AGAR LENNOX, MEDIO NUTRICIONALMENTE RICO PARA EL CRECIMIENTO Y MANTENIMIENTO DE CULTIVOS PUROS DE CEPAS RECOMBINANTES DE E.COLI, 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1574", "subtotal": "1574", "tax": "251.84", "other_taxes": null, "total": "1825.84" }, { "number": "0", "cucop_code": "25101-0049", "description": "DIMETILSULFÓXIDO (DMSO) PARA CULTIVO CELULAR, PUREZA MAYOR AL 99.7%, 250 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "999", "subtotal": "999", "tax": "159.84", "other_taxes": null, "total": "1158.84" }, { "number": "0", "cucop_code": "25901-1897", "description": "ETILENGLICOL. FRASCO DE 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "369", "subtotal": "369", "tax": "59.04", "other_taxes": null, "total": "428.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICEROL. FRASCO DE 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "581", "subtotal": "581", "tax": "92.96", "other_taxes": null, "total": "673.96" }, { "number": "0", "cucop_code": "25101-0049", "description": "SULFATO DE COBRE PENTAHIDRATADO GRADO REACTVO, 500 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "915", "subtotal": "915", "tax": "146.4", "other_taxes": null, "total": "1061.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "FERROCIANURO DE POTASIO, 50 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "590", "subtotal": "590", "tax": "94.4", "other_taxes": null, "total": "684.4" }, { "number": "0", "cucop_code": "25101-0049", "description": "DIMETIL SULFÓXIDO SOLVENTE, 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1900", "subtotal": "1900", "tax": "304", "other_taxes": null, "total": "2204" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRIOTUBOS DE 2 ML DE POLIPROPILENO (ROSCADO)CON TAPA, FONDO REDONDO, ESTÉRIL, SIN PIRÓGENOS. PARA TEMPERATURAS DE -190 ° C. CON ARANDELA DE SILICONA. BOLSA CON 1000 PIEZAS.", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1725", "subtotal": "1725", "tax": "276", "other_taxes": null, "total": "2001" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS DE JERINGA PARA LABORATORIO (MEMBRANA DE PVDF 0.22 UM Y 4 MM DE DIÁMETRO). ESTÉRILES, PAQUETE CON 100 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4298", "subtotal": "4298", "tax": "687.68", "other_taxes": null, "total": "4985.68" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROJERINGA DE VIDRIO 10 µL X 51 MM, CALIBRE DE AGUJA DE 26 S PARA MICROINYECCIÓN DE LÍQUIDOS EN ESTEREOTÁXICO", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1369", "subtotal": "1369", "tax": "219.04", "other_taxes": null, "total": "1588.04" } ] }, { "id": "C-2026-00076412", "internal_reference": "INNN-DG-DA-SRM-LP-090-2026", "title": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO DIRECCIÓN DE INVESTIGACIÓN", "status": "PUBLICADO", "contractor": { "name": "VITASOF SA DE CV", "normalized_name": "VITASOF", "rfc_type": null, "slug": "vitasof" }, "contract_period": { "published_at": "2026-08-06T21:20:41.000Z", "starts_at": "2026-06-26T06:00:00.000Z", "ends_at": "2026-12-31T06:00:00.000Z" }, "value": { "subtotal": "90177", "tax": "14428.32", "total": "104605.32", "maximum_subtotal": "131932", "maximum_total": "153041.12", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI BCL-2 DE CONEJO O RATÒN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2182", "subtotal": "2182", "tax": "349.12", "other_taxes": null, "total": "2531.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-GFAP EN RATÓN MONOCLONAL, REACTIVIDAD A HUMANO, RATA Y RATÓN PARA WB E IHC. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2115", "subtotal": "2115", "tax": "338.4", "other_taxes": null, "total": "2453.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-P21 (CONTRA LA REGIÓN CARBOXILO TERMINAL) DE CONEJO REACTIVO PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5430", "subtotal": "5430", "tax": "868.8", "other_taxes": null, "total": "6298.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-P53 (CLONA DO-1) DE RATÓN, MONOCLONAL, REACTIVIDAD A HUMANO Y A RATA. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2730", "subtotal": "2730", "tax": "436.8", "other_taxes": null, "total": "3166.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-SINAPTOFISINA, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4050", "subtotal": "4050", "tax": "648", "other_taxes": null, "total": "4698" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI TRIPTASA MURINO. VIAL CON 100 µL", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3440", "subtotal": "3440", "tax": "550.4", "other_taxes": null, "total": "3990.4" }, { "number": "0", "cucop_code": "25101-0049", "description": "MEDIO DE MONTAJE PARA MICROSCOPÍA, LIBRE DE AGUA. CONSISTE EN POLÍMEROS DE ACRILATO MEZCLADOS DISUELTOS EN XILENOS. FRASCO CON 500 ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1850", "subtotal": "1850", "tax": "296", "other_taxes": null, "total": "2146" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE BLOQUEO PARA INMUNOFLUORESCENCIAS RATON SOBRE RATÓN (M.O.M.). VIAL 1ML", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5772", "subtotal": "5772", "tax": "923.52", "other_taxes": null, "total": "6695.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE DE INCLUSIÓN DE TEJIDOS PARA CORTE POR CONGELACIÓN. FRASCO DE 118 ML", "unit": "UNIDAD", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "345", "subtotal": "2760", "tax": "441.6", "other_taxes": null, "total": "3201.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIRECT-ZOL RNA MINIPREP PLUS KI, PRODUCT SUPPLIED W/ 200 ML TRI REAGENTT. KIT PARA 200 PREPS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11640", "subtotal": "11640", "tax": "1862.4", "other_taxes": null, "total": "13502.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA DE DETECCIÓN BASADO EN LA INTERACCIÓN DE ESTREPTAVIDINA-BIOTINA ALTAMENTE ESPECÍFICA Y SENSIBLE PARA DETECTAR UN ANTICUERPO PRIMARIO UNIDO (IHC LINK-LABEL SUPER SENSITIVE). KIT PARA 1000 PRUEBAS CON SOLUCIÓN MARCADORA (110 ML) Y MEZCLA DE IGG ANTI-RATÓN Y ANTI-CONEJO CONJUGADAS CON BIOTINA (110 ML)", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36000", "subtotal": "36000", "tax": "5760", "other_taxes": null, "total": "41760" }, { "number": "0", "cucop_code": "25101-0004", "description": "XILENO GRADO REACTIVO ANALÍTICO. FRASCO 4 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "985", "subtotal": "985", "tax": "157.6", "other_taxes": null, "total": "1142.6" }, { "number": "0", "cucop_code": "25901-0007", "description": "COLORANTE HEMATOXILINA DE HARRIS IISTA PARA USAR. FRASCO 1 L", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "650", "subtotal": "650", "tax": "104", "other_taxes": null, "total": "754" }, { "number": "0", "cucop_code": "25101-0049", "description": "EOSINA AMARILLENTA (EOSINA Y). POLVO. FRASCO CON 25 G", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "850", "subtotal": "850", "tax": "136", "other_taxes": null, "total": "986" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE BLOQUEO CON TWEEN 20 PARA MEMBRANAS DE WESTERN BLOT. FRASCO DE 1 L", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2800", "subtotal": "5600", "tax": "896", "other_taxes": null, "total": "6496" }, { "number": "0", "cucop_code": "25501-0090", "description": "CASSETE PARA INCLUSIÓN DE TEJIDOS EN PARAFINA. CAJA CON 500 PIEZAS", "unit": "UNIDAD", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "923", "subtotal": "923", "tax": "147.68", "other_taxes": null, "total": "1070.68" }, { "number": "0", "cucop_code": "25501-0106", "description": "CUCHILLAS DE ALTO PERFIL DESECHABLE DE ACERO INOXIDABLE PARA ELABORAR CORTES FINOS DE ALTA CALIDAD PARA HISTOTECNOLOGÍA, 80MM DE LARGO X 14MM DE ALTO X 0.35MM DE ESPESOR. CAJA CON 50 UNIDADES, PARA MICROTOMO DE PARAFINA. CAJA CON 50 PIEZAS", "unit": "UNIDAD", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1600", "subtotal": "3200", "tax": "512", "other_taxes": null, "total": "3712" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "CONVOCATORIA", "filename": "Convoca I12.pdf", "availability": "available", "size_bytes": "5167115", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-15T20:14:37.356Z", "updated_at": "2026-05-15T20:14:49.239Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE SUSPENSIÓN DE JUNTA DE ACLARACIONES", "filename": "Diferimiento.pdf", "availability": "available", "size_bytes": "539828", "mime_type": "application/pdf", "sha256": "e70c038c421c7542a1cb1897be414f1e9059d1907f8fbdf9593b7a71a0a8436c", "uploaded_at": "2026-05-26T22:01:00.679Z", "updated_at": "2026-08-06T02:56:07.118Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE SUSPENSIÓN DE JUNTA DE ACLARACIONES", "filename": "2 Diferimiento.pdf", "availability": "available", "size_bytes": "291717", "mime_type": "application/pdf", "sha256": "1f2754a333728c270135d438fc8a0f80e38b538571ce5db18c90945679ab74f2", "uploaded_at": "2026-05-26T22:01:05.356Z", "updated_at": "2026-08-06T02:56:07.047Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "DIFERIMIENTO.pdf", "availability": "available", "size_bytes": "299660", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-06-10T21:50:53.114Z", "updated_at": "2026-06-10T21:50:53.373Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "DIFE FALLO.pdf", "availability": "available", "size_bytes": "323681", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-06-23T18:27:10.006Z", "updated_at": "2026-06-23T18:27:10.268Z" }, { "id": null, "annex_number": 2, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "AT SUS DI.pdf", "availability": "available", "size_bytes": "24883424", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-15T20:14:30.038Z", "updated_at": "2026-05-15T20:14:49.103Z" }, { "id": null, "annex_number": 3, "document_type": null, "description": "MODELO DE CONTRATO", "filename": "MODELO_CON.docx", "availability": "available", "size_bytes": "79692", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2026-05-15T20:14:32.163Z", "updated_at": "2026-05-15T20:14:49.236Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "CONVOCATORIa WORD", "filename": "Convoca I12.docx", "availability": "available", "size_bytes": "23812940", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2026-05-15T20:14:43.195Z", "updated_at": "2026-05-15T20:14:51.089Z" }, { "id": "622e7be3-c251-4e20-ac04-cf61b5cf41d5", "annex_number": 4, "document_type": null, "description": "AVISO DE SUSPENSIÓN DE JUNTA DE ACLARACIONES", "filename": "Diferimiento.pdf", "availability": "available", "size_bytes": "1030705", "mime_type": "application/pdf", "sha256": "e70c038c421c7542a1cb1897be414f1e9059d1907f8fbdf9593b7a71a0a8436c", "uploaded_at": "2026-08-06T22:10:59.442Z", "updated_at": "2026-08-06T22:10:59.442Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "APÉNDICES", "filename": "APENDICES.pdf", "availability": "available", "size_bytes": "21320797", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-15T20:14:48.845Z", "updated_at": "2026-05-15T20:14:51.111Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "AVISO DE SUSPENSIÓN DE JUNTA DE ACLARACIONES", "filename": "Diferimiento.pdf", "availability": "available", "size_bytes": "539828", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-28T00:00:40.277Z", "updated_at": "2026-05-28T00:00:55.321Z" }, { "id": "ec604bac-56de-42a5-bfe1-b7aad167e141", "annex_number": 6, "document_type": null, "description": "AVISO DE SUSPENSIÓN DE JUNTA DE ACLARACIONES", "filename": "2 Diferimiento.pdf", "availability": "available", "size_bytes": "291717", "mime_type": "application/pdf", "sha256": "1f2754a333728c270135d438fc8a0f80e38b538571ce5db18c90945679ab74f2", "uploaded_at": "2026-08-06T22:11:00.477Z", "updated_at": "2026-08-06T22:11:00.477Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "CONVOCATORIa WORD", "filename": "Convoca I12.docx", "availability": "available", "size_bytes": "23812940", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2026-05-28T00:00:33.147Z", "updated_at": "2026-05-28T00:00:55.311Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "APÉNDICES", "filename": "APENDICES.pdf", "availability": "available", "size_bytes": "21320797", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-28T00:00:38.099Z", "updated_at": "2026-05-28T00:00:55.318Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "anexo técnico", "filename": "AT SUSTAN DI.docx", "availability": "available", "size_bytes": "4989659", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2026-05-28T00:00:49.670Z", "updated_at": "2026-05-28T00:00:55.658Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "ACTA JUNTA DE ACLARACIONES", "filename": "acta_junta_de_aclaraciones-firmada.pdf", "availability": "available", "size_bytes": "8543900", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-27T04:30:35.313Z", "updated_at": "2026-05-27T04:30:35.579Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "ACTA CIERRE JUNTA DE ACLARACIONES", "filename": "CIERRE JA DI.pdf", "availability": "available", "size_bytes": "223529", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-28T00:00:46.913Z", "updated_at": "2026-05-28T00:00:55.414Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "ACTA CIERRE JUNTA DE ACLARACIONES", "filename": "acta_cierre_junta_de_aclaraciones-firmada.pdf", "availability": "available", "size_bytes": "766465", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-05-28T16:17:16.651Z", "updated_at": "2026-05-28T16:17:16.957Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "apéndice 1", "filename": "APENDICE 1.xlsx", "availability": "available", "size_bytes": "204258", "mime_type": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "sha256": null, "uploaded_at": "2026-05-28T00:00:51.634Z", "updated_at": "2026-05-28T00:00:55.778Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "apéndice 2", "filename": "APENDICE 2.xlsx", "availability": "available", "size_bytes": "199895", "mime_type": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "sha256": null, "uploaded_at": "2026-05-28T00:00:53.754Z", "updated_at": "2026-05-28T00:00:55.916Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "ACTA DE APERTURA DE PROPOSICIONES", "filename": "acta_de_apertura_de_proposiciones-firmada.pdf", "availability": "available", "size_bytes": "101744599", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-06-05T01:23:54.694Z", "updated_at": "2026-06-05T01:23:54.943Z" }, { "id": "040def6c-de20-4900-a435-d4e0e225fd49", "annex_number": 18, "document_type": null, "description": "ACTA DE FALLO", "filename": "acta_de_fallo-firmada.pdf", "availability": "available", "size_bytes": "6452380", "mime_type": "application/pdf", "sha256": "4ef6e537563c76f19efbbb3cab763f10e26cdf65ada7cb2cdf9e66be2dfa3d2a", "uploaded_at": "2026-08-06T22:11:03.726Z", "updated_at": "2026-08-06T22:11:03.727Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "la-12-nck-012nck001-i-39-2024", "nombre_procedimiento": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO 2024.", "dependencia": "INNN", "siglas": "INNN", "score": 0.08782020472944352 }, { "numero_procedimiento": "la-12-nde-012nde001-i-240-2023", "nombre_procedimiento": "SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO COMPLEMENTO DE INVESTIGACIÓN.", "dependencia": "INPER", "siglas": "INPER", "score": 0.09314709346609584 }, { "numero_procedimiento": "la-12-nck-012nck001-i-45-2026", "nombre_procedimiento": "SEGUNDO PROCEDIMIENTO PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DI", "dependencia": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "siglas": "INNN", "score": 0.11929302696627064 }, { "numero_procedimiento": "la-12-nde-012nde001-i-172-2024", "nombre_procedimiento": "SUSTANCIAS QUIMICAS Y MATERIAL DE LABORATORIO PARA LA DIRECCION DE INVESTIGACION", "dependencia": "INPER", "siglas": "INPER", "score": 0.12168842554092407 }, { "numero_procedimiento": "la-12-nbv-012nbv001-i-146-2023", "nombre_procedimiento": "ADQUISICIÓN DE SUSTANCIAS Y MATERIALES DE ORIGEN QUÍMICO,...", "dependencia": "INSTITUTO NACIONAL DE CANCEROLOGÍA", "siglas": "INCAN", "score": 0.123557448387146 }, { "numero_procedimiento": "la-12-nde-012nde001-i-174-2023", "nombre_procedimiento": "SUSTANCIAS QUÍMICAS, REACTIVOS ANALÍTICOS, MATERIALES DE CURACIÓN Y LABORATORIO.", "dependencia": "INPER", "siglas": "INPER", "score": 0.13014921933857226 } ] }