{ "ocid": "ocds-x-licitia-la-12-nck-012nck001-i-39-2024", "id": "LA-12-NCK-012NCK001-I-39-2024", "date": "2024-06-05T22:00:00.000Z", "language": "es", "initiationType": "tender", "tag": [ "tender", "award", "contract" ], "parties": [ { "id": "INNN", "name": "INNN", "roles": [ "buyer" ] }, { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV", "roles": [ "supplier" ] }, { "id": "ABYNTECH SA DE CV", "name": "ABYNTECH SA DE CV", "roles": [ "supplier" ] }, { "id": "ACCESORIOS PARA LABORATORIOS SA DE CV", "name": "ACCESORIOS PARA LABORATORIOS SA DE CV", "roles": [ "supplier" ] }, { "id": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS SA DE CV", "name": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS SA DE CV", "roles": [ "supplier" ] }, { "id": "BIOADVANCED SYSTEMS SA DE CV", "name": "BIOADVANCED SYSTEMS SA DE CV", "roles": [ "supplier" ] }, { "id": "CIENTIFICA SENNA SA DE CV", "name": "CIENTIFICA SENNA SA DE CV", "roles": [ "supplier" ] }, { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "roles": [ "supplier" ] }, { "id": "COMPAÑIA VILAB SA DE CV", "name": "COMPAÑIA VILAB SA DE CV", "roles": [ "supplier" ] }, { "id": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "roles": [ "supplier" ] }, { "id": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "name": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "roles": [ "supplier" ] }, { "id": "DESARROLLO QUIMICO HELU SA DE CV", "name": "DESARROLLO QUIMICO HELU SA DE CV", "roles": [ "supplier" ] }, { "id": "DIAGNOCELL LABORATORIOS SA DE CV", "name": "DIAGNOCELL LABORATORIOS SA DE CV", "roles": [ "supplier" ] }, { "id": "MEXICO BIOCARE REPRESENTANTE SA DE CV", "name": "MEXICO BIOCARE REPRESENTANTE SA DE CV", "roles": [ "supplier" ] }, { "id": "MIGUEL CASTILLO FLORES", "name": "MIGUEL CASTILLO FLORES", "roles": [ "supplier" ] }, { "id": "PRODUCTOS Y EQUIPOS BIOTECNOLOGICOS SA DE CV", "name": "PRODUCTOS Y EQUIPOS BIOTECNOLOGICOS SA DE CV", "roles": [ "supplier" ] }, { "id": "QUIMICA INDUSTRIAL Y DE SALUD SA DE CV", "name": "QUIMICA INDUSTRIAL Y DE SALUD SA DE CV", "roles": [ "supplier" ] }, { "id": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "name": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "roles": [ "supplier" ] }, { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "roles": [ "supplier" ] }, { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV", "roles": [ "supplier" ] }, { "id": "VITALMEX COMERCIAL SA DE CV", "name": "VITALMEX COMERCIAL SA DE CV", "roles": [ "supplier" ] } ], "buyer": { "id": "INNN", "name": "INNN" }, "tender": { "id": "LA-12-NCK-012NCK001-I-39-2024", "title": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO 2024.", "description": "ADQUISICIÓN DE SUSTANCIAS QUIMICAS Y MATERIAL DE LABORATORIO PARA LAS ÁREAS DEL INSTITUTO NACIOINAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "status": "complete", "procurementMethod": "open", "procurementMethodDetails": "LICITACIÓN PÚBLICA", "mainProcurementCategory": "goods", "tenderPeriod": { "startDate": "2024-05-16T05:48:49.000Z", "endDate": "2024-05-27T22:00:00.000Z" }, "awardPeriod": { "endDate": "2024-06-05T22:00:00.000Z" }, "items": [ { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BMGBI (BMGBI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1410, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BSAI (BSAI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1533, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BSMBI (BSMBI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1605, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BSTXI VIAL DE 500U VIAL 500 U", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 783, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN SSP I VIAL 1500 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 945, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN XHOI, LÍQUIDO A 10 U/µL VIAL 5,000 UNIDADES (5,000 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1430, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR, ESCALERA DE 25 PB VIAL 150 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1970, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESOS MOLECULARES COMPATIBLE CON GELES DE AGAROSA PARA ADN O PCR, FAGO LAMBDA DIGERIDO CON EZIMA HINDIII PARA FRAGMENTOS DESDE 125 HASTA 23130 PARES DE BASES VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1652, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA DE DNTP, (DATP, DCTP, DGTP Y DTTP 10 MM CADA UNO), LÍQUIDO, PUREZA >99% VIAL 5X1 ML (5 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2272, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA PARA ENSAMBLADO DE GIBSON (GIBSON ASSEMBLY MASTER MIX), LÍQUIDO VIAL 50 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12038, "currency": "MXN" } } }, { "id": "0", "description": "MINI, CONJUNTO DE INHIBIDORES DE PROTEASAS SIN EDTA EN TABLETA CAJA 25 TABLETAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2811, "currency": "MXN" } } }, { "id": "0", "description": "OLIGO DT 12-18 VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 718, "currency": "MXN" } } }, { "id": "0", "description": "RETROTRANSCRIPTASA CON ACTIVIDAD H REDUCIDA (H MINUS REVERSE TRANSCRIPTASE) 2000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1342, "currency": "MXN" } } }, { "id": "0", "description": "RNASA A DE PÁNCREAS BOVINO VIAL 500 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 721, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN MONOFÁSICA DE FENOL E ISOTIOCIANATO DE GUANIDINA FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3382, "currency": "MXN" } } }, { "id": "0", "description": "TINCIÓN PARA ÁCIDOS NUCLEICOS DE DOBLE CADENA, SYTO 9 KIT 5MM, 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5908, "currency": "MXN" } } }, { "id": "0", "description": "TINTES DE ÁCIDO NUCLEICO FLUORESCENTES VERDES SYTO 9 VIAL 100 UL 5MM, EN DMSO.", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5908, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBIÓTICO SELECTIVO GENETICINA O SULFATO G418, POLVO, PUREZA MAYOR AL 98% PARA CULTIVO CELULAR FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-6880" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10101, "currency": "MXN" } } }, { "id": "0", "description": "BICARBONATO DE SODIO PARA CULTIVO CELULAR FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7736" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 251, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER PARA LISIAR CÉLULAS DE MAMÍFEROS, ESTÉRIL FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25401-7026" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2827, "currency": "MXN" } } }, { "id": "0", "description": "COMPLEMENO B-27 SIN INSULINA CONCENTRADO (50X) FRASCO 10 ML", "classification": { "scheme": "CUCOP", "id": "25401-7925" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2589, "currency": "MXN" } } }, { "id": "0", "description": "GENETICINA EN POLVO (GENETICIN - G418) 500 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2637, "currency": "MXN" } } }, { "id": "0", "description": "HIDRATO DE SAL DE TRISULFATO DE NEOMICINA, POLVO, PUREZA MAYOR AL 98% PARA CULTIVO CELULAR FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25301-4407" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2827, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE TAMPÓN DE FIJACIÓN/PERMEABILIZACIÓN (10X). (COMPUESTO POR SOLUCIÓN DE FIJACIÓN/PERMEABILIZACIÓN Y SOLUCIÓN DE LAVADO) BOTELLA 300 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 854, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DMEM/F12, POLVO PAQUETE 10 SOBRES PARA 10 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1088, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO NEUROBASAL, ESTÉRIL, SIN D-GLUCOSA Y SIN PIRUVATO DE SODIO FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1620, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN AZUL TRIPANO AL 0.4% ESTÉRIL FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 378, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE AMINOÁCIDOS NO ESENCIAL MEM, 100X BOTELLA 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 406, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE LISIS DE GLÓBULOS ROJOS (10X). SOLUCIÓN DE LISIS PARA ERITROCITOS CON EFECTOS MÍNIMOS PARA CÉLULAS HUMANAS, DE RATA, DE RATÓN, EN MÉDULA ÓSEA Y SUSPENSIONES UNICELULARES DE PREPARACIONES DE TEJIDOS FRASCO 50 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1315, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN ESTÉRIL DE GENTAMICINA (125 G/ML)/AMFOTERICINA B (5MG/ML), 500X PARA CULTIVO CELULAR BOTELLA 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 1620, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN ESTÉRIL DE HEPES (N-2-HIDROXIETILOPIPERACINA-N-2-ETANO ÁCIDO SULFÓNICO) 1 MOLAR, ESTÉRIL, PARA CULTIVO CELULAR BOTELLA 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1307, "currency": "MXN" } } }, { "id": "0", "description": "TRIPSINA 0.25%-EDTA PARA CULTIVO CELULAR FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 577, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE DETERGENTE NP-40 BOTELLA 50 ML", "classification": { "scheme": "CUCOP", "id": "25401-4555" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2875, "currency": "MXN" } } }, { "id": "0", "description": "ESTREPTAVIDINA CONJUGADA CON HRP, CONCENTRACIÓN 1.25 MG/ML VIAL 0.25 ML", "classification": { "scheme": "CUCOP", "id": "25401-5994" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2367, "currency": "MXN" } } }, { "id": "0", "description": "APC ANEXINA V, DETECCIÓN DE APOPTOSIS KIT 300 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8068, "currency": "MXN" } } }, { "id": "0", "description": "ESTUCHE COMERCIAL PARA EXTRACCIÓN DE DNA PARA 250 PREPARACIONES DE ADN: 250 COLUMNAS CON SOLUCIONES PARA ELIMINACIÓN DE CONTAMINANTES E INHIBIDORES (PROTEINASA K, ARN PORTADOR, TAMPONES Y TUBOS DE RECOGIDA (2 ML)), QUE SEA COMPATIBLE CON EQUIPO QIACUBE. CAJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 20102, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE INICIO DE ELECTROFORESIS VERTICAL PARA 4 GELES DE 1.5 MM DE GROSOR, INCLUYE SOPORTES PARA POLIMERIZAR GELES DE ACRILAMIDA, PEINES DE 10 Y 15 POZOS, VIDRIOS DELGADOS Y GRUESOS DE 1.5 MM DE GROSOR KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 25668, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE MINIPREP (MINIPREP KIT) 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2277, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE OLIGOS PARA SECUENCIACIÓN POR ILLUMINA MULTIPLEX (MULTIPLEX OLIGOS FOR ILLUMINA KIT) 24 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 19764, "currency": "MXN" } } }, { "id": "0", "description": "KIT ENZIMÁTICO PYROMARK GOLD Q24 PARA LA TECNOLOGÍA DE PIROSECUENCIACIÓN PARA MUESTRAS DE 5 X 24. CONTIENE MEZCLA DE SUSTRATOS Y NUCLEÓTIDOS. PERMITEN EL ANÁLISIS DE METILACIÓN Y MUTACIÓN KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9298, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA PCR PYROMARK DE 200 REACCIONES. MEZCLA MAESTRA, CONCENTRADA 10X QUE INCLUYE ADN POLIMERASA HOTSTARTAQ Y TAMPÓN DE REACCIÓN OPTIMIZADO QUE CONTIENE MGCL2 3 MM Y DNTP. TUNEL-BRDU-RED PARA DETECTAR APOPTOSIS KIT 200 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7770, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETE COMERCIAL PARA LA REALIZACIÓN DE REACCIONES DE METILACIÓN CUANTITATIVA POR PIROSECUENCIACIÓN (5 X 24) COMPATIBLE CON EQUIPO PYROMARK Q24 (ÚNICO EQUIPO EN EL MERCADO QUE REALIZA METILACIÓN CUANTITATIVA POR PIROSECUENCIACIÓN). EL KIT DEBE CONTENER MEZCLA DE SUSTRATOS (ADENOSINA-5'-FOSFOSULFATO Y LUCIFERINA) Y MEZCLA DE ENZIMAS (ADN-POLIMERASA, ATP-SULFURILASA) PARA LA PIROSECUENCIACIÓN, DATPAS , DCTP, DTTP, DGTP. CONSERVAR NUCLEÓTIDOS, ENZIMAS Y SUSTRATOS (SENSIBLES A LA LUZ) A 4–8 °C. CAJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 7770, "currency": "MXN" } } }, { "id": "0", "description": "NONIDET P40 FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-1099" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2875, "currency": "MXN" } } }, { "id": "0", "description": "BIS-ACRILAMIDA FRASCO 50 G", "classification": { "scheme": "CUCOP", "id": "25401-7844" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1634, "currency": "MXN" } } }, { "id": "0", "description": "BIS-ACRILAMIDA FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7844" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1634, "currency": "MXN" } } }, { "id": "0", "description": "COMPLETE, MINI PROTEASE INHIBITOR COCKTAIL CONTAINS 25 MM TRIS, 192 MM GLYCINE, 0.1% SDS, PH 8.3 FOLLOWING DILUTION TO 1X WITH WATER 25 TABLETAS", "classification": { "scheme": "CUCOP", "id": "25401-5960" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2811, "currency": "MXN" } } }, { "id": "0", "description": "IMMUN-BLOT PVDF MEMBRANE, ROLL, 26 CM X 3.3 M, ROLL 0.2 µM, 26 CM X 3.3 M, BULK MEMBRANE FOR HIGH BINDING (150–160 µG/CM2) IMMUNOBLOTTING 1 ROLLO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8129, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE NITROCELULOSA, 0.2 µM, 30 CM X 3 M ROLLO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7696, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE NITROCELULOSA, 0.45 µM 30 CM X 3.5 M ROLLO 3.5 M", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 6332, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO ABSORBENTE PARA BLOT EXTRA GRUESO, PRECORTADO, 7 X 8.4 CM PAQUETE 60 HOJAS", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1461, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO EXTRA GRUESO PARA TRANSFERENCIA CON TURBO TRANSFER, TAMAÑO 7.5 X 10 CM PAQUETE 60 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4062, "currency": "MXN" } } }, { "id": "0", "description": "PONCEAU S STAINING SOLUTION BOTELLA 1000 ML", "classification": { "scheme": "CUCOP", "id": "25401-7055" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1164, "currency": "MXN" } } }, { "id": "0", "description": "TEMED PARA PREPARAR GELES DE ELECTROFORESIS FRASCO 5 ML", "classification": { "scheme": "CUCOP", "id": "25401-7843" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 364, "currency": "MXN" } } }, { "id": "0", "description": "APLICADOR DE PELÍCULA ADHESIVA ÓPTICA PARA PCR PAQUETE 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8030" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1417, "currency": "MXN" } } }, { "id": "0", "description": "INSERTOS ESTÉRILES PARA CAJA DE CULTIVO CELULAR DE TAMAÑO DE PORO 0.4µM, 30 MM DE DIÁMETRO CAJA 50 INSERTOS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2754, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE AGLUTINACIÓN LÁTEX PARA DIAGNÓSTICO DE CRYPTOCOCCUS KIT PARA 60 DETERMINACIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 37304, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE DIAGNÓSTICO PARA GDH + TOXIN A + B DE CLOSTRIDIUM DIFFICILE EN HECES CAJA CON 20 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 24200, "currency": "MXN" } } }, { "id": "0", "description": "NG-TEST CARBA 5 CAJA C/20 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 47300, "currency": "MXN" } } }, { "id": "0", "description": "ROSA DE BENGALA, AGLUTINACIÓN EN PORTA. KIT DE DETERMINACIÓN CUALITATIVA DE ANTICUERPOS ANTI-BRUCELLA IVD KIT CON 50 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1960, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-SARS-COV-2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 67104, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PANTRK RM423 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 108300, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO DE SCHIFF FUCSINA - SULFITO LISTO PARA USARSE FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5667.2, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DESCALCIFICADORA ESPECIAL PARA UÑAS FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 36564, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DESCALCIFICANTE QUE FUNCIONA COMO FIJADOR Y DESCALCIFICANTE SIMULTANEMENTE, ESPECIAL PARATECNICAS DE INMUNOHISTOQUIMICA E HIBRIDACION IN SITU GALON", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 46000, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EVF PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 85700, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HUMAN IGG (¿-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 147100, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA TINCION DE HEROVICI KIT", "classification": { "scheme": "CUCOP", "id": "25501-0099" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 89650, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOQUERATINA PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 57500, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE AMIGDALA PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE APENDICE PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE GANGLIO PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 48933, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE OVARIO PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PANCREAS PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PIEL PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PLACENTA PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE TUMORES GERMINALES PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 48300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE UTERO PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 48300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ALFA FETOPROTEINA PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ATRX PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA BHGC PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOMEGALOVIRUS PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA HERPES VIRUS PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA IDH1 R132H PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA KI67 PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA OLIG 2 PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA P53 PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLAP PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA TOXOPLASMA PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 48200, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIRUS EPSTEIN BARR PARA INMUNOHISTOQUIMICA CAJA CON 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 35300, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS DE PLASTICO PARA TRANSFERENCIA DE UN SOLO PASO LIBRE DE DECANTACIÓN DESPUES DE CENTRIFUGACION PARA TUBO CONICO DE 12 ML PARA RETENER 1.0 ML DE ORINA CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 28400, "currency": "MXN" } } }, { "id": "0", "description": "CELECOXIB, 98% O MÁS DE PUREZA FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 317200, "currency": "MXN" } } }, { "id": "0", "description": "GRAMICIDIN A VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25401-5569" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 63128, "currency": "MXN" } } }, { "id": "0", "description": "LIPOPOLISACÁRIDO DE ESCHERICHIA COLI O111:B4. PURIFICADO POR EXTRACCIÓN FENOL FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 16800, "currency": "MXN" } } }, { "id": "0", "description": "PICROTOXINA VIAL 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1874, "currency": "MXN" } } }, { "id": "0", "description": "REVERSAN 50 MG", "classification": { "scheme": "CUCOP", "id": "23501-0007" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 116600, "currency": "MXN" } } }, { "id": "0", "description": "TARIQUIDAR FRASCO 25 MG", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 73891, "currency": "MXN" } } }, { "id": "0", "description": "ALFA SINUCLEÍNA HUMANA RECOMBINANTE EXPRESADA EN E. COLI MARCADA CON HISTIDINA EN LA REGIÓN N-TERMINAL CON PUREZA >90% (SDS-PAGE), POLVO LIOFILIZADO VIAL 500 µG", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 22300, "currency": "MXN" } } }, { "id": "0", "description": "GLUTATION AGAROSA (PARA INMUNOPRECIPITACIONES) FRASCO 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12610, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR DE AMPLIO ESPECTRO DE PKC (GO 6983) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 46160, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR DE LA ACTIVACIÓN DE NFKB (CARDAMONIN) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 45422, "currency": "MXN" } } }, { "id": "0", "description": "ACUTASA 400-600 UNIDADES POR MILILITRO (ESTÉRIL/FILTRADO). ADECUADO PARA MAMÍFEROS Y ANÁLISIS UNICELULAR BOTELLA 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINACIÓN DE GLUCOSA FOSFATO ISOMERASA CELULAR KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 36360, "currency": "MXN" } } }, { "id": "0", "description": "DOPAC, ÁCIDO HOMOPROTOCATEQUIICO, PUREZA: =98% (HPLC) FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26280, "currency": "MXN" } } }, { "id": "0", "description": "L-KINURENINA (PUREZA MAYOR A 98% GRADO HPLC) FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 41300, "currency": "MXN" } } }, { "id": "0", "description": "PHTALDIALDEHÍDO FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-6886" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 43000, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFÍA NEXCOL C18 5UM (50 X 3.0 MM, 100 A) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 66960, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFIA ZORBAX ECLIPSE AAA C-18 RESOLUCIÓN RÁPIDA 3.5 UM (4.6 X 150 MM) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 58918, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE GRAFITO CON PLATAFORMA TRANSVERSAL (THGA) ESTÁNDAR PARA USO EN HORNO DE GRAFITO PARA ESPECTROFOTOMETRÍA DE ABSORCIÓN ATÓMICA (COMPATIBLE CON EQUIPO PERKIN ELMER AA600) CAJA 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 89600, "currency": "MXN" } } }, { "id": "0", "description": "GLICERINA GRADO REACTIVO FRASCO DE 1 LT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 530.21, "currency": "MXN" } } }, { "id": "0", "description": "TARJETAS (DRYSLIDE) PARA PRUEBA DE OXIDASA. SISTEMA DE DIAGNOSTICO PARA DETERMINAR LA PRUEBA DE OXIDASA DE LAS BACTERIAS CAJA C/25 SOBRES DE 3 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1351.29, "currency": "MXN" } } }, { "id": "0", "description": "TARGET SOLUCIÓN RECUPERADORA DE ANTÍGENOS PARA INMUNOHISTOQUÍMICA PH 6 (CONCENTRADA) FRASCO DE 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 4453.68, "currency": "MXN" } } }, { "id": "0", "description": "TINCION EA50 PARA PAPANICOLAOU LISTA PARA USARSE FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1295, "currency": "MXN" } } }, { "id": "0", "description": "TINCION OG-6 PARA PAPANICOLAOU LISTA PARA USARSE FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 518.66, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE ZINC FRASCO DE 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2500.77, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA EN ENVASE DE PLÁSTICO FRASCO 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 381, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE DE WRIGTH (MERK) FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 792.36, "currency": "MXN" } } }, { "id": "0", "description": "AMPICILINA SAL SÓDICA, POLVO, IRRADIADA O CON PUREZA MAYOR AL 98% FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25301-4398" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6172.41, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR PLUS 405 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6441.29, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO DE CABRA, ALEXA FLUOR 546 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5650.01, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR PLUS 647 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7011.82, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN POLLO, ACOPLADO A ALEXA FLUOR 594 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4582.54, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN CONEJO, ACOPLADO A ALEXA FLUOR 568 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4692.91, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA ANTI-IGG DE RATÓN (H+L) DE CABRA, ALEXA FLUOR™ 430 VIAL 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4766.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA ANTI-IGG DE RATÓN (H+L) DE CABRA, ALEXA FLUOR™ 568 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4692.91, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA IGG (H+L) ANTI-CONEJO DE CABRA, ALEXA FLUOR™ 430 VIAL 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4766.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO DE ADSORCIÓN CRUZADA IGG (H+L) ANTI-CONEJO DE CABRA, ALEXA FLUOR™ 568 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4692.91, "currency": "MXN" } } }, { "id": "0", "description": "DILUYENTE DE ANTICUERPOS PRIMARIOS UTILIZADOS EN INMUNOHISTOQUÍMICA EN TEJIDOS INCLUIDOS EN PARAFINA FRASCO 50 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2926.22, "currency": "MXN" } } }, { "id": "0", "description": "CÉLULAS DE E.COLI QUÍMICAMENTE COMPETENTES CEPA DH5A (DH5A COMPETENT CELLS), ALTA EFICIENCIA VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2797.37, "currency": "MXN" } } }, { "id": "0", "description": "DNASA I, LIBRE DE RNASA (DNASE I, RNASE FREE) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11226.26, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BCGI (BCGI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1729.9, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN ESP3I (BSMBI), LÍQUIDO A 10 U/µL 1000 UNITS (1000 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1509.14, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HAE III VIAL 1500 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 685.1, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN MBO II VIAL 1500 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4195.97, "currency": "MXN" } } }, { "id": "0", "description": "EXONUCLEASA DEPENDIENTE DE FOSFATO (PHOSPHATE-DEPENDENT EXONUCLEASE) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1435.39, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE PARA SU USO EN WESTERN BLOT, CON MEMBRANAS DE PVDF Y NITROCELULOSA, CON UN RANGO DE SENSIBILIDAD DEL ORDEN DE PICOGRAMOS A FEMTOGRAMOS. CONTENIDO DEL KIT LUMINOL/POTENCIADOR 500 ML Y SOLUCIÓN ESTABLE EN PERÓXIDO 500 ML KIT 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1840.44, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR, ESCALERA DE 100 PB VIAL 150 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1837.42, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA (2X) PARA QPCR CON SYBR GREEN/ROX (SYBR GREEN/ROX QPCR MASTER MIX 2X), LÍQUIDO VIAL 1000 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7251.05, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA TAQMAN VIAL 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6570.14, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA UNIVERSAL PARA SONDAS DE HIDRÓLISIS (2X), NO UNG AMPERASA, QUE OFREZCA RESULTADOS EN 40 MINUTOS PARA 40 CICLOS DE PCR EN TIEMPO REAL. DEBE CONTENER COLORANTE DE REFERENCIA PASIVA ROX Y SER COMPATIBLE CON EQUIPOS STEP ONE™ Y QUANTSTUDIO™5. MEZCLA PARA LA IDENTIFICACIÓN DE GENOTIPOS DE ALTO RENDIMIENTO TUBO 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 3257.52, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA UNIVERSAL, QUE CONTENGA ENZIMA TERMOESTABLE, 400 µM DNTPS CON AMORTIGUADOR DE 3 MM MGCL2 Y SOLUCIÓN PARA REGIONES RICAS EN GC, Y AGUA LIBRE DE RNASAS PARA PCR PUNTO FINAL, ESTUCHE COMERCIAL DE 1000 UNIDADES (X3) CAJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1932.34, "currency": "MXN" } } }, { "id": "0", "description": "PELÍCULA DE LUZ CARESTREAM BIOMAX HOJAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7306.32, "currency": "MXN" } } }, { "id": "0", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA) VIAL 20 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3404.69, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DE PRECIPITACIÓN DE PROTEINAS PARA EXTRACCION DE DNA FCO 1L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1590.79, "currency": "MXN" } } }, { "id": "0", "description": "TAQ POLIMERASA TAQ JUMPSTART VIAL 50 U", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2079.67, "currency": "MXN" } } }, { "id": "0", "description": "FACTOR DE CRECIMIENTO DE FIBROBLASTOS BÁSICO (BFGF), PROTEÍNA RECOMBINANTE HUMANA, POLVO LIOFILIZADO VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16600.08, "currency": "MXN" } } }, { "id": "0", "description": "FACTOR DE CRECIMIENTO EPIDERMAL (EGF), PROTEÍNA RECOMBINANTE HUMANA, POLVO LIOFILIZADO VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25301-3398" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4968.94, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO NEUROBASAL FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1535.18, "currency": "MXN" } } }, { "id": "0", "description": "POLY D LISINA FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2429.28, "currency": "MXN" } } }, { "id": "0", "description": "SUERO FETAL BOVINO, INACTIVADO POR CALOR FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2105.38, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO B27 859 X) FRASCO 10 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 889.22, "currency": "MXN" } } }, { "id": "0", "description": "DODECIL SULFATO DE SODIO (SDS) FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-4557" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1237.66, "currency": "MXN" } } }, { "id": "0", "description": "FORMALDEHÍDO 37% FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-7382" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1475.91, "currency": "MXN" } } }, { "id": "0", "description": "ÓXIDO DE PROPILENO (PUREZA MAYOR A 99%) FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7115" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1629.36, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO BICINCONÍNICO KIT - DETERMINACIÓN DE 200 A 1000 UG DE PROTEÍNA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2999.81, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ANEXINA V ACOPLADO A APC PARA 300 PRUEBAS FRASCO PEQUEÑO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4600.85, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA INTERLEUCINA 18 EN HOMOGENADOS DE TEJIDO Y CON REACTIVIDAD EN RATA PLACA DE 96 POZOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10600.46, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ENSAYO DOBLE DE LUCIFERASA DE RENILLA Y DE LUCIÉRNAGA. DETECCIÓN DE BIOLUMINISCENCIA EN MICROPLACA KIT 1000 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19323.86, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ENSAYO ELECTROFÓRETICO DE CAMBIO DE MOVILIDAD (EMSA) BASADO EN FLUORESCENCIA PARA DETECTAR ÁCIDOS NUCLEICOS Y PROTEÍNAS EN EL MISMO GEL. MÉTODO DE DETECCIÓN POR SYBR GREEN Y SYPRO RUBY. KIT 10 MINI GELES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2484.55, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE FRACCIONAMIENTO CELULAR (NÚCLEO/CITOSOL) KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14686.06, "currency": "MXN" } } }, { "id": "0", "description": "KIT DETERMINACIÓN DE PROTEINAS POR BCA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2999.81, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR IFN-GAMMA EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10600.46, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR IL-10 EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10784.59, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR IL-6 EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10600.46, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR IL.4 EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10600.46, "currency": "MXN" } } }, { "id": "0", "description": "KIT SUTRATO DIAMINOBECIDINA (DAB) PARA SU USO EN INMUNOHISTOQUÍMICA USANDO EL SISTEMA HRP/ENZIMA PEROXIDASA. CONTIENE EL CROMOGENO DAMINOBENCIDINA (DAB) 50X CON 4 ML Y EL SUSTRATO PARA DIAMINOBENCIDINA DE 125 ML KIT 125 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2410.8, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS2032582 DEL GEN HUMANO ABCB1 MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: TATTTAGTTTGACTCACCTTCCCAG[C/A]ACCTTCTAGTTCTTTCTTATCTTTC VIAL 150 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8889.05, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS2032582 DEL GEN HUMANO ABCB1 MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: TATTTAGTTTGACTCACCTTCCCAG[C/T]ACCTTCTAGTTCTTTCTTATCTTTC VIAL 150 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8889.05, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS429358 DEL GEN HUMANO APOE MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: GCTGGGCGCGGACATGGAGGACGTG [C/T]GCGGCCGCCTGGTGCAGTACCGCGG VIAL 300 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6882.96, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETE COMERCIAL PARA GENOTIPIFICAR VARIANTE SNP RS7412 DEL GEN HUMANO APOE MEDIANTE PCR EN TIEMPO REAL. DEBE CONTENER PAR DE OLIGONUCLEÓTIDOS Y SONDAS DE HIDRÓLISIS MARCADAS CON FLUOROCROMO [VIC/FAM] PARA RECONOCER ALELO SILVESTRE Y ALELO MUTANTE. SECUENCIA: CCGCGATGCCGATGACCTGCAGAAG[C/T]GCCTGGCAGTGTACCAGGCCGGGGC VIAL 300 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6882.96, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO CASPASA-3/7 VERDE READYPROBES CELLEVENT 1.75 ML MOLECULAR PROBES FRASCO CUENTA GOTAS CON 1.75 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5705.11, "currency": "MXN" } } }, { "id": "0", "description": "CARBONATO DE AMONIO FRASCO 2 G", "classification": { "scheme": "CUCOP", "id": "25901-1604" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6897.81, "currency": "MXN" } } }, { "id": "0", "description": "GLUCOSA (PUREZA MAYOR A 99.5%) FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7505" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1029, "currency": "MXN" } } }, { "id": "0", "description": "SAL SÓDICA DE ÁCIDO 1-OCTANOSULFÓNICO (GRADO HPLC) FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-7918" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1282.47, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ISOPROPÍLICO FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7723" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1511.25, "currency": "MXN" } } }, { "id": "0", "description": "ISOPROPANOL, GRADO HPLC GALÓN", "classification": { "scheme": "CUCOP", "id": "25401-7723" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4465.86, "currency": "MXN" } } }, { "id": "0", "description": "3-4-DIHIDROXIFENILACETICO , PUREZA: =98% (HPLC) FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 651.93, "currency": "MXN" } } }, { "id": "0", "description": "FORMAMIDA ALTAMENTE DESIONIZADA (HI-DI) FRASCO 25 ML", "classification": { "scheme": "CUCOP", "id": "25901-0004" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1039.75, "currency": "MXN" } } }, { "id": "0", "description": "L-GLUTAMINA, POLVO FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25401-7881" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1772.58, "currency": "MXN" } } }, { "id": "0", "description": "L-TRIPTÓFANO FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25301-1931" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2879.28, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE HEMATOXILINA DE HARRIS FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7390" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1294, "currency": "MXN" } } }, { "id": "0", "description": "YODURO DE PROPIDIO FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25401-7170" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3515.06, "currency": "MXN" } } }, { "id": "0", "description": "YODURO DE PROPIDIO, SOLUCIÓN DE 1.0 MG/ML FRASCO CON 10 ML", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1826.5, "currency": "MXN" } } }, { "id": "0", "description": "COCKTAIL INHIBIDOR DE PROTEASAS EN TABLETAS COMPRIMIDAS CON EDTA 1MM 1 CAJA CON 30 TABLETAS", "classification": { "scheme": "CUCOP", "id": "25401-5960" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3257.52, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DUAL PARA PROTEÍNAS DE 20 A 200 KDA VIAL", "classification": { "scheme": "CUCOP", "id": "25501-0067" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2282.11, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO ECL LUMINOL PARA DETECCIÓN DE QUIMIOLUMINISCENCIA PARA DETECTAR LA SEÑAL HRP CONJUGADA EN WESTERN BLOT, ALTA SENSIBILIDAD FRASCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 3680.71, "currency": "MXN" } } }, { "id": "0", "description": "SUSTRATO DE MÁXIMA SENSIBILIDAD SUPER SEÑAL™ (WEST FEMTO) FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-6088" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7766.3, "currency": "MXN" } } }, { "id": "0", "description": "CAJA CON 20 PLACAS ÓPTICAS DE 48 POZOS COMPATIBLES CON EQUIPO DE PCR EN TIEMPO REAL STEP ONE CAJA", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 1307.71, "currency": "MXN" } } }, { "id": "0", "description": "FILTRO DE MEMBRANA DE PES, DE 0.22 µM, 47 MM DE DIÁMETRO PAQUETE 50 FILTROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2726.76, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS DE NITROCELULOSA CON PORO DE 0.22 MICRAS Y 45 MM DE DIÁMETRO CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6262" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4360.77, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS PIRINOLA DE 0.22 MICRAS Y 33 MM, ESTÉRILES Y CON ENVOLTURA INDIVIDUAL CAJA 250 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8668" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9709.2, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS PIRINOLA DE NYLON, 0.45 UM PAQUETE 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1762.35, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO PARA CULTIVO CELULAR DE 25 CM2, ESTÉRILES Y DE POLIESTIRENO, TAPA VENTILADA CON FILTRO 0.22 MICRAS CAJA 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0138" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2079.34, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACA DE 96 POZOS, MEDIA ÁREA, ESTÉRIL, TRANSPARENTE, CON TAPA, PARA CULTIVO CELULAR PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1276.3, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACA DE REACCIÓN ÓPTICA DE 96 POCILLOS COMPATIBLE CON ANALIZADOR GENÉTICO: AB3100, 3130, 3500, POLIPROPILENO, VOL. DE TRABAJO 0.2 ML, LIBRE DE ARNASA Y ADNASA CAJA 10 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1271.42, "currency": "MXN" } } }, { "id": "0", "description": "PARAFILM 12 CM X 10 M ROLLO", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 5885.04, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA SEROLÓGICA DE POLIPROPILENO DESECHABLE DE 10 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS CAJA 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6575" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 399.5, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA SEROLÓGICA DE POLIPROPILENO DESECHABLE DE 25 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS CAJA 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6576" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1007.83, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA SEROLOGICA DE POLIPROPILENO DESECHABLE DE 5 ML, ENVUELTA INDIVIDUALMENTE, ESTÉRIL, LIBRE DE PIRÓGENOS CAJA 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6574" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 354.48, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE 96 POZOS PARA PCR CON FILM TRANSPARENTE NATURAL LIBRE DE RNASAS Y DNASAS, DNA E INHIBIDORES DE PCR CAJA 10 PLACAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 18054.29, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE VERIFICACIÓN RÁPIDA DEL INSTRUMENTO DE 48 POCILLOS PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11298.17, "currency": "MXN" } } }, { "id": "0", "description": "SEPTO DE 96 POCILLOS PARA ANALIZADOR GENÉTICO AB3100, 3130,3500 DX/3500XL DX CAJA 20 SEPTOS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9068.98, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE FILTRACIÓN ESTÉRIL, DE 1000 ML; MEMBRANA PES 0.22µM, CON CUELLO 45 MM DESECHABLE PAQUETE 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2599.35, "currency": "MXN" } } }, { "id": "0", "description": "TAPA ÓPTICA PLANA EN TIRA PARA 8 TUBOS O PLACAS DE 48 POZOS COMPATIBLE CON ERMOCICLADORES STEP ONE CAJA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 2288.66, "currency": "MXN" } } }, { "id": "0", "description": "TIRAS DE 8 TAPONES ÓPTICOS PAQUETE 300 TIRAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2288.66, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN CON FILTROS PES 0.22 µM, ESTÉRIL, DE 45 MM DE DIÁMETRO, 500 ML CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0224" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1863.29, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA PORRÓN 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 351, "currency": "MXN" } } }, { "id": "0", "description": "AMIKACINA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2947.5, "currency": "MXN" } } }, { "id": "0", "description": "AMOXICILINA ÁCIDO CLAVULÁNICO 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2938.5, "currency": "MXN" } } }, { "id": "0", "description": "AMPICILINA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2905.5, "currency": "MXN" } } }, { "id": "0", "description": "AZITROMICINA 15 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3028.5, "currency": "MXN" } } }, { "id": "0", "description": "AZTREONAM 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2833.5, "currency": "MXN" } } }, { "id": "0", "description": "BACITRACINA TAXO A 0.04 U CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5514, "currency": "MXN" } } }, { "id": "0", "description": "BASE DE MEDIO LOWESTEIN-JENSEN FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3823.5, "currency": "MXN" } } }, { "id": "0", "description": "CALDO MÜLLER HINTON FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3088.5, "currency": "MXN" } } }, { "id": "0", "description": "CEFALOTINA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3192, "currency": "MXN" } } }, { "id": "0", "description": "CEFEPIME 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2820, "currency": "MXN" } } }, { "id": "0", "description": "CEFOTAXIMA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2874, "currency": "MXN" } } }, { "id": "0", "description": "CEFOXITIN 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3036, "currency": "MXN" } } }, { "id": "0", "description": "CEFTAZIDIMA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2883, "currency": "MXN" } } }, { "id": "0", "description": "CEFTRIAXONA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2886, "currency": "MXN" } } }, { "id": "0", "description": "CEFUROXIMA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3106.5, "currency": "MXN" } } }, { "id": "0", "description": "CIPROFLOXACINA 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2839.5, "currency": "MXN" } } }, { "id": "0", "description": "CLINDAMICINA 2 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2956.5, "currency": "MXN" } } }, { "id": "0", "description": "COLISTINA 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3015, "currency": "MXN" } } }, { "id": "0", "description": "CROMO AGAR CANDIDA MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6657, "currency": "MXN" } } }, { "id": "0", "description": "DOXICICLINA 30 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3192, "currency": "MXN" } } }, { "id": "0", "description": "ERITROMICINA 15MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3003, "currency": "MXN" } } }, { "id": "0", "description": "ERTAPENEM 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3372, "currency": "MXN" } } }, { "id": "0", "description": "FOSFOMICINA 200 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3192, "currency": "MXN" } } }, { "id": "0", "description": "GENTAMICINA 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2938.5, "currency": "MXN" } } }, { "id": "0", "description": "HEMOGLOBINA SUPLEMENTO PARA MEDIO DE CULTIVO FRASCO DE 450 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4660.5, "currency": "MXN" } } }, { "id": "0", "description": "IMIPENEM 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2866.5, "currency": "MXN" } } }, { "id": "0", "description": "INDICADOR DE CRECIMIENTO Y ENRIQUECIMIENTO PARA TUBOS MGIT CAJA C/6 TUBOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 10999.5, "currency": "MXN" } } }, { "id": "0", "description": "LEVOFLOXACINO 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2844, "currency": "MXN" } } }, { "id": "0", "description": "MEROPENEM 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3037.5, "currency": "MXN" } } }, { "id": "0", "description": "MIDDLEBROOK 7H9 BROTH FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9433.5, "currency": "MXN" } } }, { "id": "0", "description": "MOXIFLOXACINO 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3192, "currency": "MXN" } } }, { "id": "0", "description": "NITROFURANTOINA 300 MCG SENSIDISCOS CAJA CON 10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3168, "currency": "MXN" } } }, { "id": "0", "description": "NORFLOXACINA 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2874, "currency": "MXN" } } }, { "id": "0", "description": "NOVOBIOCINA 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3030, "currency": "MXN" } } }, { "id": "0", "description": "OFLOXACINO 10 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2721, "currency": "MXN" } } }, { "id": "0", "description": "OPTOQUINA TAXO P 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2724, "currency": "MXN" } } }, { "id": "0", "description": "OXACILINA 1 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2938.5, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO AL 30% FRASCO 425ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 96, "unit": { "name": "PIEZA", "value": { "amount": 351.98, "currency": "MXN" } } }, { "id": "0", "description": "PIPERACILINA TAZOBACTAM 100/10 SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2779.5, "currency": "MXN" } } }, { "id": "0", "description": "POLIENRIQUECIMIENTO O ISOVITALEX LIOFILIZADO SUPLEMENTO DE CULTIVO CAJA C/5 FRASCOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4123.5, "currency": "MXN" } } }, { "id": "0", "description": "RIFAMPICINA 5 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2947.5, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA PARA IDENTIFICACIÓN DE ENTEROBACTERIAS 20 E CAJA PARA 25 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 6799.5, "currency": "MXN" } } }, { "id": "0", "description": "SULFAMETOXAZOL TRIMETOPRIM 23.75/1.25 MCG SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2853.5, "currency": "MXN" } } }, { "id": "0", "description": "TIGECICLINA 15MG SENSIDISCOS PAQ/5 PAQUETE CON 5 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3192, "currency": "MXN" } } }, { "id": "0", "description": "VANCOMICINA SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3061.5, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO DE EHRLICH PIEZA C/100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 390, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA EN ENVASE DE PLÁSTICO FRASCO 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 80, "unit": { "name": "PIEZA", "value": { "amount": 214.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI PRION PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CELS PLASMATICAS PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 32040, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EBV EBNA-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 31400, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MAP 2 CLONA HM-2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MN1 POLICLONAL PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 45760, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OCLUIDINA ZO-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OLIG1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO 4-HIDROXINONENAL 12F7 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 29112, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALOX15B/15-LOX-2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 35800, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CCM2/MGC4607 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CYR61 HL2144 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO DMT1 POLICLONAL PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FERROPORTINA 1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 27200, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO RECEPTOR ADRENERGICO BETA-1 C3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SSTR2A 11H21L13 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 57680, "currency": "MXN" } } }, { "id": "0", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38% PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8083.92, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EV-CAD PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CCM1/KRIT1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30960, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CCM3/PDCD10 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 38520, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MEKK3-KLF2/4 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28728, "currency": "MXN" } } }, { "id": "0", "description": "4-NITROPHENYL PHOSPHATE DISODIUM SALT HEXAHYDRATE 5 MG CAJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 228.8, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO ACETICO (JT BAKER) FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 863.2, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE FOSFATOS PARA WRIGHT DE 7.4 (MERK) SIN COLOR FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2795.2, "currency": "MXN" } } }, { "id": "0", "description": "NUEVO AZUL DE METILO FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 956.8, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION YODO LUGOL PARA COPROPARASITOSCOPICO FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2305.2, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA EN ENVASE DE PLÁSTICO. FRASCO 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 228.8, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO EN ROLLO DE 50 CM. X 15 MTS. ROLLO", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2460, "currency": "MXN" } } }, { "id": "0", "description": "SOBRES GENERADORES DE ANAEROBIOSIS SISTEMA BOLSA CON INDICADOR CAJA C/20 SOBRES", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3267.2, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA COCENTRICA DESECHABLE MONOPOLAR PARA ELECTROMIOGRAFÍA CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO M-902-DMG-75. PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA. CAJA CON 24 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 5960, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. PARA ESTUDIOS PSG CON CONECTOR DE BROCHE. NECESARIO MUESTRA FISICA BOLSA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 70, "unit": { "name": "PIEZA", "value": { "amount": 750, "currency": "MXN" } } }, { "id": "0", "description": "MODULO DE CONTROL ZRIP DESECHABLE PARA ESTUDIOS DE PSG. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 43820, "currency": "MXN" } } }, { "id": "0", "description": "PIEDRA PARA AFILAR, RECTANGULAR, CON UN LADO POROSO Y OTRO LISO, DE APROXIMADAMENTE 15 X 5 CM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 303, "currency": "MXN" } } }, { "id": "0", "description": "PIEZA FACIAL DE MEDIA CARA 3M MODELO 6100/07024 PARA FILTRO 3M MOD. 07024 PROPIEDAD DEL INNN PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0082" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 734.4, "currency": "MXN" } } }, { "id": "0", "description": "ACCESO CERRADO LUER CON TECNOLOGIA SPLIT SEPTUM PARA TOMA DE CURVAS DE INSULINA Y HORMONA DE CRECIMIENTO. CAJA", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 14880, "currency": "MXN" } } }, { "id": "0", "description": "ACEITE DE INMERSION EN BOTELLA AMBAR BOTELLA", "classification": { "scheme": "CUCOP", "id": "25501-0059" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1100.8, "currency": "MXN" } } }, { "id": "0", "description": "AGITADOR MAGNETICO DE COLORES (BARRA MAGNETICA) DE 10 X 3 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 305.6, "currency": "MXN" } } }, { "id": "0", "description": "AGITADORES DE VIDRIO 6.4MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 38.4, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 21G X 1 \" ( 0.8 MM X 25 MM) COLOR VERDE CAJA", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 566.4, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 22G X 1 \" ( 0.7 MM X 25 MM ) COLOR NEGRO CAJA", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 48, "unit": { "name": "PIEZA", "value": { "amount": 889.6, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, ESTERIL Y DESECHABLE DE 22G X 1.5 \" ( 0.7 X 38 MM ) COLOR NEGRO CAJA CON 50 AGUJAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 512, "currency": "MXN" } } }, { "id": "0", "description": "AGUJAS PARA TOMA DE MUESTRAS SANGRE AL VACÍO 21 G X 38 MM (VERDE) CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 240, "unit": { "name": "PIEZA", "value": { "amount": 478.4, "currency": "MXN" } } }, { "id": "0", "description": "BASES PLASTICAS PARA LAS AGUJAS DE TOMA DE MUESTRA SANGUINEA AL VACIO (DE LA MISMA MARCA DE LAS AGUJAS) BOLSA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 36, "unit": { "name": "PIEZA", "value": { "amount": 649.6, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO SENCILLO DE VIDRIO DE 1 LITRO DE CAPACIDAD PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 324.8, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLONES PARA PROBETAS DE 2000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 94.4, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO AMBAR (FRASCO DE PLASTICO AMBAR, PARA MANTENER LA INTEGRIDAD DE LOS METABOLITOS SENCIBLES A LA LUZ, CON ESCALA DE GRADUACION QUE PERMITE MEDIR EL VOLUMEN DE LA ORINA REDUCIENDO EL RIESGO DE EXPOSICION. CON TAPA HERMETICA QUE EVITA RIESGO DE FUGAS Y CONTAMINACION Y ADAPTADOR DE TRANSFERENCIA INTEGRADO PARA LA RECOLECCION DE ORINA DE 24HRS VOL 3LTS PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0018" }, "quantity": 912, "unit": { "name": "PIEZA", "value": { "amount": 98, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 500 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 472, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS KELLY PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 210, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS PASTEUR DE PLASTICO DE 1.5 ML REF. 200003.C BOLSA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 24, "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "PORTATUBOS CON ADAPTADOR PARA EXTRACCION MULTIPLE PREMONTADO LUER LOCK PARA TOMA DE CURVAS DE INSULINA Y HORMONA DE CRECIMIENTO. CAJA/200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 3507.2, "currency": "MXN" } } }, { "id": "0", "description": "TAPA PARA TUBO CONICO PARA EGO CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 27918, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO CON ANTICOAGULANTE CITRATO (TAPÓN AZUL) 2.7 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ALTIPLANO MEXICANO. GRADILLA CON 100", "classification": { "scheme": "CUCOP", "id": "25501-0048" }, "quantity": 183, "unit": { "name": "PIEZA", "value": { "amount": 593.6, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO CON ANTICOAGULANTE EDTA (TAPÓN LILA) 4 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ANTIPLANO MEXICANO. GRADILLA CON 100", "classification": { "scheme": "CUCOP", "id": "25501-0048" }, "quantity": 363, "unit": { "name": "PIEZA", "value": { "amount": 416, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE, CON GEL SEPARADOR, CON ACTIVADOR DE LA COAGULACIÓN Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 5 ML. GRADILLA", "classification": { "scheme": "CUCOP", "id": "25501-0048" }, "quantity": 255, "unit": { "name": "PIEZA", "value": { "amount": 561.6, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ROJO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. GRADILLA", "classification": { "scheme": "CUCOP", "id": "25501-0048" }, "quantity": 300, "unit": { "name": "PIEZA", "value": { "amount": 411.2, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CONICO PARA EGO DE 12 ML MARCA KOVA CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 27918, "currency": "MXN" } } }, { "id": "0", "description": "MANGO DE LARINGOSCOPIO DE FIBRA OPTICA ILUMINACION HALOGENA CON HOJA CURVA # 3 PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 9000, "currency": "MXN" } } }, { "id": "0", "description": "MANGO DE LARINGOSCOPIO DE FIBRA OPTICA ILUMINACION HALOGENA CON HOJA CURVA # 4 PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 9000, "currency": "MXN" } } }, { "id": "0", "description": "CONOS PARA OTOSCOPIO MCA. WELCH ALLYN 4.25 MM SINGLE-USE, ADULT TIP, REF 52434-U CAJA CON 25 PAQUETES C/ 34 PZAS C/U CAJA C/ 25 PAQUETES DE 34 PIEZAS C/U", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1556.8, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326A (AUDIFONOS DE INSERCIÓN) SOBRE CON 20", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19800, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326B (AUDIFONOS DE INSERCIÓN) SOBRE CON 20", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19800, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 A. (AUDIFONOS DE INSERCIÓN) SOBRE CON 50", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 16, "unit": { "name": "PIEZA", "value": { "amount": 8782, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 B. (AUDIFONOS DE INSERCIÓN) SOBRE CON 50", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 9782, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. ELECTRODOS CONDUCTORES ADHESIVOS PARA EGK KENDAL MEDI-TRACE 100. EQUIPO PROPIEDAD DEL INNN SOBRE CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 36, "unit": { "name": "PIEZA", "value": { "amount": 925, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS TIMPÁNICO PARA ELECTROCOCLEOGRAFÍA N° PARTE 8049550 PARA EQUIPO PARA EQUIPO ECLIPSE PROPIEDAD DEL INNN SOBRE CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 225000, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO INTERACUSTIC. MOD. AT 235, MED. 7, 8, 9.5, 11, 12.5, 14, 16 MM. CAT. BET25 KIT", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 17800, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO MARCA MADSEN, MOD. ZODIAC 901 EQUIPO PROPIEDAD DEL INNN CAT. 8-69-29601 KIT", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 17800, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PARA EQUIPO INTERACOUSTIC AT 235 PROPIEDAD DEL INNN REF 1011002 EN ROLLO ROLLO", "classification": { "scheme": "CUCOP", "id": "25501-0302" }, "quantity": 25, "unit": { "name": "PIEZA", "value": { "amount": 5655, "currency": "MXN" } } }, { "id": "0", "description": "PINZA CAIMÁN DE OIDO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 1980, "currency": "MXN" } } }, { "id": "0", "description": "SET DE ELECTRODOS SUBDERMICOS DE DOS CANALES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL EQUIPO PROPIEDAD DEL INNN SET", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 36, "unit": { "name": "PIEZA", "value": { "amount": 24806, "currency": "MXN" } } }, { "id": "0", "description": "CABLE DE ELECTRODOS ESTANDAR ETB CON BOTONES #80428801 PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12800, "currency": "MXN" } } }, { "id": "0", "description": "CABLE DE ELECTRODOS PARA TIP TRODES ETT #80428201 PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12800, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELECTRODOS SUPERFICIALES DE ALMOHADILLA ETSE #80429501 KIT", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 32600, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESTILADA PORRÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "quantity": 48, "unit": { "name": "PIEZA", "value": { "amount": 268, "currency": "MXN" } } }, { "id": "0", "description": "BAYTRIL 0.5% SOLUCIÓN INYECTABLE FRASCO", "classification": { "scheme": "CUCOP", "id": "23501-0007" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1380, "currency": "MXN" } } }, { "id": "0", "description": "BENZATINA BENCILPENICILINA, 1,200,000U ÁMPULA CON POLVO Y AMPOLLETA CON 3.0 DE DILUYENTE", "classification": { "scheme": "CUCOP", "id": "25301-0330" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 286, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE BENZALCONIO AL 80% FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25301-3738" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1098, "currency": "MXN" } } }, { "id": "0", "description": "DISULFIRAM FRASCO 50 GR", "classification": { "scheme": "CUCOP", "id": "23501-0004" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26400, "currency": "MXN" } } }, { "id": "0", "description": "ENROFLOXACINA 50 MG FRASCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 28720, "currency": "MXN" } } }, { "id": "0", "description": "ERITROPOYETINA HUMANA RECOMBINANTE 2000 UI/ML SOLUCIÓN INYECTABLE FRASCO 1 ML", "classification": { "scheme": "CUCOP", "id": "25301-0826" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 4182, "currency": "MXN" } } }, { "id": "0", "description": "GENTAMICINA 100 MG/ML FRASCO 20 ML", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 824, "currency": "MXN" } } }, { "id": "0", "description": "IODOPOVIDONA SOLUCIÓN AL 8% FRASCO 950 ML", "classification": { "scheme": "CUCOP", "id": "25401-4550" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 448, "currency": "MXN" } } }, { "id": "0", "description": "ISOFLUORANO FRASCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25301-1235" }, "quantity": 26, "unit": { "name": "PIEZA", "value": { "amount": 4785, "currency": "MXN" } } }, { "id": "0", "description": "ISOFLURANO 100% INHALACIÓN FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25301-1235" }, "quantity": 24, "unit": { "name": "PIEZA", "value": { "amount": 4143, "currency": "MXN" } } }, { "id": "0", "description": "MARIPOSAS PARA TOMA DE MUESTRA NO. 21 CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6107" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 9382.4, "currency": "MXN" } } }, { "id": "0", "description": "PENTOBARBITAL SÓDICO FRASCO 100 ML 63 MG/ML", "classification": { "scheme": "CUCOP", "id": "23501-0007" }, "quantity": 26, "unit": { "name": "PIEZA", "value": { "amount": 2319, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE KANAMICINA, POLVO, PUREZA MAYOR AL 98% FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25301-1260" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 32240, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA DE ÁCIDO POLIGLICÓLICO (POLIGLACTINA 910), TRENZADA, CALIBRE 3/0, AGUJA DE 1/2 CÍRCULO AHUSADA DE 36.4 MM (MH), HEBRA DE 70 CM CAJA 24 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0475" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 19746, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE VIDRIO CON ANTICOAGULANTE ACD CON TAPÓN AMARILLO PARA TOMA DE MUESTRA SANGUÍNEA. ESTOS TUBOS ESTÉRILES CONTIENEN SOLUCIÓN A O B DE CITRATO TRISÓDICO, ÁCIDO CÍTRICO Y DEXTROSA (ACD) PARA DETERMINACIONES DE BANCO DE SANGRE EN SANGRE TOTAL COMO FENOTIPO HLA, PRUEBAS DE HISTOCOMPATIBILIDAD, ADEMÁS DE PRUEBAS DE ADN Y PATERNIDAD. LOS TUBOS SOLICITADOS SE PRESENTAN EN DIMENSIONES: 16 X 125MM. CON ADECUADO VOLUMEN DE DRENADO Y VACÍO DE EXTRACCIÓN PARA LAS DIFERENTES NECESIDADES DE EXTRACCIÓN DE SANGRE DEL LABORATORIO. PRESENTACIÓN DE 100 TUBOS. CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8010" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 16864, "currency": "MXN" } } }, { "id": "0", "description": "ANTI BDNF HECHO EN RATÓN VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 29088, "currency": "MXN" } } }, { "id": "0", "description": "ANTI IBA-1 HECHO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 25984, "currency": "MXN" } } }, { "id": "0", "description": "ANTI RECEPTOR ITPR3 INOSITOL 1,4,5 TRIFOSFATO PRODUCIDO EN CONEJO VIAL 1ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 25984, "currency": "MXN" } } }, { "id": "0", "description": "ANTI RECEPTOR NMDA 2A HECHO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19328, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-KCHIP1 MONOCLONAL AB VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 27936, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-NEUN CLONA A60, PRODUCIDO EN RATÓN. DIRIGIDO A NEUN DE RATA Y RATÓN, PARA CONGELACIÓN Y PARAFINA VIAL 500 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 22982.4, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN PARA DETECCIÓN DE RNAM DEL GEN KLOTHO EN RATÓN SONDA FAM VIAL 750 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25401-5747" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 22688, "currency": "MXN" } } }, { "id": "0", "description": "EXONUCLEASA T (EXONUCLEASE T) 3000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 43814.4, "currency": "MXN" } } }, { "id": "0", "description": "GLICEROL FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1408.16, "currency": "MXN" } } }, { "id": "0", "description": "INHBIDOR DE TRPM4 (CBA) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30960, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR SELECTIVO DE IKK BETA (TPCA-1) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 36836, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR SELECTIVO DE JNK (SP 600125) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 25920, "currency": "MXN" } } }, { "id": "0", "description": "INHIBITOR SELECTIVO DE ERK (FR 180204) VIAL 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 35680, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DE LISIS CELULAR PARA EXTRACCION DE DNA FCO 1L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13040, "currency": "MXN" } } }, { "id": "0", "description": "X-TREME GENE 9 DNA TRANSFECTION REAGENT VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 40320, "currency": "MXN" } } }, { "id": "0", "description": "BACKGROUND SNIPER FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 26000, "currency": "MXN" } } }, { "id": "0", "description": "PARAFORMALDEHÍDO FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25501-0083" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5372, "currency": "MXN" } } }, { "id": "0", "description": "POLVO DE HÍGADO DE COBAYO FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25401-7968" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 27214, "currency": "MXN" } } }, { "id": "0", "description": "RESINA HIDROFÍLICA LÍQUIDA, GRADO MEDIO PARA INCLUSIÓN DE TEJIDOS PARA MICROSCOPÍA ELECTRÓNICA (LR-WHITE) BOTELLA 500 ML", "classification": { "scheme": "CUCOP", "id": "25401-7114" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18020, "currency": "MXN" } } }, { "id": "0", "description": "RESINA SINTETICA FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25401-7930" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2710.4, "currency": "MXN" } } }, { "id": "0", "description": "DNA-LADDER PARA DETECTAR APOTOSIS KIT 50 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30240, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE CLONACIÓN POR ENSAMBLADO DE GIBSON (GIBSON ASSEMBLY CLONING KIT) 50 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 84800, "currency": "MXN" } } }, { "id": "0", "description": "N-ARAQUIDONOIL-SEROTONINA FRASCO 10 MG", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 48900, "currency": "MXN" } } }, { "id": "0", "description": "SAMPLE BUFFER FOR SDS-PAGE FRASCO 30 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6560, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 200 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6323" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 450, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 5 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 13, "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "MOLDE DE SILICÓN OPACO PARA INCLUSIÓN EN PLANO EN RESINA EPÓXICA PARA MICROSCOPÍA ELECTRÓNICA. MOLDE PARA 21 BLOQUES (21 POZOS) DE 5MM X 12MM X 4MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 750, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE VIDRIO DELGADA PARA PREPARACIÓN DE GELES DE ACRILAMIDA VERTICALES DE 10 CM X 7.3 CM CAJA 5 VIDRIOS", "classification": { "scheme": "CUCOP", "id": "25401-6632" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS RECUBIERTOS CON POLY-D-LISINA CAJA 72 PORTAOBJETOS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2019.6, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA DE TEJIDO EMBEBIDO EN PARAFINA KIT PARA 50PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 3515.31, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE RNA DE TEJIDO EMBEBIDO EN PARAFINA KIT PARA 50PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3515.31, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 50 PB EN ESCALERA DE 50 PB VIAL CON 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1643.44, "currency": "MXN" } } }, { "id": "0", "description": "APO-BRDU™ KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11474.65, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BAMHI (BAMHI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 534.63, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN ECORV (ECORV RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 773.04, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HINFI VIAL 2500 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 680.83, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA DNA, DE 500 PARES DE BASES VIAL 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1400.38, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR, ESCALERA DE 50 PB VIAL 150 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1643.44, "currency": "MXN" } } }, { "id": "0", "description": "MASTER MIX 2X DE POLIMERASA DE ALTA FIDELIDAD (HIGH-FIDELITY 2X DNA POLIMERASE MASTER MIX) 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1496.9, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA DE PCR DE ALTA FIDELIDAD 2X, (HIGH-FIDELITY 2X DNA POLIMERASE MASTER MIX), LÍQUIDO VIAL 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1496.9, "currency": "MXN" } } }, { "id": "0", "description": "PROTEINASA K SOLUTION (100 MG) VIAL 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 998.99, "currency": "MXN" } } }, { "id": "0", "description": "RNASA GRADO BIOLOGÍA MOLECULAR VIAL 50 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 640.79, "currency": "MXN" } } }, { "id": "0", "description": "TRANSCRIPTASA INVERSA, LÍQUIDO A 200 U/µL VIAL 10,000 UNIDADES (10,000 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1525.15, "currency": "MXN" } } }, { "id": "0", "description": "TRIZOL, LÍQUIDO FRASCO 200 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 5427.4, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO DMEM-F12, TAMPÓN HEPES, CON L-GLUTAMINA, ROJO FENOL, 10 L, EN POLVO FRASCO PARA 10 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1575.99, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO DMEM, ALTA GLUCOSA CON L-GLUTAMINA, SIN BICARBONATO DE SODIO, SIN PIRUVATO DE SODIO Y CON ROJO DE FENOL, NO ESTÉRIL SOBRES PARA PREPARAR UN VOLUMEN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 759.749, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO DMEM, ALTO CONTENIDO EN GLUCOSA, PIRUVATO, POLVO ESTÉRIL EN SOBRES SOBRES 10X1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 759.75, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE TINCIÓN ANEXINA V-FITC PARA DETECCIÓN DE MUERTE CELULAR POR CITOMETRÍA DE FLUJO (50 ENSAYOS) KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6158.24, "currency": "MXN" } } }, { "id": "0", "description": "MITOTRACKER RED VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8861.97, "currency": "MXN" } } }, { "id": "0", "description": "TUNEL- BRDU-RED PARA DETECTAR APOPTOSIS KIT 60 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11474.655, "currency": "MXN" } } }, { "id": "0", "description": "BETA MERCAPTOETANOL, GRADO BIOLOGÍA MOLECULAR FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 962.94, "currency": "MXN" } } }, { "id": "0", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS DE 10 A 180 KDA (MARCADOR DE PESO MOLECULAR) PARA SU USO EN GELES DE POLIACRILAMIDA. PAQUETE 10 TUBOS DE 250 µL", "classification": { "scheme": "CUCOP", "id": "25401-7850" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2188.87, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR DE PROTEASAS COCTAIL FRASCO 5 ML", "classification": { "scheme": "CUCOP", "id": "25901-0472" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 8576.54, "currency": "MXN" } } }, { "id": "0", "description": "SUSTRATO QUIMIOLUMINISCENTE (HRP) CAJA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1997.48, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL AL 70% PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 3100, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL AL 96% PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 925, "currency": "MXN" } } }, { "id": "0", "description": "HEMATOXILINA DE HARRIS LIBRE DE OXIDO DE MERCURIO ROJO, LISTA PARA USARSE FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 1020, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE PLATA FRASCO CON 250 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 12460, "currency": "MXN" } } }, { "id": "0", "description": "XILOL PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 4100, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE CRESIL BRILLANTE AL 1% BOTELLA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 593, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE STERNHEIMER-MALBIN COL. PARA SEDIMENTO URINARIO. FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 105, "currency": "MXN" } } }, { "id": "0", "description": "DEXTROSOL SOLUCION GLUCOSADA 75 G EN 250 ML. FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 300, "unit": { "name": "PIEZA", "value": { "amount": 113, "currency": "MXN" } } }, { "id": "0", "description": "LÁPICES CON PUNTA DIAMANTE PARA ROTULAR PORTAOBJETOS RETRACTILES PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0104" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 275, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA MULTICANAL DE 8 CANALES, CON VOLUMEN 50-300 MICROL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7125, "currency": "MXN" } } }, { "id": "0", "description": "LÁPICES CON PUNTA DIAMANTE PARA ROTULAR PORTAOBJETOS RETRACTILES PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0104" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "MOLDES DE ACERO INOXIDABLE PARA UNICASETS Y SISTEMAS DE PROCESAMIENTO DE TEJIDOS DE 15X15X5 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 24, "unit": { "name": "PIEZA", "value": { "amount": 134.265, "currency": "MXN" } } }, { "id": "0", "description": "CAMARA DE FUSCH ROSENTHAL CUADRICULA DOBLE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 24, "unit": { "name": "PIEZA", "value": { "amount": 1685, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBO DE WINTROBE CON NIVEL DE BURBUJA Y TORNILLOS PARA AJUSTE DE NIVEL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6128, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 2000 ML, VIDRIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 950, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PARAFILM 10.16 CM X 38 MTS PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 560, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL SEDA PARA LIMPIAR OBJETIVOS DE MICROSCOPIO DE 4 X 6 PULGADAS BLOCK", "classification": { "scheme": "CUCOP", "id": "25501-0298" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 65, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR CORTA CAJA CON 250 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 36, "unit": { "name": "PIEZA", "value": { "amount": 265, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR LARGA CAJA CON 250 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 72, "unit": { "name": "PIEZA", "value": { "amount": 360, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 10 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 12 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "quantity": 240, "unit": { "name": "PIEZA", "value": { "amount": 165, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO VIDRIO SIN LABIO FONDO EN U, 13 X 100 MM, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0047" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 230, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE POLIESTIRENO DE 5 ML TRANSPARENTE DE (13 X 75 MM) CON TAPON BOLSA C/1000 BOLSA CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 1635, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ACÉTICO 99% FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7662" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 537, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBIÓTICO-ANTIMICÓTICO SOL. 100X, ESTÉRIL (PENICILINA G, ESTREPTOMICINA, ANFOTERICINA B) FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 26, "unit": { "name": "PIEZA", "value": { "amount": 625, "currency": "MXN" } } }, { "id": "0", "description": "LÍNEA CELULAR HBEC-5I CRL.3245, CÉLULAS ENDOTELIALES DE LA VASCULATURA CEREBRAL, LIBRES DE MICOPLASMA VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 39636.19, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO DULBECCOS CON ALTA GLUCOSA Y PIRUVATO CAJA 10 FRASCOS PARA 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 754, "currency": "MXN" } } }, { "id": "0", "description": "PENICILINA-ESTREPTOMICINA-GLUTAMINA (100X), LÍQUIDO, ESTÉRIL FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 509.99, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN ESTÉRIL 0.1% DE GELATINA PARA CULTIVO CELULAR, LIBRE DE ENDOTOXINA BOTELLA 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 455, "currency": "MXN" } } }, { "id": "0", "description": "TRIPSINA DE PÁNCREAS DE PORCINO 10X, ESTÉRIL FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 600, "currency": "MXN" } } }, { "id": "0", "description": "DETERGENTE ALCALINO CONCENTRADO LÍQUIDO PH 12 FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-6309" }, "quantity": 18, "unit": { "name": "PIEZA", "value": { "amount": 354, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE MONTAJE ANTIDECOLORACIÓN CON DAPI FRASCO 10 ML", "classification": { "scheme": "CUCOP", "id": "25401-7930" }, "quantity": 13, "unit": { "name": "PIEZA", "value": { "amount": 1050, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE PLATA (PUREZA MAYOR A 99%) FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25401-7636" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1440, "currency": "MXN" } } }, { "id": "0", "description": "SH-SY5Y CRL-2266 VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25401-6019" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 33142.12, "currency": "MXN" } } }, { "id": "0", "description": "SUERO DE CABRA NORMAL FRASCO 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 9, "unit": { "name": "PIEZA", "value": { "amount": 837.5, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE ZINC CRISTALES DIHIDRATADO, REACTIVO ANALÍTICO (PUREZA MAYOR A 99.95%) BOTE 2.5 KG", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "SAL TETRASÓDICA HIDRATO DE ÁCIDO ETILENDIAMINOTETRAACÉTICO (EDTA), PUREZA MAYOR AL 99% FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-6728" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3450, "currency": "MXN" } } }, { "id": "0", "description": "ACETONITRILO GRADO HPLC GALÓN", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 1320, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ETÍLICO, GRADO BIOLOGÍA MOLECULAR FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7794" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 1420, "currency": "MXN" } } }, { "id": "0", "description": "DIMETIL SULFÓXIDO, PUREZA 99% FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7557" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1985, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ANHIDRO FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7606" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1450, "currency": "MXN" } } }, { "id": "0", "description": "METANOL FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7724" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 594.54, "currency": "MXN" } } }, { "id": "0", "description": "ALBÚMINA SÉRICA BOVINA, POLVO LIOFILIZADO FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25401-7847" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4820, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE TIAZOLIL BROMURO DE TETRAZOLIO (MTT) FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25401-7894" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 1780, "currency": "MXN" } } }, { "id": "0", "description": "CAJA/RACK CON PUNTAS AMARILLAS PARA MICROPIPETA VOLUMEN DE 20 A 200 MICROLITROS, AUTOCLAVABLES, LIBRES DE PIRÓGENOS RACK 96 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6675" }, "quantity": 75, "unit": { "name": "PIEZA", "value": { "amount": 50.5, "currency": "MXN" } } }, { "id": "0", "description": "CAJA/RACK CON PUNTAS AZULES PARA MICROPIPETA VOLUMEN DE 100 A 1000 MICROLITROS, AUTOCLAVABLES, LIBRES DE PIRÓGENOS RACK 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6675" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 73, "currency": "MXN" } } }, { "id": "0", "description": "CÁMARA DE 8 POZOS DE VIDRIO PARA CULTIVO CELULAR, ESTÉRILES, CON TAPA CAJA 96 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8544, "currency": "MXN" } } }, { "id": "0", "description": "CÁMARA DE 8 POZOS DE VIDRIO, ESTÉRILES CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1070, "currency": "MXN" } } }, { "id": "0", "description": "CÁMARA PORTA-OBJETO (VIDRIO), PARA CULTIVO CELULAR DE 8 POZOS; VOLUMEN DE 0.2 A 0.7 ML; ESTÉRIL CAJA 96 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8544, "currency": "MXN" } } }, { "id": "0", "description": "CRIOCAJA DE CARTÓN PARA ALMACENAR TUBOS EN NITRÓGENO LÍQUIDO CON DIVISOR PARA 100 LUGARES PAQUETE 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "DESECANTE DRIERITE CON INDICADOR, EL COLOR VIRA DE AZUL A ROSA FRASCO 450 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3680, "currency": "MXN" } } }, { "id": "0", "description": "DRIERITE - 1 POUND REFILL BOTTLE PERLAS DESECADORAS PARA ESTIRADOR DE PIPETAS BOTE", "classification": { "scheme": "CUCOP", "id": "25401-6038" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 998, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO DE FILTRACIÓN DE 300 ML, DE VIDRIO, BOROSILICATO CON FILTRO DE TAMAÑO DE PORO DE 47 MM, CON AGARRADERA DE ACERO INOXIDABLE Y MATRAZ COLECTOR DE 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 15800, "currency": "MXN" } } }, { "id": "0", "description": "ETIQUETAS PARA MICROTUBOS, DE POLIOLEFINA FLEXIBLE Y ADHESIVO ACRÍLICO FB215 B 2.1X5 MM ROLLO 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS DE PVDF CON PORO DE 0.22 MICRAS DE 30 MM ESTÉRILES PARA JERINGA PAQUETE 30 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6267" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5774.18, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOROSILICATO CON TAPÓN DE ROSCA AZUL 1000 ML, AUTOCLAVEABLES PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 170, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO BOCA ANCHA PARA MEDIO DE CULTIVO DE 100 ML, AUTOCLAVABLE PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 97, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO BOCA ANCHA PARA MEDIO DE CULTIVO DE 1000 ML, AUTOCLAVABLE PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 170, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO BOCA ANCHA PARA MEDIO DE CULTIVO DE 500 ML, AUTOCLAVABLE PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 31, "unit": { "name": "PIEZA", "value": { "amount": 125, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO DE BOROSILICATO DE 1L, GRADUADO, CON TAPA DE ROSCA DE POLIPROPILENO PARA MEDIO DE CULTIVO PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 170, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO DE BOROSILICATO DE 500 ML, GRADUADO, CON TAPA DE ROSCA DE POLIPROPILENO PARA MEDIO DE CULTIVO PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 125, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO PARA CULTIVO CELULAR DE 25 CM2, ESTÉRILES Y DE POLIESTIRENO, TAPA VENTILADA CON FILTRO 0.22MICRAS, BOCA INCLINADA CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0138" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 10117.5, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO PARA CULTIVO CELULAR DE 75 CM2, ESTÉRILES Y DE POLIESTIRENO, TAPA VENTILADA CON FILTRO CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0138" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1251, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO PARA CULTIVO CELULAR DE 75 CM2, ESTÉRILES Y DE POLIESTIRENO, TAPA VENTILADA CON FILTRO 0.22 MICRAS, BOCA INCLINADA CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0138" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 12510, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENIZADOR DE VIDRIO PARA TEJIDOS DE 10 ML (15X150 MM). LARGO TOTAL 270 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4035, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENIZADOR DE VIDRIO PARA TEJIDOS DE 5 ML (12X135 MM). LARGO TOTAL 235 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3185, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ KITASATO 1 L PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0268" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1550, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO \"A\" DE VIDRIO CON TAPÓN DE 1 ML, SIN BASE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO \"A\" DE VIDRIO CON TAPÓN DE 2 ML, SIN BASE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 355, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 10 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 365, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 2 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 357, "currency": "MXN" } } }, { "id": "0", "description": "MATRIZ DE ACRÍLICO PARA CEREBRO DE RATA, CORTES DE 1 MM, CORONAL Y SAGITAL PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6334" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 14994, "currency": "MXN" } } }, { "id": "0", "description": "MICROJERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACIÓN DE 1 MICROLITRO, PUNTA BISELADA PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6289" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4381.28, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACA DE 96 POZOS, MEDIA ÁREA ESTÉRIL, NEGRA, FONDO TRANSPARENTE PAQUETE 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5870, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACA DE 96 POZOS, MEDIA ÁREA, ESTÉRIL, TRANSPARENTE, LIBRE DE PIRÓGENOS PARA ELISA CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1311.5, "currency": "MXN" } } }, { "id": "0", "description": "MINIBOMBAS OSMÓTICAS DE INFUSIÓN A 0.25 MICROLITROS POR HORA PAQUETE CON 10 BOMBAS", "classification": { "scheme": "CUCOP", "id": "25401-0574" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 19682.58, "currency": "MXN" } } }, { "id": "0", "description": "MINIBOMBAS OSMÓTICAS DE INFUSIÓN A 0.5 MICROLITROS POR HORA PAQUETE CON 10 BOMBAS", "classification": { "scheme": "CUCOP", "id": "25401-0574" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 16371.72, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS DE TRANSFERENCIA DE POLIPROPILENO RESISTENTES A SOLVENTES CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 375, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE 12 TRANSWELL, 48 POZOS, CON INSERTOS DE 12MM, MEMBRANA DE POLIESTIRENO 3 µM PAQUETE 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2997, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CULTIVO DE 100 MM SUPERFICIE TRATADA PARA CULTIVO CELULAR; ESTÉRIL, LIBRESDE PIRÓGENOS CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4348, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CULTIVO DE 96 POZOS BLANCA CAJA 25 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1510, "currency": "MXN" } } }, { "id": "0", "description": "PLACA INDIVIDUAL DE 12 POZOS DE POLIESTIRENO, CON FONDO PLANO, PRECARGADAS, NO PIROGÉNICAS, ESTÉRILES, PARA CULTIVO CELULAR CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1531, "currency": "MXN" } } }, { "id": "0", "description": "PLACA INDIVIDUAL DE 24 POZOS DE POLIESTIRENO, CON FONDO PLANO, PRECARGADA, NO PIROGÉNICA, ESTÉRIL, PARA CULTIVO CELULAR CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2523, "currency": "MXN" } } }, { "id": "0", "description": "PLACA INDIVIDUAL DE 48 POZOS DE POLIESTIRENO, CON FONDO PLANO, PRECARGADA, NO PIROGÉNICA, ESTÉRIL, PARA CULTIVO CELULAR CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4683, "currency": "MXN" } } }, { "id": "0", "description": "PLACA INDIVIDUAL DE 6 POZOS DE POLIESTIRENO, CON FONDO PLANO, PRECARGADAS, NO PIROGÉNICAS, ESTÉRILES, PARA CULTIVO CELULAR, CON TAPA CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2611, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE FILTRACIÓN COMPLETO DE VIDRIO BOROSILICATO SARTORIUS. ENTREGADA COMPLETA CON:\n• FRASCO 1 LITRO DE VIDRIO BOROSILICATO\n• BASE Y EMBUDO DE VIDRIO BOROSILICATO\n• SOPORTE-FILTRO: DE VIDRIO, INCLUYENDO UN ANILLO PTFE Y 1 JUNTA TÓRICA VITON (45 X 3 MM)\n• 1 PINZA DE SUJECIÓN DE ALUMINIO ANODIZADO UNIDAD", "classification": { "scheme": "CUCOP", "id": "25401-6262" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 6628, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE FILTRACIÓN ESTÉRIL, DE 150 ML; MEMBRANA PES 0.22µM, CON CUELLO 45 MM DESECHABLE PAQUETE 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6262" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1105, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE FILTRACIÓN ESTÉRIL, DE 500 ML; MEMBRANA PES 0.22µM, CON CUELLO 45 MM DESECHABLE PAQUETE 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1359, "currency": "MXN" } } }, { "id": "0", "description": "SUCCIONADOR DE PIPETA CON EMBOLO PARA PIPETA DE 10 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6022" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 245, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE POLIESTIRENO ESTÉRIL DE 14 ML CON TAPA MAX RCF 1400XG, 17*100 MM PAQUETE 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8017" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1719, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE POLIESTIRENO ESTÉRIL DE 5 ML CON TAPA MAX RCF 1400XG, 12*75MM PAQUETE 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8017" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1259, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN 500 ML DE POLISULFONA CON UNIDAD RECEPTORA DE 1000 ML REUSABLE 47 MM, AUTOCLAVEABLE UNIDAD", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4561.02, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN AUTOCLAVABLE DE POLISULFONA COMPLETA, CON RECEPTOR DE VOLUMEN 500 ML POR UNIDAD UNIDAD", "classification": { "scheme": "CUCOP", "id": "25401-6267" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7186.51, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN CON RECIPIENTE DE POLIESTIRENO, FILTRO DE TAMAÑO DE PORO DE 0.22 MICRAS, DE VOLUMEN DE 1 L, ESTÉRIL CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6267" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 2751, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN DESECHABLE DE 500 ML, DE PORO 0.22 µM, CON ADAPTADOR PARA VACÍO, ESTÉRIL, CON TAPA Y RESERVORIO GRADUADO. EMPAQUETADO INDIVIDUALMENTE, LIBRE DE PIRÓGENOS CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1729, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN POR VACÍO DE PLÁSTICO ESTÉRIL DE 0.22 MICRAS DE 500 ML CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6263" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1770, "currency": "MXN" } } }, { "id": "0", "description": "PENICILINA 10 UNIDADES SENSIDISCOS CAJA C/10 CARTUCHOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2291, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 4 SIN COLOR FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1960, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 7 SIN COLOR FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1960, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO KAÍNICO FRASCO 50 MG", "classification": { "scheme": "CUCOP", "id": "23501-0007" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 13895, "currency": "MXN" } } }, { "id": "0", "description": "BDTX-1535 25 MG", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11869, "currency": "MXN" } } }, { "id": "0", "description": "ELCUBRAGISTAT (SINONIMO: ABX-1431) 100 MG", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13271, "currency": "MXN" } } }, { "id": "0", "description": "LIPOPOLISACÁRIDO DE E. COLI FRASCO 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11275, "currency": "MXN" } } }, { "id": "0", "description": "PENTILENTETRAZOL FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3309, "currency": "MXN" } } }, { "id": "0", "description": "ANTI IL-1 BETHA VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13820, "currency": "MXN" } } }, { "id": "0", "description": "ANTI MAP-2 PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11295, "currency": "MXN" } } }, { "id": "0", "description": "ANTI PKC-DELTA AB (14/PKCDELTA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9250, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CD3 ACOPLADO A ALEXA FLUOR 488, PRODUCIDO EN RATÓN, PARA HUMANO VIAL 100 UG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7109, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CONEJO CONTRA EL CANAL DE POTASIO, SUBFAMILIA K, MIEMBRO 12 (KCNK12) VIAL 25 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7567, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CONEJO CONTRA EL RECEPTOR ÁCIDO ¿-AMINOBUTÍRICO (GABA) A VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9250, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CONEJO CONTRA EL RECEPTOR ÁCIDO ¿-AMINOBUTÍRICO (GABA) B VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10636, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-CD-274 (B7-H1, PD-L1) ACOPLADO A FICOERITRINA/CIANINA 7, PRODUCIDO EN RATA, PARA RATÓN VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7833, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-CD185 (CXCR5) ACOPLADO A MORADO BRILLANTE 605, PRODUCIDO EN RATA, PARA RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5768, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-CD63 ACOPLADO A MORADO BRILLANTE 711, PRODUCIDO EN RATÓN, PARA HUMANO VIAL 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11964, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATA ACOPLADO A FICOERITRINA (PE), DIRIGIDO CONTRA F4/80 DE HUMANO, RATON Y RATA PARA TECNICAS DE CITOMETRIA DE FLUJO (FCM) E INMUNOFLUORESCENCIA (IF) 100µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3783, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN DIRIGIDO CONTRA T-BET DE HUMANO, RATON Y RATA PARA TECNICAS DE WB, ICC/IF, IP, CHIP 100µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11492, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO CONTRA METTL3 HUMANA (HUMAN METTL3 RABBIT POLYCLONAL ANTIBODY) 100UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9250, "currency": "MXN" } } }, { "id": "0", "description": "PERLAS MAGNÉTICAS PARA SELECCIÓN DE DNA POR TAMAÑOS (SPRI MAGNETIC SIZE SELECTION BEADS) 10 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 16061, "currency": "MXN" } } }, { "id": "0", "description": "ELISA DELUXE SET IL-17A HUMANA, 5 PLACAS. KIT DE 5 PLACAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 9309, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA DE IL-5 PARA HUMANO (SENSIBILIDAD 2 PG/ML, RANGO DE DETECCIÓN 3.9-250 PG/ML) 5 PLACAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8182, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA DE IL-6 PARA HUMANO (SENSIBILIDAD 2 PG/ML, RANGO DE DETECCIÓN 3.9-250 PG/ML) 10 PLACAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11911, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PANEL DE INFLAMACIÓN HUMANA 1 (13 BLANCOS: IL-1ß, IFN-A2, IFN-¿, TNF-A, MCP-1 (CCL2), IL-6, IL-8 (CXCL8), IL-10, IL-12P70, IL-17A, IL-18, IL-23 Y IL-33.) CON PLACA CON FONDO EN V KIT 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 47239, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PANEL DE INFLAMACIÓN VASCULAR HUMANA 1-U (PARA 10 PROTEÍNAS: MIOGLOBINA, NGAL, CRP, MMP-2, MPO, SAA, IGFBP-4, ICAM-1, VCAM-1Y MMP-9) CON PLACA CON FONDO EN V, PARA HUMANO KIT 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 40935, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PANEL DE NEUROINFLAMACIÓN HUMANA 1 (13 BLANCOS: VILIP-1, CCL2 (MCP-1), STREM-2, BDNF, FREE ACTIVE TGF-ß1, VEGF, IL-6, STREM-1, ß-NGF, IL-18, TNF-A, SRAGE, CX3CL1 ) CON PLACA FILTRANTE KIT 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 47239, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PANEL DE RESPUESTA INMUNE ESENCIAL HU (13 BLANCOS: IL-4, IL-2, CXCL10 (IP-10), IL-1ß, TNF-A, CCL2 (MCP-1), IL-17A, IL-6, IL-10, IFN-¿, IL-12P70, CXCL8 (IL-8), Y TGF-ß1 LIBRE ACTIVO) CON CON PLACA CON FONDO EN V, PARA HUMANO KIT 100 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 47239, "currency": "MXN" } } }, { "id": "0", "description": "2', 7' DIACETILDICLOROFLUORESCEÍNA (DCFHDA) FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-6914" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 10581, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE TALIO FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "23501-0003" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6008, "currency": "MXN" } } }, { "id": "0", "description": "APOMORFINA\nR-(-)-APOMORPHINE\nHYDROCHLORIDE\nHEMIHYDRATE FRASCO 250 MG", "classification": { "scheme": "CUCOP", "id": "25301-3467" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3231, "currency": "MXN" } } }, { "id": "0", "description": "CESIUM METHANESULFONATE VIAL 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3595, "currency": "MXN" } } }, { "id": "0", "description": "CLORHIDRATO DE PIOGLITAZONA\nAGONISTA DE LOS RECEPTORES\nPPARS ESPECÍFICAMENTE\nPPARGAMMA FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25301-1723" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4295, "currency": "MXN" } } }, { "id": "0", "description": "CLORO (TRIFENILFOSFINA) DE ORO (I), PUREZA 99.9% FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5567, "currency": "MXN" } } }, { "id": "0", "description": "FTALOCIANINA DE ZINC, CONTENIDO EN COLORANTE 97% FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "24101-0176" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2531, "currency": "MXN" } } }, { "id": "0", "description": "GUANOSINE 5'-TRIPHOSPHATE SODIUM VIAL 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 19707, "currency": "MXN" } } }, { "id": "0", "description": "HC030031, ANTAGONISTA SELECTIVO DEL CANAL DE CATIONES DE POTENCIAL DE RECEPTOR TRANSITORIO SUBFAMILIA A, MIEMBRO 1 (TRPA1) VIAL 50 MG", "classification": { "scheme": "CUCOP", "id": "25901-0016" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 16023, "currency": "MXN" } } }, { "id": "0", "description": "INHIBIDOR CREB, 666-15 FRASCO 1 MG", "classification": { "scheme": "CUCOP", "id": "25401-7539" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2700, "currency": "MXN" } } }, { "id": "0", "description": "PEPSINA DE MUCOSA GÁSTRICA PORCINA FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25901-1085" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3491, "currency": "MXN" } } }, { "id": "0", "description": "ACETONITRILO, GRADO HPLC (PUREZA MAYOR A 99.9%) GARRAFÓN 19 L", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 53411, "currency": "MXN" } } }, { "id": "0", "description": "ARACHIDONYL-2'-CHLOROETHYLAMIDE HYDRATE (ACEA) FRASCO 25 MG", "classification": { "scheme": "CUCOP", "id": "25401-4619" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11067, "currency": "MXN" } } }, { "id": "0", "description": "AZD1480 FRASCO 5 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3698, "currency": "MXN" } } }, { "id": "0", "description": "CLORHIDRATO DE DOPAMINA FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-6869" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1882, "currency": "MXN" } } }, { "id": "0", "description": "CLORHIDRATO DE MECAMILAMINA FRASCO 25 MG", "classification": { "scheme": "CUCOP", "id": "25301-3231" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7383, "currency": "MXN" } } }, { "id": "0", "description": "D-SERINA (PUREZA MAYOR A 98%) FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25301-0169" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5670, "currency": "MXN" } } }, { "id": "0", "description": "L-ASCORBIC ACID FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-0050" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4010, "currency": "MXN" } } }, { "id": "0", "description": "TAURINA FRASCO 50 G", "classification": { "scheme": "CUCOP", "id": "25301-3541" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3205, "currency": "MXN" } } }, { "id": "0", "description": "THIOUREA FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1960, "currency": "MXN" } } }, { "id": "0", "description": "10X TRIS/GLYCINE/SDS. BIORAD. PKG OF 1, 1 L, 10X PREMIXED ELECTROPHORESIS BUFFER FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7392" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2411, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR PAP PEN (PLUMA) PARA INMUNOHISTOQUÍMICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 1950, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA PORRÓN 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE PETRI DESECHABLE ESTÉRIL DE 90 X 150 MM (MUESTRA FÍSICA) CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "quantity": 18, "unit": { "name": "PIEZA", "value": { "amount": 1650, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON DELGADO PARA PIPETA SEROLOGICA LARGO (14 A 16 CM) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 26, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA MATRAZ DE 2L PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 30, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE 2 LT PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 290, "currency": "MXN" } } }, { "id": "0", "description": "PINZA DE DISECCION PUNTA FINA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS PARA MICROSCOPIA DE 25 X 75 MM, BORDES LISOS SIN ESMERILADO. CAJA C/50 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 49, "currency": "MXN" } } }, { "id": "0", "description": "VERNIER DE ACERO INOXIDABLE, MICRÓMETRO DIGITAL CON VISUALIZACIÓN LCD GRANDE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 850, "currency": "MXN" } } }, { "id": "0", "description": "CHAIRA DE 30 CM DE LARGO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 15 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 29 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0011" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 1300, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE ALTO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 14 X 0.35 MM CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0106" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR CORTA CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 175, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR LARGA CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS CON PANTALLA ESMERILADA DE 75 MM X 25 MM CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 150, "unit": { "name": "PIEZA", "value": { "amount": 49, "currency": "MXN" } } }, { "id": "0", "description": "BULBOS PARA PIPETA PASTEUR PARA 2 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 2, "currency": "MXN" } } }, { "id": "0", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 100µL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 80, "currency": "MXN" } } }, { "id": "0", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 1000µL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "CUBRE HEMACÍMETRO/CUBRE OBJETOS 22 X 22 MM CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0109" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 30, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO DE PLASTICO 75 MM. DE DIAMETRO X 110 DE ALTURA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 65, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON CERDA NATURAL, PARA LAVADO DE MATERIAL DE LABORATORIO, ELABORADO DE CERDA NATURAL QUE NO RAYA, CON UN SOPORTE DE ALAMBRE GALVANIZADO O ACERO INOXIDABLE. ANILLO EN EL EXTREMO DEL MANGO PARA COLGAR, LONGITUD TOTAL 40 CM, DIÁMETRO DE BARRIDO 15CM, DIÁMETRO DE CEPILLO 5 CM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 90, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 10 X 75 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 100 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 75 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE PLASTICO CON TAPA DE ROSCA (PARA MUESTRAS DE ORINA), NO ESTERIL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0018" }, "quantity": 6000, "unit": { "name": "PIEZA", "value": { "amount": 2.9, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLAS DE PLASTICO DE 25 CM. DE LARGO X 10.5 CM. DE ANCHO X 5.5 CM. DE ALTO, PARA 90 TUBOS PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 175, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 1000 ML, VIDRIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0024" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 620, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO LISO, FILTRACIÓN MEDIA / RÁPIDA, GRUESO, CON RETENCIÓN DE PARTÍCULAS DE 8-10 MICRAS CAJA C/100 CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0098" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS AUTOMATICAS DE VOLUMEN VARIABLE DE 10 A 1000 µL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS AUTOMATICAS VOLUMEN VARIABLE 10 A 200 µL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE PLÁSTICO DE 500 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0068" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS PARA MICROSCOPIA, 25 X 75 MM, CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FÍSICA) CAJA CON 50 PIEZAS CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 240, "unit": { "name": "PIEZA", "value": { "amount": 40, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 720, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 250 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 370, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 50 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 210, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA PIPETAS AUTOMÁTICAS VOLUMEN 1 A 10 ML BOLSA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "ROLLO DE POLIETILENO TUBULAR DE USO PESADO DE 6 MIL - 8\" X 1,000'. ROLLO ROLLO", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4800, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO. VIDRIO. 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 39, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 250 ML DE VIDRIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 60, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "TERMOMETRO BIMETALICO MARCA TYLOR PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 450, "currency": "MXN" } } }, { "id": "0", "description": "TERMÓMETRO DE VARILLA PARA LABORATORIO CON RANGO DE TEMPERATURA DE -10°C A 150°C PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 190, "currency": "MXN" } } }, { "id": "0", "description": "PINZA BAYONETA CHICA PARA ORL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "PINZA BAYONETA GRANDE PARA ORL PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 360, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA PORRÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 380, "currency": "MXN" } } }, { "id": "0", "description": "CAMPO QUIRÚRGICO ADHESIVO CON FENESTRACIÓN DE 7.5 CM DE DIÁMETRO, HENDIDO 50X70CM CON ADHESIVO ESTÉRIL BOLSA 10 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "HOJA DE BISTURÍ NÚM. 15, ESTÉRIL CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8254" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 440, "currency": "MXN" } } }, { "id": "0", "description": "HOJA DE BISTURÍ NÚM. 20, ESTÉRIL CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8253" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 440, "currency": "MXN" } } }, { "id": "0", "description": "LIGADURAS PARA TOMA DE MUESTRA UNIDAD", "classification": { "scheme": "CUCOP", "id": "25401-0587" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 10, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA SK263019F4P SEDA TRENZADA 75CM 4-0 19MM 3/8 REVERSO CORTANTE CAJA 24 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0472" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 6500, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE COPLIN DE VIDRIO CON TAPA CON CAPACIDAD 500 ML Y CANASTILLA METÁLICA PARA 30 LAMINILLAS PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8066" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 5400, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DE 80 MM DE LARGO X 14 MM DE ALTO X 0,35 MM DE GROSOR PARA MICRÓTOMO CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6115" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "GLUTARALDEHÍDO SOLUCIÓN AL 25% PARA MICROSCOPÍA ELECTRÓNICA FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-7336" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2500, "currency": "MXN" } } }, { "id": "0", "description": "LAMINILLAS CON ADHESIVO ESPECIAL PARA INMUNOHISTOQUIMICA CAJA CON 10 PAQUETES DE 100 LAMINILLAS", "classification": { "scheme": "CUCOP", "id": "25401-6115" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18000, "currency": "MXN" } } }, { "id": "0", "description": "LÁPIZ HIDROFÓBICO PARA INMUNOTINCIÓN PIEZA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1950, "currency": "MXN" } } }, { "id": "0", "description": "TETRÓXIDO DE OSMIO (PUREZA MAYOR A 99.8%) FRASCO 250 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6800, "currency": "MXN" } } }, { "id": "0", "description": "ACRÍLICO DENTAL AUTOCURABLE NO. 66 C (35G) FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0038" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "BARRAS MAGNÉTICAS DE DIFERENTES TAMAÑOS CAJA 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0010" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2000, "currency": "MXN" } } }, { "id": "0", "description": "BULBOS LARGOS DE SUCCIÓN PARA PIPETAS PASTEUR PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6022" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PARA ALMACENAMIENTO DE TUBOS DE 1.5/2 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6033" }, "quantity": 22, "unit": { "name": "PIEZA", "value": { "amount": 170, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PETRI CUADRADA ESTÉRIL 12X12 CM CAJA", "classification": { "scheme": "CUCOP", "id": "25501-0005" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9800, "currency": "MXN" } } }, { "id": "0", "description": "CÁMARA DE RECUENTO NEUBAUER EN V DE VIDRIO ÓPTICO CON REJILLAS PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2000, "currency": "MXN" } } }, { "id": "0", "description": "CÁMARAS REMOVIBLES CON PORTAOBJETOS DE VIDRIO DE 8 POZOS CON BORDES HIDROFÓBICOS AZULES DE 0.7 CM2/POZO, ESTÉRILES PARA CULTIVO CELULAR CAJA 16 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6034" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 12600, "currency": "MXN" } } }, { "id": "0", "description": "CÁNULA DE ADMINISTRACIÓN PARA RATÓN 20 G DE ACERO INOXIDABLE, PUNTA CURVA CAJA 10 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8660" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "CELDA DE CUARZO 0.7 ML PAREDES NEGRAS, LONGITUD DE PASO ÓPTICO DE 10 MM, ALTURA DE 45 MM, CON TAPA CAJA 2 CELDAS", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9600, "currency": "MXN" } } }, { "id": "0", "description": "CELDA DE CUARZO DE CUATRO CARAS TRANSPARENTES CON VOLUMEN DE 3.5 ML Y LONGITUD DE PASO ÓPTICO DE 10MM, ALTURA 45 MM CAJA 2 CELDAS", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3450, "currency": "MXN" } } }, { "id": "0", "description": "CEPO DE CONTENCIÓN PARA RATAS DE 250-500 G TIPO CILINDRO, 8 1/2\" X 2 1/2\" DE ACRÍLICO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "CÍLINDRO DE METAL PARA ESTERILIZAR PIPETAS DE 5 Y 10 ML DE 41X20 CM. PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0072" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1400, "currency": "MXN" } } }, { "id": "0", "description": "CÍLINDRO DE METAL PARA GUARDAR Y ESTERILIZAR PIPETAS PAUSTER DE 20X20 CM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0072" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 850, "currency": "MXN" } } }, { "id": "0", "description": "CRIOETIQUETAS PARA TUBOS DE MICROCENTRÍFUGA DE 0.5 ML PARA IMPRESORA LÁSER, 24 MM X 13 MM PAQUETE 2380 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 2100, "currency": "MXN" } } }, { "id": "0", "description": "CRIOETIQUETAS PARA TUBOS DE MICROCENTRÍFUGA DE 1.5-2.0 ML PARA IMPRESORA LÁSER, 33 MM X 13 MM PAQUETE 1700 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1700, "currency": "MXN" } } }, { "id": "0", "description": "CRIOTUBOS DE 2 ML DE POLIPROPILENO (ROSCADO) CON TAPA, FONDO REDONDO, ESTÉRIL, SIN PIRÓGENOS, PARA TEMPERATURAS DE -190 ° C CON ANANBELA DE SILICONA BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8050" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4000, "currency": "MXN" } } }, { "id": "0", "description": "CRIOTUBOS DE POLIPROPILENO DE 1.5 ML, ESTÉRILES CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8050" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "CUBREOBJETOS DE VIDRIO NO. 2 RECTANGULAR O CUADRADO CON UN ESPESOR DE 0.25 MM EN DOS DIMENSIONES: 22 X 22 MM CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6111" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 35, "currency": "MXN" } } }, { "id": "0", "description": "CUBREOBJETOS DE VIDRIO REDONDOS DE 12 MM DE DIÁMETRO CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0150" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5200, "currency": "MXN" } } }, { "id": "0", "description": "DEPÓSITO PARA REACTIVOS DE ELISA DE POLIESTIRENO, FONDO V, ESTÉRILES, EMPAQUEDATAS INDIVIDUALMENTE PAQUETE 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0013" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4800, "currency": "MXN" } } }, { "id": "0", "description": "ESPÁTULA DE ACERO INOXIDABLE CON MANGO DE MADERA, 80 MM DE LARGO X 20 MM DE ANCHO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 40, "currency": "MXN" } } }, { "id": "0", "description": "ESPÁTULA DE ACERO INOXIDABLE, EXTREMO EN CUCHARA CON CAPACIDAD DE 2 ML Y OTRO EXTREMO CON ANCHO DE 20 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "ESTACIÓN DE TRABAJO PARA 4 PIPETAS CON DISPENSADOR DE PUNTAS CON TAPA DE ACRÍLICO 9 5/8\"W X 9 11/16 \"H X 6 1/2\" L PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2500, "currency": "MXN" } } }, { "id": "0", "description": "ESTILETE DE ACERO INOXIDABLE CON MANGO DE MADERA DE 14 CM PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8157" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "ESTUCHE DE DISECCIÓN DE 12 PIEZAS DE ACERO INOXIDABLE ESTUCHE 12 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 460, "currency": "MXN" } } }, { "id": "0", "description": "ETIQUETA P/MICROTUBOS DE 1.5-2ML, COLORES SURTIDOS EN CÍRCULOS ROLLO 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 900, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE ALMACENAMIENTO BLANCO DE1 L PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 60, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOROSILICATO CON TAPÓN DE ROSCA AZUL 100 ML, AUTOCLAVEABLES PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOROSILICATO CON TAPÓN DE ROSCA AZUL 2000 ML, AUTOCLAVEABLES PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 380, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOROSILICATO CON TAPÓN DE ROSCA AZUL 250 ML, AUTOCLAVEABLES PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 110, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOROSILICATO CON TAPÓN DE ROSCA AZUL 500 ML, AUTOCLAVEABLES PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 135, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE CRISTAL DE 2 LITROS CON TAPA DE ROSCA FRASCO", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE CRISTAL DE 250 MILILITROS CON TAPA DE ROSCA FRASCO", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE PLÁSTICO CAPACIDAD DE 500 ML CON TAPA DE ROSCA DE PLÁSTICO PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6274" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO ÁMBAR CAPACIDAD DE 1 L CON TAPA DE ROSCA DE VAQUELITA PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6275" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO ÁMBAR CAPACIDAD DE 500 ML CON TAPA DE ROSCA DE VAQUELITA PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6275" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 80, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO ÁMBAR CON TAPA DE ROSCA DE 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6275" }, "quantity": 7, "unit": { "name": "PIEZA", "value": { "amount": 80, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO ÁMBAR CON TAPA DE ROSCA DE 500 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6275" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 65, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA CON TAPA PARA 96 MICROTUBOS PCR DE 0.2 ML\n PAQUETE 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8085" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 640, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA DE PLÁSTICO PARA TUBOS DE 1.5 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8085" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA DE PLÁSTICO PARA TUBOS DE 16 MM PARA 36 TUBOS (6 X 6) PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8085" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 290, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA DE PLÁSTICO PARA TUBOS DE 50 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8085" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 290, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA METÁLICA CON 8 LUGARES DE 30 MM DE DIÁMETRO; 147X80X89 MM PARA TUBOS CÓNICOS DE 50 ML PAQUETE 2 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8084" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 600, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBOS DE 20 MM, 40 ESPACIOS, AUTOCLAVABLE. DIÁMETRO DEL TUBO 20 MM. DIMENSIONES: 9 3/4 X 4 X 2 3/4\" PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8084" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 360, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 1 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4000, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 15 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5100, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 7 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5100, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 2 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3900, "currency": "MXN" } } }, { "id": "0", "description": "LÁPIZ PUNTA DIAMANTE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0104" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "LUPA ILUMINADA CON DIÁMETRO GRANDE PARA MUESTRAS DE LABORATORIO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1750, "currency": "MXN" } } }, { "id": "0", "description": "MACROPUNTA PARA PIPETA DE VOLUMEN VARIABLE DE 1 A 5 ML. ELABORADAS EN POLIPROPILENO UNIVERSALES. LIBRES DE DNAASA/RNASA Y PIRÓGENOS, SIN FILTRO, AUTOCLAVEABLES BOLSA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6681" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "MACROPUNTAS PARA PIPETA DE VOLUMEN VARIABLE DE 1 A 10 ML. ELABORADAS EN POLIPROPILENO UNIVERSALES (COMPATIBLES CON PIPETAS AXYGEN). LIBRES DE DNAASA/RNASA Y PIRÓGENOS, SIN FILTRO AUTOCLAVEABLES BOLSA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6678" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "MANGO PARA BISTURÍ NO. 3 PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "MANGUERA DE GOMA FLEXIBLE, DE DIÁMETRO INTERNO DE 5 MM Y DIÁMETRO EXTERNO DE 10 MM, 10 M PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "MARCADORES PARA CRIOVIALES PAQUETE CON 4 (ROJO, AZUL, VERDE Y NEGRO) PAQUETE", "classification": { "scheme": "CUCOP", "id": "25401-6301" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 950, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 100 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6322" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 230, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 20 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 320, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 25 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 185, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 250 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6323" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 310, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 50 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6321" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 210, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO 500 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6324" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 1 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6320" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO CON TAPÓN ESMERILADO DE VIDRIO DE 25 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6313" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 660, "currency": "MXN" } } }, { "id": "0", "description": "MICROESPÁTULAS EN ACERO INOXIDABLE, TIPO PLANA/CUCHARA 30 MM/12X4 MM 150 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-1110" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 110, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE POLIPROPILENO DE 0.5 ML, TRANSPARENTE, INCOLORO PARA REACCIÓN EN CADENA DE LA POLIMERASA BOLSA 250 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8030" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "MONÓMERO PARA ACRÍLICO DENTAL AUTOCURABLE FRASCO", "classification": { "scheme": "CUCOP", "id": "25401-8264" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "PAÑOS DE PAPEL PARA TAREAS DELICADAS, LIMPIEZA DE LENTES DE MICROSCOPIOS CAJA 280 PAÑUELOS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIOS, BLOCK CON HOJAS DE 10X15 CM BLOCK 100 HOJAS", "classification": { "scheme": "CUCOP", "id": "25401-6546" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "PELÍCULA ADHESIVA ÓPTICA PARA 48 POCILLOS COMPATIBLE CON EQUIPO DE PCR EN TIEMPO REAL/TERMOCICLADOR STEP ONE. CAJA 25 PELÍCULAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "PELÍCULA ADHESIVA ÓPTICA PARA PLACAS DE PCR DE 96 POCILLOS PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3500, "currency": "MXN" } } }, { "id": "0", "description": "PERFORADORA DE OREJAS DE ACERO INOXIDABLE PARA RATÓN PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0092" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 4500, "currency": "MXN" } } }, { "id": "0", "description": "PINZA DE SUJECIÓN DE 3 DEDOS, FIJA FIRMEMENTE ARTÍCULOS DE 2-90 MM DE DIÁMETRO\n PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-0748" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "PINZA FORCEPS DE PLÁSTICO DE 12 CM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "PINZA PARA BLOTTING DE PLÁSTICO Y EXTREMO PLANO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "PINZA PARA CUBREOBJETOS 111 MM DE LARGO DE ACERO INOXIDABLE PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "PINZA RECTA, PUNTA ULTRAFINA CÓNICA 0,00 139,89 139,89\nPARA MICROSCOPÍA; LARGO: 4,25 PULGADAS (110 MM); ANCHO: 0,375 PULG. (9,5 MM); ALTO: 0,06 PULGADAS (1,5 MM); MATERIAL: ACERO INOXIDABLE ANTIMAGNÉTICO PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0080" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3500, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DE TRANSFERENCIA 3 ML BOLSA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0031" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR DE VIDRIO PUNTA CORTA, NO ESTÉRIL CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6557" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR DE VIDRIO PUNTA LARGA CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6557" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR DE VIDRIO TALLO CORTO NO ESTÉRILES CAJA 200 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6569" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "PLÁSTICO PARA CERRAR TUBO DE DIÁLISIS, BOLSA BOLSA", "classification": { "scheme": "CUCOP", "id": "25401-0075" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 28000, "currency": "MXN" } } }, { "id": "0", "description": "PORTA ETIQUETAS PARA JAULAS DE RATONES CON GANCHO METÁLICO PARA SUJETARLO EN LAS CAJAS PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS CORTE DIAMANTADO DE 25X75 MM CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 32, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE PLÁSTICO 100 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6672" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE PLÁSTICO 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6672" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 360, "currency": "MXN" } } }, { "id": "0", "description": "PROPIPETA PARA PIPETAS SEROLÓGICAS 10 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6022" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 140, "currency": "MXN" } } }, { "id": "0", "description": "PROPIPETA PARA PIPETAS SEROLÓGICAS 2 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6022" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 140, "currency": "MXN" } } }, { "id": "0", "description": "PROPIPETA PARA PIPETAS SEROLÓGICAS 5 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6022" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 140, "currency": "MXN" } } }, { "id": "0", "description": "RECIPIENTE DE CONGELACIÓN DE POLICARBONATO CON UNA VELOCIDAD DE REFRIGERACIÓN -1ºC/MIN, DE 117MM DE DIAMETRO, PARA 12 TUBOS DE 1-2ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE PLÁSTICO DE 1 L PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE PLÁSTICO DE 500 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 105, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 10 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 52, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 100 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 20 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 49, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 250 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 9, "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 50 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0052" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "VIAL CRIOGÉNICO DE POLIPROPILENO CON ROSCA EXTERNA DE 2 ML, AUTÓNOMO CON FONDO REDONDO, LIBRE DE RNASA/DNASA, ESTÉRIL, NO PIROGÉNICO CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2200, "currency": "MXN" } } }, { "id": "0", "description": "PARAFINA PARAPLAST, HISTOPLAST, MERCK O SAKURA, CON PUNTO DE FUSIÓN 56°-58°C, PRESENTACIÓN EN LENTEJAS PARA USO EN EQUIPO CENTRO DE INCLUSIÓN LEICA MODELO EG1160 PROPIEDAD DEL INNN BOLSA", "classification": { "scheme": "CUCOP", "id": "24101-0126" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 198, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD10 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18016, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IDH1 SILVESTRE PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 116515, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IDH2 SILVESTRE PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 122341, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NKP46 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 119428, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NMDAR1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 97096, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO TAU PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20174, "currency": "MXN" } } }, { "id": "0", "description": "GEL RED EN SOLUCIÓN CONCENTRADA 10,000X NUCLEIC ACID FRA 500 UL VIAL DE 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 977, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA, RNA Y PROTEÍNAS A PARTIR DE SANGRE Y TEJIDO KIT PARA 50PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8142, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100 PB EN ESCALERA DE 100 PB VIAL CON 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 732, "currency": "MXN" } } }, { "id": "0", "description": "PCR MASTER MIX KIT KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1806, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HUMAN IGG (µ-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5502, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE BAJO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 8 X 0.25 MM CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0106" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 1542, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS PARA PCR DE 0.2 ML DE TAPA PLANA BOLSA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 254, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS ELECTROCARGADOS DE 75MM X 25MM CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 490, "currency": "MXN" } } }, { "id": "0", "description": "LAMINILLA CON REJILLAS PARA ORINA (GLASSTIC SLIDE 10 WITH GRIDS) CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 1572, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE PLÁSTICO DE 1000 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0068" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 117, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-PROX 1 ANTIBODY 5G10 MOUSE AB 50 µL BOTE", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6657, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI NEUN DE HUMANO Y RATÓN PRODUCIDO EN RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7049, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI PROHIBITINA-1, PRODUCIDO EN CONEJO, REACTIVIDAD CONTRA HUMANO, RATA, RATÓN, PARA CORTES DE TEJIDO INCLUIDO EN PARAFINA VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11004, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL IL-6 RECOMBINANTE, PRODUCIDO EN CONEJO, ESPECIE REACTIVA: RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13809, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA IBA1/AIF-1 DE RATÓN, RATA, HUMANO Y MONO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9671, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO ANTI-GASDERMIN D PRODUCIDO EN CONEJO, REACTIVIDAD EN RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13054, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-ACMSD, PRODUCIDO EN CONEJO, REACTIVIDAD PARA HUMANO Y RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9200, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO POLICLONAL ANTI-NEUN , PRODUCIDO EN CONEJO, PARA HUMANO, RATÓN Y RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6657, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A ALEXA FLUOR 350 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3627, "currency": "MXN" } } }, { "id": "0", "description": "CONEJO ANTI-PSTAT3 CLONA EP2147Y VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14672, "currency": "MXN" } } }, { "id": "0", "description": "AGAROSA FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7841" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5496, "currency": "MXN" } } }, { "id": "0", "description": "AGAROSA, GRADO BIOLOGÍA MOLECULAR PARA ELECTROFORESIS FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7828" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 5496, "currency": "MXN" } } }, { "id": "0", "description": "DNASA DE PANCREAS BOVINO FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25401-5747" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1628, "currency": "MXN" } } }, { "id": "0", "description": "DNASA DE PÁNCREAS BOVINO, LIOFILIZADA FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25401-5747" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1628, "currency": "MXN" } } }, { "id": "0", "description": "DNASA I GRADO BIOLOGÍA MOLECULAR VIAL 50 MG", "classification": { "scheme": "CUCOP", "id": "25401-5747" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1628, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN ECORI (ECORI RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 244, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HINDIII (HINDIII RESTRICTION ENZYME) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 366, "currency": "MXN" } } }, { "id": "0", "description": "ESTÁNDAR DE ADN DE 1 KB (1 KB DNA LADDER), LÍQUIDO VIAL 5 X 50 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1017, "currency": "MXN" } } }, { "id": "0", "description": "EXONUCLEASA I (EXONUCLEASE I) DE E. COLI, LÍQUIDO A 20,000 UNIDADES/ML VIAL 3000 UNIDADES (3000 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 692, "currency": "MXN" } } }, { "id": "0", "description": "FG TQMN RNASA P DETEC RGTS VIAL 250 UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5298, "currency": "MXN" } } }, { "id": "0", "description": "ITAQ UNIVERSAL SYBR GREEN SUPERMIX VIAL 500 X 20 µL RXNS, 5 ML (5 X 1 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4633, "currency": "MXN" } } }, { "id": "0", "description": "LIGASA T4 (T4 LIGASE) 1000 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1058, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA CON TODOS LOS REACTIVOS NECESARIOS PARA REALIZAR REACCIÓN EN CADENA DE LA POLIMERASA PCR CON POTENCIADOR DE FRAGMENTOS GC VIAL 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1806, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA DE PCR CON ADN POLIMERASA PLATINUM TAQ, CON SOLUCIÓN AMORTIGUADORA CON MAGNESIO Y DNTP PARA LA PREPARACIÓN DE PCR VIAL PARA 200 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1806, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA PARA PCR EN TIEMPO REAL CONCENTRACIÓN 2X. CONTIENE EL COLORANTE SYBR GREEN, ADN POLIMERASA CON ARRANTE EN CALIENTE MEDIADO POR ANTICUERPO, DNTP, UDG, COLORANTE ROX, COLORANTE AZUL INERTE COMPONENTES DE BUFFER OPTIMIZDOS CON DOS VIALES DE 5 ML PAQUETE 2 VIALES DE 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4633, "currency": "MXN" } } }, { "id": "0", "description": "PLATINUM TAQ POLIMERASA 2.5U/µL, 500U VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1952, "currency": "MXN" } } }, { "id": "0", "description": "POLINUCLEÓTIDO QUINASA T4 , LÍQUIDO A 10 U/µL VIAL 500 UNIDADES (500 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 855, "currency": "MXN" } } }, { "id": "0", "description": "REFERENCIA ESTÁNDAR DE PESO MOLECULAR PARA GELES DE ELECTROFORESIS. MEZCLA DE 10 PROTEÍNAS RECOMBINANTES (10–250 KD), 8 BANDAS TEÑIDAS DE AZUL Y 2 BANDAS DE REFERENCIA ROSADAS (25 Y 75 KD) VIAL 500 µL 50 APLICACIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1832, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE TINCIÓN DE ACIDOS NUCLEICOS LIBRE DE BROMURO DE ETIDIO CONCENTRADA (10,000 X) VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 977, "currency": "MXN" } } }, { "id": "0", "description": "SONDA TAQMAN PARA VVZ VIAL 500UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14940, "currency": "MXN" } } }, { "id": "0", "description": "T7 ADN LIGASA (T7 DNA LIGASE), LÍQUIDO A 3,000,000 U/ML VIAL 100,000 UNITS (100,000 U)", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 692, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO DMEM EN POLVO, ALTO EN GLUCOSA CON L-GLUTAMINA, SIN PIRUVATO DE SODIO Y SIN BICARBONATO FRASCO PARA 10 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 613, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO EMEM (EAGLE'S MINIMUM ESSENTIAL MEDIUM) SOBRES PARA PREPARAR UN VOLUMEN DE 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 994, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE CULTIVO F12, LÍQUIDO ESTÉRIL BOTELLA 1X10L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8273, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO PARA TRANSFECCIÓN DE ADN, SIRNAS Y MIRNAS EN CÉLULAS EUCARIOTES, LÍQUIDO VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 15432, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN GLUTAMAX 200MM, GRADO CULTIVO CELULAR BOTELLA 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 543, "currency": "MXN" } } }, { "id": "0", "description": "SUERO FETAL BOVINO, FILTRADO ESTÉRIL, LIBRE DE MICOPLASMA, ENDOTOXINAS Y ANTIBIÓTICO FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 31, "unit": { "name": "PIEZA", "value": { "amount": 6982, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO DE CRECIMIENTO DE CÉLULAS ENDOTELIALES ESTÉRIL, LIOFILIZADO, GRADO CULTIVO CELULAR FRASCO 15 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1462, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO G5 (100X) VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2317, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE PERFIL ALTO 818, DE ACERO INOXIDABLE, DE 80 MM DE LARGO X 14 MM DE ALTO X 0,35 MM DE GROSOR CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8080" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1816, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS PARA MICROTOMO DE ALTO PERFIL (8 X 1.4 X 0.035 CM) CAJA CON 10 PAQUETES DE 50 NAVAJAS CADA UNO", "classification": { "scheme": "CUCOP", "id": "25401-6115" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1816, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE MONTAJE PARA TEJIDOS FRASCO CON 118 ML", "classification": { "scheme": "CUCOP", "id": "25401-7930" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 208, "currency": "MXN" } } }, { "id": "0", "description": "PARAFINA PARA INCLUSIÓN, PURIFICADA CON POLÍMEROS SINTÉTICOS QUE PERMITE EL CORTE CON UNA COMPRESIÓN MÍNIMA. PUNTO DE FUSIÓN: 56-57º C BOLSA 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7645" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 212, "currency": "MXN" } } }, { "id": "0", "description": "BETAZOID DAB KIT, DIAMINOBENZIDINA (DAB). EL KIT CONTIENE FRASCO DE 4ML DE DAB Y 4 FRASCOS DE 25 ML DE BUFFER DE SUSTRATO PARA DAB KIT - BETAZOID DAB CHROMOGEN 1 X 4.0 ML BETAZOID DAB SUBSTRATE BUFFER 4 X 25 ML. 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2400, "currency": "MXN" } } }, { "id": "0", "description": "DAB SUBSTRATE KIT PEROXIDASE (HRP) WITH NICKEL,(3,3-DIAMINOBENZIDINE) KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2400, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA BNDF. REACTIVIDAD: HUMANO, RATA Y RATÓN.SENSIBILIDAD: 1.35 PG/ML\n RANGO: 15.6 - 10000 PG/ML 96 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11450, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA CORTICOSTERONA PARA ROEDORES. DETECCIÓN COLORIMÉTRICA, CON UNA SENSIBILIDAD DE DETECCIÓN DE 32-20000 PG/ML\n LIMITE DE DETECCION 27 PG/ML 96 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7844, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA DETECTAR CORTICOSTERONA 96-POZAS, SENSIBILIDAD DEL KIT ES DE 27 PG/ML., REACTIVIDAD EN RATA Y RATON KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7844, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE MIDIPREPARACIÓN DE PLÁSMIDOS, PURIFICACIÓN DE HASTA 400 µG DE ADN PLASMÍDICO KIT 50 PREPARACIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6921, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE MINIPREPARACIÓN DE PLÁSMIDOS, PURIFICACIÓN DE HASTA 60 µG DE ADN PLASMÍDICO KIT 100 PREPARACIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2646, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PREPARACIÓN DE LIBRERÍAS DE DNA PARA SECUENCIACIÓN POR ILLUMINA (DNA LIBRARY PREP KIT FOR ILLUMINA) 24 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2520, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETECCIÓN DE BDNF, ELISA SANDWICH, REACTIVIDAD EN RATA Y HUMANO, DETECCIÓN COLORIMÉTRICA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11450, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR CORTICOSTERONA EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7844, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR IL.1 BETA EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10368, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA DETERMINAR TNF-ALFA EN SUERO DE RATA POR ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10368, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA LA DETECCIÓN DEL FACTOR DE TRANSCRIPCIÓN NRF2 EN PLACA DE 96 POZOS. MÉTODO COLORIMÉTRICO PARA DETECTAR LA ACTIVIDAD DE UNIÓN AL ADN DEL FACTOR DE TRANSCRIPCIÓN NRF2 EN EXTRACTOS NUCLEARES KIT 96 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 29020, "currency": "MXN" } } }, { "id": "0", "description": "SECUENCIAS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC, MÍNIMO 25 NMOLES PARA SECUENCIAR LA METILACIÓN DE CPG EN EL EXÓN 4 DEL GEN HUMANO APOE MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARK Q24. F: ATGAAGGAGTTGAAGGTTTATAAAT.\nR: AACCCCCACCTAATACACTACCAA*MARCADO CON BIOTINA.\nS1: GGGTAAGGTTGTTTAAGGA.\nS2: GGGTGAGTTTAGTTTTTTATTTG. VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8186, "currency": "MXN" } } }, { "id": "0", "description": "SECUENCIAS DE OLIGONUCLEÓTIDOS PURIFICADOS POR HPLC, MÍNIMO 25 NMOLES PARA SECUENCIAR LA METILACIÓN DE CPG EN REGIÓN PROMOTORA DEL GEN HUMANO APOE MEDIANTE PIROSECUENCIACIÓN EN EQUIPO PYROMARKQ24. F: TTGGGATTTATAATAGGGTTTAGGAAAGTG\nR: CCTCTCTAAACATCAAATTCCTTTACT*MARCADO CON BIOTINA.\nS: AGGGTTTAGGAAAGTGATA VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6862, "currency": "MXN" } } }, { "id": "0", "description": "FLUO-4 PENTAPOTASSIUM SALT, CELL IMPERMEANT VIAL 500 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4875, "currency": "MXN" } } }, { "id": "0", "description": "GLICINA FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7458" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1058, "currency": "MXN" } } }, { "id": "0", "description": "2.5 ML (5 X 500 µL), MIXTURE OF TEN BLUE-STAINED RECOMBINANT PROTEINS (10–250 KD) VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25401-7392" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1832, "currency": "MXN" } } }, { "id": "0", "description": "ESCALERAS DE PROTEÍNAS PRETEÑIDAS PAGERULER™ PLUS, DE 10 A 250 KDA VIAL", "classification": { "scheme": "CUCOP", "id": "25401-7828" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1832, "currency": "MXN" } } }, { "id": "0", "description": "ESTÁNDAR DE PROTEÍNAS PRETEÑIDAS DE 10 A 250 KDA VIAL 2 X 250 µL", "classification": { "scheme": "CUCOP", "id": "25401-7850" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 1832, "currency": "MXN" } } }, { "id": "0", "description": "PRECISION PLUS PROTEIN™ ALL BLUE PRESTAINED PROTEIN STANDARDS FRASCO 2.5 ML", "classification": { "scheme": "CUCOP", "id": "25401-5065" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1832, "currency": "MXN" } } }, { "id": "0", "description": "LINTERNA UV LED PROFESIONAS DE LONNGUITUD DE ONDA DE 365 NM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0089" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4413, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DE PLÁSTICO ESTÉRIL DE 10 ML CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6573" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 490, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DE PLÁSTICO ESTÉRIL DE 25 ML CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6573" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 796, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DE PLÁSTICO ESTÉRIL DE 5 ML CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6573" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 432, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE 250 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0068" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 77, "currency": "MXN" } } }, { "id": "0", "description": "TIRAS DE 8 TUBOS DE POLIPROPILENO PARA PCR CON CAPACIDAD DE 0.1 ML PAQUETE 125 TIRAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1855, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CÓNICO DE 15 ML PARA CENTRÍFUGA, DE POLIPROPILENO, GRADUACIONES IMPRESAS Y MEMBRETE, LIBRE DE PIRÓGENOS CON TAPA DE ROSCA CAJA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-7316" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1580, "currency": "MXN" } } }, { "id": "0", "description": "CABLE MONOPOLAR STIMULATING PROBE, DESECHABLE. NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 2565, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES. 2.0 DE LONGITUD. NECESARIO MUESTRA FÍSICA CAJA CON 24 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 5535, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES 2.5 LONGITUD. NECESARIO MUESTRA FÍSICA CAJA CON 24 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 5535, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE ELECTRODES FOR IOM DESECHABLES. NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 5865, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE EPIDURAL SPINAL ELECTRODE DESECHABLE. PKG STAINLES STEELE (DIN STYLE). NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 15309, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE CORKSCREW ELECTRODE DESECHABLE. (ELECTRODO DE RESORTE) NECESARIO MUESTRA FÍSICA CAJA CON 24 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 2338, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE MONOPOLAR PROBE ELECTRODO DESECHABLE. NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 2195, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA EMG, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG50.PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA CAJA CON 48 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 9248, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA EMG, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMF-25.PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA CAJA CON 48 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 9248, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMF37. SE REQUIERE MUESTRA FÍSICA CAJA CON 48 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 9248, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG37. SE REQUIERE MUESTRA FÍSICA CAJA CON 48 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 9248, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO CON PARCHE ADHESIVO (TWO CHANNEL LARYNGEAL SUFARCE ELECTRO DE DRAGONFLY) LSE500DCS NECESARIO MUESTRA FISICIA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 32400, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DE ANILLO PARA NEUROCONDUCCIÓN SENSITIVA DESECHABLE. NECESARIO MUESTRA FÍSICA (ELECTRODO DE TIERRA CON TERMINACION EN ARGOLLA DE ACERO INOXIDABLE) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 1755, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DE TIERRA DESECHABLE PARA LA REALIZACIÓN DE ESTUDIOS NEUROFISIOLÓGICOS. NECESARIO MUESTRA FÍSICA PIEZA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 1485, "currency": "MXN" } } }, { "id": "0", "description": "MASCARILLAS NASALES PARA CPAP TAMAÑO CHICA DESECHABLE. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 3639, "currency": "MXN" } } }, { "id": "0", "description": "MASCARILLAS NASALES PARA CPAP TAMAÑO MEDIANA DESECHABLE. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0086" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 3639, "currency": "MXN" } } }, { "id": "0", "description": "OXÍMETRO DE PULSO NONI PARA MEDIR LA SATURACIÓN DE OXÍGENO EN LA SANGRE. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 60, "unit": { "name": "PIEZA", "value": { "amount": 16650, "currency": "MXN" } } }, { "id": "0", "description": "FLEXI WRAP TAPES DESECHABLES PARA SENSOR SPO2, CINTA PARA FIJACION DE OXIMETRO DE PULSO DESECHABLE TAMAÑO ADULTO. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 100, "unit": { "name": "PIEZA", "value": { "amount": 2565, "currency": "MXN" } } }, { "id": "0", "description": "OXÍJMETRO DE FLEX (CINTA) OXIMETRO DE PULSO COMPATIBLE CON POLISOMNOGRAFIA DESECHABLE. COD S11047. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 80, "unit": { "name": "PIEZA", "value": { "amount": 11283, "currency": "MXN" } } }, { "id": "0", "description": "TRANSDUCTOR DESECHABLE DE PRESIÓN CON DISPOSITIVO DE FLUJO CONTINUO TIPO GATILLO. SE REQUIERE MUSTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 18822, "currency": "MXN" } } }, { "id": "0", "description": "CÁNULAS DE PRESIÓN NASAL TAMAÑO ADULTO DE 0.6 M DE LONGITUD. NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 13230, "currency": "MXN" } } }, { "id": "0", "description": "CÁNULAS PARA MEDICION DE FLUJO RESPIRATORIO Y/O MEDICION DE CO2 RESPIRATORIO COD. S11057 LONGITUD 2.1 MTRS NASAL ADULTO. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 300, "unit": { "name": "PIEZA", "value": { "amount": 540, "currency": "MXN" } } }, { "id": "0", "description": "CÁNULAS PARA MEDICION DE FLUJO RESPIRATORIO Y/O MEDICION DE CO2 RESPIRATORIO COD. S11058 LONGITUD 2.1 MTRS ORONASAL ADULTO. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0094" }, "quantity": 200, "unit": { "name": "PIEZA", "value": { "amount": 540, "currency": "MXN" } } }, { "id": "0", "description": "TERMISTOR DE FLUJO NASAL CON ENTRADA DIN (DE RESPIRACIÓN) NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 100, "unit": { "name": "PIEZA", "value": { "amount": 15309, "currency": "MXN" } } }, { "id": "0", "description": "BANDAS TORACICAS ABDOMINALES Y DE TORAX. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 21949, "currency": "MXN" } } }, { "id": "0", "description": "BANDA DE ESFUERZO RESPIRATORIO Z-RIP GRANDE 61-190 CMS, (SENSOR PARA RESPIRACIÓN ABDOMINAL) NECESARIO MUESTRA FISICA. PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 20554, "currency": "MXN" } } }, { "id": "0", "description": "BANDAS TORAXICAS ABDOMINALES DE PLETISMOGRAFIA NO CALIBRADAS. NECESARIO MUESTRA FISICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 18853, "currency": "MXN" } } }, { "id": "0", "description": "BANDA DE ESFUERZO RESPIRATORIO Z-RIP GRANDE 114-312 CMS, (SENSOR PARA RESPIRACIÓN ABDOMINAL) NECESARIO MUESTRA FISICA. PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 14992, "currency": "MXN" } } }, { "id": "0", "description": "BIPOLAR FELT PAD ELECTRODO DESECHABLES. NECESARIO MUESTRA FÍSICA PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0102" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 3160, "currency": "MXN" } } }, { "id": "0", "description": "APC ANNEXIN V APOPTOSIS DETECTION KIT WITH 7-AAD KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6480, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA LA DETECCIÓN CUANTITATIVA DE AUTOANTICUERPOS DE TIPO IGG ANTI LA GLICOPROTEÍNA ASOCIADA A MIELINA (ANTI-MAG) HUMANA EN SUERO O PLASMA CAJA 96 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 32886, "currency": "MXN" } } }, { "id": "0", "description": "VECTASTAIN ELITE ABC-HRP KIT PEROXIDASE, R.T.U. (UNIVERSAL) VECTOR KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8100, "currency": "MXN" } } }, { "id": "0", "description": "CARTUCHO CLÁSICO C18 PARA EXTRACCIÓN EN FASE SÓLIDA, 360 MG SORBENTE, FASE REVERSA, TAMAÑO PARTÍCULA 55-105 MICRAS, TAMAÑO PORO 125 A, SORBENTE SILICA, ENDCAPPED, PARA VOLUMEN HASTA 0.85 ML PAQUETE 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7495.2, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFÍA CATECOLAMINAS 3 UM (4.6X100MM) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 21708, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFÍA SPHERISORB ODS2 3UM (COLUMNA ANALÍTICA 4.5X150 MM) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 25444.8, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFÍA ZORBAX ECLIPSE XBD-C18 (ANALÍTICA 4.6 X150MM 5 MICRON) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 58000, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PROTECOL C18G 120A 5 UM (150MM X4.6MM) PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0120" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 31860, "currency": "MXN" } } }, { "id": "0", "description": "FRIT PTFE PARA BOMBA DE HPLC PAQUETE 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0083" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1080, "currency": "MXN" } } }, { "id": "0", "description": "VIAL DE VIDRIO 6 MM PARA CROMATOGRAFÍA DE LÍQUIDOS. CLARO, FONDO REDONDO,0.3 ML, HTS Y HTC PAL PAQUETE 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4482, "currency": "MXN" } } }, { "id": "0", "description": "VIALES DE MICROINSERTOS DE VIDRIO (TRANSPARENTE, DIAMETRO 6 MM, ALTURA 31 MM, FONDO PLANO, CAPACIDAD: 300MICROLITROS) PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4482, "currency": "MXN" } } }, { "id": "0", "description": "VIALES DE POLIESTIRENO PARA MUESTRAS MICRODIÁLISIS, 300 MICROLITROS VOLUMEN MÁXIMO PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3978, "currency": "MXN" } } }, { "id": "0", "description": "VIALES DE POLIPROPILENO PARA MUESTRAS MICRODIÁLISIS, 300 MICROLITROS VOLUMEN MÁXIMO PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3978, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD20 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11254.32, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD56 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15946.56, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK AE1/AE3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14182.56, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LISOZIMA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10160.64, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD31 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16299.36, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO H3K27 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30514.67, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO HMB45 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11495.95, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IDH1-R132H PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 24213.82, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MIELINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10215.78, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OSTEONECTINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10215.78, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO RECEPTOR ESTROGENOS PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20095.61, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO STAT6 CLONA YE361 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20431.55, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SV40 PAB101 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20431.55, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CDX2 BC39 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 24671.79, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NKX3.2 D2Y1A PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 30507.84, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCION DESCALCIFICANTE DE ACCION LIGERA A BASE DE ACIDO FORMICO, IDEAL PARA DESCALCIFICAR HUESO PARA INMUNOHISTOQUIMICA GALON", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7920, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CDE31 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16682.49, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NITRICO 68-70% CONCENTRACION FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1502, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0063" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 726, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ABSOLUTO PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 5931, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO AL 30% FRASCO DE 1 LITRO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 290, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE ZINC EN POLVO FRASCO DE 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1282, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 10 X 75 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 16, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 100 MM PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0097" }, "quantity": 40, "unit": { "name": "PIEZA", "value": { "amount": 16, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE BOCA ANCHA ESTÉRIL PARA UROCULTIVO DE 30 ML CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0077" }, "quantity": 18, "unit": { "name": "PIEZA", "value": { "amount": 1680, "currency": "MXN" } } }, { "id": "0", "description": "TERMÓMETRO DE VARILLA PARA LABORATORIO CON RANGO DE TEMPERATURA DE -10°C A 150°C PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0096" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO TRICLOROACÉTICO FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-6707" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2420, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODIO PERLAS, ACS FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7627" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 450, "currency": "MXN" } } }, { "id": "0", "description": "SÍLICA GEL EN PERLAS DE 1-4 MM, CON INDICADOR DE COLOR AZUL FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25301-4146" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1605, "currency": "MXN" } } }, { "id": "0", "description": "GELRED NUCLEIC ACID VIAL 0.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 644, "currency": "MXN" } } }, { "id": "0", "description": "DICROMATO DE POTASIO (CRISTAL) FRASCO 250 G", "classification": { "scheme": "CUCOP", "id": "25401-7807" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1077, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE COBALTO FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1519, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE SODIO, GRADO REACTIVO ANALITICO BOTE 10 KG", "classification": { "scheme": "CUCOP", "id": "25401-7590" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 221, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7616" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 621, "currency": "MXN" } } }, { "id": "0", "description": "SACAROSA BOTE DE 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7680" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 359, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE ALUMINIO FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0047" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 638, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ETÍLICO AL 96% PORRÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25401-7493" }, "quantity": 11, "unit": { "name": "PIEZA", "value": { "amount": 3588, "currency": "MXN" } } }, { "id": "0", "description": "XILOL PORRÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25401-7752" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 459, "currency": "MXN" } } }, { "id": "0", "description": "CRISTAL VIOLETA FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 372, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE ALMACENAMIENTO PARA CONGELACIÓN DE MICROTUBOS DE 1.5-2.0 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6033" }, "quantity": 15, "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PETRI DE CRISTAL ESTÉRIL AUTOCLAVABLE DE 100X15 MM, SIN SEPARACIONES PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6028" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1639, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE CONCENTRADO 10,000X FRASCO 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 62145.2, "currency": "MXN" } } }, { "id": "0", "description": "AGAR CITRATO DE SIMMONS FCO 450 GR FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1354.28, "currency": "MXN" } } }, { "id": "0", "description": "CALDO DE ROJO DE FENOL Y MANITOL MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1175.85, "currency": "MXN" } } }, { "id": "0", "description": "CALDO TIOGLICOLATO FRASCO (NIH) MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1249.39, "currency": "MXN" } } }, { "id": "0", "description": "EQUIPO ALADO ULTRA-TOUCH PARA TOMA DE MUESTRAS SANGUINEAS AL VACIO CON AGUJA NO. 23 G X .75 CON TUBO DE PLASTICO FLEXIBLE DE 7\"(AZUL CLARO) CON TECNOLOGIA DE PARED ULTRAFINA RIGTHGAUGE QUE PERMITE UTILIZAR CALIBRES MAS PEQUEÑOS PARA LOS ACCESOS VENOSOS DIFICILES Y CON DISEÑO PENTAPOINT DE 5 BISELES EL CUAL DISMINUYE LA FUERZA DE PENETRACIÓN DE LA AGUJA CON SISTEMA DE BOTÓN DE SEGURIDAD PARA LA RETRACCIÓN DE LA AGUJA (\"PUSH BUTTON\") CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0105" }, "quantity": 48, "unit": { "name": "PIEZA", "value": { "amount": 1526.66, "currency": "MXN" } } }, { "id": "0", "description": "AGUJAS PARA TOMA DE MUESTRAS DE SANGRE AL VACÍO 21 G X 25 MM (VERDE), ESTÉRILES, DESECHABLES PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-0554" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 328.43, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACÍO CON ANTICOAGULANTE (EDTA, TAPÓN MORADO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8005" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 5712.7, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACÍO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, CON GEL SEPARADOR, CON VOLUMEN DE DRENADO DE 6 ML CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8008" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3851.45, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACÍO CON ANTICOAGULANTE (EDTA, TAPÓN MORADO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8008" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 5712.7, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACÍO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, CON GEL SEPARADOR, CON VOLUMEN DE DRENADO DE 6 ML CAJA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6107" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3851.45, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO CLORHÍDRICO REACTIVO ANALÍTICO FRASCO 1 LT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 197.54, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESIONIZADA PORRON DE 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0062" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 328.33, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO CLORHÍDRICO REACTIVO ANALÍTICO FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 197.54, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESIONIZADA PORRON", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 328.33, "currency": "MXN" } } }, { "id": "0", "description": "DIETANOLAMIDA (ACRILAMIDA EN POLVO FRA 500G) FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2216.96, "currency": "MXN" } } }, { "id": "0", "description": "METANOL GRADO HPLC FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1786.2, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ACÉTICO GLACIAL FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7662" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 390.56, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO CÍTRICO MONOHIDRATADO FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-1133" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 450.6, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NÍTRICO 70%, ALTA PUREZA PURIFICADO POR RE-DESTILACIÓN, =99.999%, ULTRA PURO EN BASE A TRAZAS DE METAL FRASCO 475 ML", "classification": { "scheme": "CUCOP", "id": "25401-7702" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3652.16, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO AL 30% FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25401-7653" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 176.69, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN AMORTIGUADORA DE REFERENCIA PH 10.0 FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7118" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 94.9, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN AMORTIGUADORA DE REFERENCIA PH 4.0 FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7081" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 94.9, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN AMORTIGUADORA DE REFERENCIA PH 7.0 FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7058" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 94.9, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESIONIZADA PORRÓN 20 L", "classification": { "scheme": "CUCOP", "id": "25101-0062" }, "quantity": 34, "unit": { "name": "PIEZA", "value": { "amount": 328.33, "currency": "MXN" } } }, { "id": "0", "description": "(-)-EPICATEQUINA FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4645.76, "currency": "MXN" } } }, { "id": "0", "description": "5-IODOTUBERCIDIN FRASCO 5 MG", "classification": { "scheme": "CUCOP", "id": "25301-3253" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6510.6, "currency": "MXN" } } }, { "id": "0", "description": "COLAGENASA A DE CLOSTRIDIUM HISTOLYTICUM FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7920.96, "currency": "MXN" } } }, { "id": "0", "description": "COLAGENASA B (0.195 U/MG LYO) FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25901-1869" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6091.8, "currency": "MXN" } } }, { "id": "0", "description": "TRITÓN X-100 BOTELLA 50 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 707.24, "currency": "MXN" } } }, { "id": "0", "description": "TRITÓN X-100 GRADO BIOLOGÍA MOLECULAR FRASCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2088.16, "currency": "MXN" } } }, { "id": "0", "description": "IGEPAL, GRADO BIOLOGÍA MOLECULAR FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-4555" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2093.68, "currency": "MXN" } } }, { "id": "0", "description": "2-METOXIESTRADIOL (2-MEOE2) FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8537.36, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE PLOMO FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7659" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 684.77, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO CÍTRICO MONOHIDRATADO FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7339" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 450.6, "currency": "MXN" } } }, { "id": "0", "description": "ADENOSINE 5'-TRIPHOSPHATE MAGNESIUM VIAL 1 G", "classification": { "scheme": "CUCOP", "id": "25401-6500" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 3970.48, "currency": "MXN" } } }, { "id": "0", "description": "BETA-NICOTINAMIDA ADENINA DINUCLEÓTIDO 2 FOSFATO REDUCIDO SAL TETRASÓDICA HIDRATADA, POLVO >93% FRASCO 250 MG", "classification": { "scheme": "CUCOP", "id": "25401-7760" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7055.24, "currency": "MXN" } } }, { "id": "0", "description": "CITRATO DE SODIO TRIBÁSICO DIHYDRATE, GRADO REACTIVO ACS, PUREZA =99.0% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-1025" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1165.4, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE ZINC, PUREZA MAYOR A 98% FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 629.96, "currency": "MXN" } } }, { "id": "0", "description": "COCTEL DE INHIBIDORES DE FOSFATAS ÁCIDAS Y BÁSICAS FRASCO/CAJA 10 TABLETAS", "classification": { "scheme": "CUCOP", "id": "25401-6763" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3739.56, "currency": "MXN" } } }, { "id": "0", "description": "DICLOHEXILCARBOMIDA (DCC) PUREZA =99% FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25401-6763" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 667.68, "currency": "MXN" } } }, { "id": "0", "description": "DYETHYLPYROCARBONATE FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25301-1753" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7597.5, "currency": "MXN" } } }, { "id": "0", "description": "FORMIATO DE AMONIO =99.995 EN A TRAZAS DE METALES FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1596.88, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE SODIO MONOBÁSICO PUREZA 99% FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25401-7616" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 503, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7613" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 885.32, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DIBÁSICO DE SODIO DODECAHIDRATADO ACS, =99,0 FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7456" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2813.12, "currency": "MXN" } } }, { "id": "0", "description": "HIDROSULFURO DE SODIO HIDRATADO (NASH. H2O) FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0059" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 953.8, "currency": "MXN" } } }, { "id": "0", "description": "ORTOVANADATO DE SODIO FRASCO 10 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1584, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO DE ZINC HEPTAHIDRATADO, REACTIVO ACS, PUREZA =99% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7697" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 448.76, "currency": "MXN" } } }, { "id": "0", "description": "2-AMINO-2-METILPROPANO, PUREZA 98% FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "21401-0028" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2717.44, "currency": "MXN" } } }, { "id": "0", "description": "2-METILBUTANO FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7051" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4566.64, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA ACS FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7660" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 911.02, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA GRADO ANALÍTICO FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25401-7660" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 295.54, "currency": "MXN" } } }, { "id": "0", "description": "CLOROFORMO GALÓN", "classification": { "scheme": "CUCOP", "id": "25401-7372" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1888.22, "currency": "MXN" } } }, { "id": "0", "description": "DIMETIL SULFÓXIDO FRASCO 250 ML", "classification": { "scheme": "CUCOP", "id": "25401-7557" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2215.73, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ABSOLUTO GARRAFÓN 19 L", "classification": { "scheme": "CUCOP", "id": "25401-7721" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 3523.27, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ABSOLUTO, REACTIVO ANALÍTICO, PUREZA 99.9% FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7721" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1046.66, "currency": "MXN" } } }, { "id": "0", "description": "METANOL GRADO HPLC FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7724" }, "quantity": 9, "unit": { "name": "PIEZA", "value": { "amount": 1786.2, "currency": "MXN" } } }, { "id": "0", "description": "XILENO, GRADO ACS FRASCO 4 L", "classification": { "scheme": "CUCOP", "id": "25401-7751" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1086.12, "currency": "MXN" } } }, { "id": "0", "description": "(R)-(+)-WIN 55,212-2 MESYLATE SALT FRASCO 25 MG", "classification": { "scheme": "CUCOP", "id": "25401-4619" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10442.68, "currency": "MXN" } } }, { "id": "0", "description": "1-(2,4-DICHLOROPHENYL)-5-(4-IODOPHENYL)-4-METHYL-N-1-PIPERIDINYL-1H-PYRAZOLE-3-CARBOXAMIDE FRASCO 10 MG", "classification": { "scheme": "CUCOP", "id": "25401-4619" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6493.12, "currency": "MXN" } } }, { "id": "0", "description": "1400W, N-(3-AMINOMETILL)BENCILACETAMIDINA, 2HCL FRASCO 10 MG", "classification": { "scheme": "CUCOP", "id": "25401-7734" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3090.96, "currency": "MXN" } } }, { "id": "0", "description": "2-ARACHIDONYL GLYCEROL FRASCO 5 MG", "classification": { "scheme": "CUCOP", "id": "25401-4619" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9299.12, "currency": "MXN" } } }, { "id": "0", "description": "3-HIDROXI-DL-KINURENINA (ESTÁNDAR ANALÍTICO) FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 11694.8, "currency": "MXN" } } }, { "id": "0", "description": "5-BROMO-2'-DESOXIURIDINA (BRDU) FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2380.72, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO DIETILENTRIAMINOPENTAACÉTICO (PUREZA MAYOR A 99%) FRASCO 50 G", "classification": { "scheme": "CUCOP", "id": "25401-7127" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 172.03, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO 30% FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-7653" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 176.69, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ACTH PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6919, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALFA 1 ANTI-TRIPSINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8904, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALFA-SINUCLEINA (FOSFORILADA) PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10958, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALK PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12589, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ATRX PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BCL-2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12671, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BCL-6 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11422, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO C1Q PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD163 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12180, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD166 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4412, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16335, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD30 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10440, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD34 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 16069, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD35 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11873, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD38 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15537, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD45 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11627, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD57 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11770, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD68 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9519, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD8 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9928, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK 5/6 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK-HMW PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9723, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK-LMW PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8904, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CLAUDINA 1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CLAUDINA 3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CLAUDINA 5 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6714, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CMV PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7512, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CMYC PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18116, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO E-CADHERINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9928, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EMA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8904, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FACTOR VIII PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4442, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FASCINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8188, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FSH PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2763, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GATA-3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20368, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GFAP PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 10951, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GH PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GLUT-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5936, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IGG PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INI-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 20634, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO KAPPA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6775, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO KI-67 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 11873, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO L1CAM CLONA UJ127.11 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LAMBDA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8147, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LMP-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18832, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MELAN-A A103 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MGMT CLONA MT3.1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MIOGENINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12671, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MTOR PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NEUN FOX3 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16148, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NEUROFILAMENTOS NO FOSFORILADOS SMI32 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12662, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NSE PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12794, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OLIG2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 18832, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO P53 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 11975, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO P65 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PLAP PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11627, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PROLACTINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8864, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PS100 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11566, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PTEN PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8516, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO RECEPTOR PROGESTERONA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 19139, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SINAPTOFISINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6571, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SMA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 12650, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO TERT CLONA 2C4 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO TSH PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10747, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO TTF-1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13265, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO VIMENTINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 11832, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO YAP1 CLONA SU33-06 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4412, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALDH1A1 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14431, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-LH PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8188, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BRACHYURY 1H9A2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15312, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO DESMINA D33 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FERRITINA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GPX4 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO HIF-1 ALFA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14288, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO HIF-2 ALFA PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 22067, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INSM1 A-8 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16949, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NAPSIN A PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 10399, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NCOA4 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13386, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PDCD10 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16148, "currency": "MXN" } } }, { "id": "0", "description": "POLI-L-LISINA EN SOLUCION FRASCO DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 3311, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA CROMÓGENO DIAMINOBENCIDINA K3468 (DAB + CHROMOGEN) KIT DE 110 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 6039, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA LSAB - HRP SISTEMA DE DETECCIÓN K0690 (LINK Y ESTREPTAVIDINA) KIT DE 250 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 22415, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EVFGR2 PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16148, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO RECEPTOR ALFA ADRENERGICO PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6853, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO COLAGENA IV PARA INMUNOHISTOQUÍMICA EN TEJIDO HUMANO EN PARAFINA VIAL DE 1 ML CONCENTRADO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 9109, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AZULES PARA PIPETA AUTOMATICA VOLUMEN 1000 µL (MICROLITROS) BOLSA C/1000 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 153, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS) BOLSA C/1000 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 116, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS DE POLIPROPILENO CÓNICOS DE 1.5 ML DE TAPA PLANA PARA MICROCENTRÍFUGA CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 122, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS) BOLSA CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 116, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE 1.5 ML TRANSPARENTE (TUBO TIPO EPENDORF) CAJA C/500 CAJA CON 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0026" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 122, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AZULES PARA PIPETA AUTOMATICA VOLUMEN 1000 µL (MICROLITROS) BOLSA CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 36, "unit": { "name": "PIEZA", "value": { "amount": 153, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 0.5 A 10 µL (BLANCAS) BOLSA CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 152, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS) BOLSA CON 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 24, "unit": { "name": "PIEZA", "value": { "amount": 116, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO RETINOICO FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25301-0070" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2150, "currency": "MXN" } } }, { "id": "0", "description": "BASE TRIZMA FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-1007" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 705, "currency": "MXN" } } }, { "id": "0", "description": "ANTI BETA ACTINA PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI BETA ACTINA PRODUCIDO EN RATÓN VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3592, "currency": "MXN" } } }, { "id": "0", "description": "ANTI COX-2 DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI GRP75 PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI KI-67 PRODUCIDA EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI KI67 HUMANA, ANTICUERPO PRIMARIO MONOCLONAL DE CONEJO ANTI-HUMANO VIAL 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 4412, "currency": "MXN" } } }, { "id": "0", "description": "ANTI LAMININA B PRODUCIDA EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI MOTOFUSINA-2 (MFN2) PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4412, "currency": "MXN" } } }, { "id": "0", "description": "ANTI NON-RECEPTOR TYROSINE KINASE PYK2 PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4412, "currency": "MXN" } } }, { "id": "0", "description": "ANTI RECEPTOR ITPR3 INOSITOL 1,4,5 TRIFOSFATO PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI TREM2 HECHO EN RATÓN VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-BRDU ALEXA FLUOR 488 VIAL 200 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7476, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-CASPASA 3 DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-CASPASA 8 DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-ERK DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HIF1A DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-P65NF-¿B DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-PCNA DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-PERK DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-PJNK DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-PK53 DE HUMANO, MONOCLONAL, HECHO EN RATÓN VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ERK1/2 DE HUMANO Y RATÓN, PRODUCIDO EN RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ALFA TUBULINA (TU-02) ACOPLADO AL FLUORÓFORO ALEXA FLUOR® 680 VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7476, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ACTH POLICLONAL PRODUCIDO EN CONEJO, REACTIVIDAD CONTRA HUMANO, RATA, PARA CORTES DE TEJIDO INCLUIDO EN PARAFINA VIAL 1 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 16148, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI CATALASA, ESPECIES REACTIVAS: HUMANO, RATA Y RATÓN. HOSPEDERO IGG CONEJO VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI EGFR, REACTIVIDAD HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI NFKB P65 DE HUMANO Y RATÓN, PRODUCIDO EN RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI PKC ALPHA DE HUMANO Y RATÓN, PRODUCIDO EN RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI VDAC1/PORIN CONTROL DE CARGA MITOCONDRIAL VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI VEGF DE HUMANO Y RATÓN PRODUCIDO EN RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI- ALFA SINUCLEÍNA ( 211) HUMANA HECHO EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA LOS RESIDUOS DE AMINOÁCIDOS 121-125 DE ALFASINUCLEÍNA HUMANA VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-ALFASINUCLEINA NITRADA (SYN 514) HUMANA HECHA EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA LA ALFASINUCLEÍNA OXIDADA DE ORIGEN HUMANO VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CD63 HUMANO HECHO EN RATÓN (ISOTIPO IGG1K) QUE RECONOZCA EL CD63 HUMANO VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CD81 HUMANO HECHO EN RATÓN (ISOTIPO IGG2BK) QUE RECONOZCA LOS AMINOÁCIDOS 90-210 DE CD81 DE ORIGEN HUMANO VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CYCLIN D1 (A-12) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO E-CADHERINA (G-10) EN CABRA, RATÓN MONOCLONAL IGG1 (CADENA KAPPA) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GLUTATION PEROXIDASA I, ESPECIES REACTIVAS: HUMANO, RATA Y RATÓN. HOSPEDERO IGG CONEJO VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI BNDF DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI CASPASA-3, DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI FGFR1, DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI IL-10 DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI KLOTHO DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI NESTINA DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI NEUROD DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI NMDA¿1, DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI PAX6 DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI TNFA DE HUMANO Y RATÓN, HECHO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL CASPASA-3 (E-8), PRODUCIDO EN RATÓN IGG2A VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL CASPASA-8 (8CSP03), PRODUCIDO EN RATÓN IGG1 (CADENA LIGERA KAPPA) VIAL 100 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL CITOCROMO C (7H8) IGG2B VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-BCL2, REACTIVIDAD CONTRA HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-NOS-1, REACTIVIDAD CONTRA HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN ANTI-VDAC1 CLONA (B-6) ISOTIPO IGG1 (CADENA LIGERA KAPPA) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN DIRIGIDO CONTRA MONOACILGLICEROL LIPASA (MGL) DE HUMANO, RATON Y RATA PARA TECNICAS DE WB, IP, IF Y ELISA 200µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATÓN, ANTI-HSP70, REACTIVIDAD CONTRA RATA Y HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL GALECTINA 3 PRODUCIDO EN RATÓN, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL GFAP PRODUCIDO EN RATÓN, ESPECIES REACTIVAS: RATÓN, RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL OCLUDINA (E-5) PRODUCIDO EN RATÓN IGG2B (CADENA LIGERA KAPPA) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL PARA HUMANO CD4 RATÓN PARA PARAFINA VIAL 1ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL PARA HUMANO CD8 PARA PARAFINA, PRODUCIDO EN RATÓN VIAL 1ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL PRIMARIO ANTI-NEUROFILAMENTO, PRODUCIDO EN RATÓN IGG1 ¿, PARA HUMANO, RATÓN Y RATA, CONJUGADO CON ALEXA FLUOR 488 VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7476, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL PRIMARIO ANTI-NEUROFILAMENTO, PRODUCIDO EN RATÓN, PARA HUMANO, RATÓN Y RATA (MARCADOR NEURONAL) VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ß-CATENIN (E-5) PRODUCIDO EN RATÓN VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NAVL1 VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NRF1 (H-4) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CABRA IGG (H+L), PRODUCIDO EN CONEJO, ACOPLADO A HRP, LIOFILIZADO VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3602, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO CABRA ANTI-IGG DE CONEJO, BIOTINILADO VIAL 2 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3120, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO POLICLONAL PRODUCIDO EN CONEJO ANTI-CABRA IGG (H+L),ESPECIE REACTIVA: CABRA VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2739, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO PRODUCIDO EN CABRA ANTI-RATÓN IGG (H+L) VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2232, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO PRODUCIDO EN CABRA DIRIGIDO A IGG DE RATA, ACOPLADO A CY3 VIAL 200 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3297, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO WNT-2 (E-7) VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "FLUORESCEIN (FITC)-AFFINIPURE GOAT ANTI-HUMAN IGG (H+L) FRASCO 2 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2486, "currency": "MXN" } } }, { "id": "0", "description": "GLUR-2 ANTICUERPO MONOCLONAL (7G6) VIAL 200 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "IGG ANTI CONEJO FITC DE CABRA VIAL 2 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2486, "currency": "MXN" } } }, { "id": "0", "description": "IGG ANTI RATÓN HRP DE CABRA VIAL 2 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3247, "currency": "MXN" } } }, { "id": "0", "description": "MA ANTI ACTINA DE RATÓN IGG1 VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 6622, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE-AFFINIPURE 1.50M GOAT ANTI-RABBIT IGG (H+L) (MIN X HU SR PROT) VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3703, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-GOAT IGG (H+L) VIAL 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3602, "currency": "MXN" } } }, { "id": "0", "description": "PROTEÍNA DE UNIÓN A IGG KAPPA DE RATÓN (M-IGG¿ BP-HRP) CONJUGADA A PEROXIDASA DE RÁBANO PICANTE (HRP) VIAL 200 µG/0.5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1944, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE RED-X-AAFFINIPURE CABRA ANTI-CONEJO IGG (H+L) VIAL 2 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2486, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE RED-X-CONJUGATED AFFINIPURE CABRA ANTI-HUMANO IGG (H+L) VIAL 2 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2486, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA PROTEÍNAS VIAL 500 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 872, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA PROTEÍNAS DE 10-250KDA, 500µL VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 478, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA PARA ANÁLISIS DE CURVAS DE DISOCIACIÓN DE ALTA RESOLUCIÓN (HRM) FRASCO 5 X 5 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 9606, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHF; 5´-56FAM ATGAAG GCC TTC GAG TCC CTC AAG TCC TTC-3' VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 423, "currency": "MXN" } } }, { "id": "0", "description": "TAE BUFFER (TRIS BASE, ACIDO ACETICO Y EDTA) 50X FCO 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1495, "currency": "MXN" } } }, { "id": "0", "description": "TAQ POLIMERASA VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1281, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20 FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 256, "currency": "MXN" } } }, { "id": "0", "description": "DIMETIL SULFÓXIDO, ESTÉRIL FRASCO 100 ML", "classification": { "scheme": "CUCOP", "id": "25401-7557" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 641, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE POLI-L-LISINA, ESTÉRIL BOTELLA 50 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3311, "currency": "MXN" } } }, { "id": "0", "description": "N,N,N’N’-TETRAMETILENDIAMINO 99% PARA ELECTROFORESIS FRASCO 50 ML", "classification": { "scheme": "CUCOP", "id": "25401-7843" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1488, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE DETECCIÓN PARA INMUNOHISTOQUÍMICA CON : 1 BLOQUEADOR; ANTICUERPO SECUNDARIO DE CABRA BIOTINILADO ANTIIGG DE CONEJO;ESTREPTAVIDINA-HRP; DAB (CROMÓGENO); PERÓXIDO DE HIDRÓGENO; Y HEMATOXILINA DE MAYER KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15239, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA INTERLEUCINA 1- BETA EN HOMOGENADOS DE TEJIDO Y CON REACTIVIDAD EN RATA PLACA DE 96 POZOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 15523, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA DE SANGRE COLUMNAS DE MEMBRANA DE SILICA MAXI SPIN CAPACIDAD 10ML KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2002, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PURIFICACIÓN DE RNA 50 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1632, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA EXTRACCIÓN DE DNA PLASMÍDICO, MIDI KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3514, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE DETECCIÓN SUPER SENSIBLE (LINK-LABEL) INTERACCIÓN STREPTAVIDIN-BIOTIN, PARA INMUNOHISTOQUÍMICA. KIT QUE INCLUYE MULTI-LINK CON UNA MEZCLA DE IGG ANTI-RATÓN Y ANTI-CONEJO CONJUGADAS CON MÚLTIPLES MOLÉCULAS DE BIOTINA Y UNA MARCA PARA ESTREPAVIDINA CONJUGADA CON UNA ENZIMA (PEROXIDASA DE RÁBANO HRP) KIT DE DOS BOTELLAS DE 110 ML CADA UNA", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14493, "currency": "MXN" } } }, { "id": "0", "description": "CARBONATO DE SODIO FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7736" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2072, "currency": "MXN" } } }, { "id": "0", "description": "CITRATO DE SODIO DIHIDRATADO CRISTALES FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-1025" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 619, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE CALCIO FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25301-1924" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 5490, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE LITIO, PUREZA MAYOR A 99%, GRADO BIOLOGÍA MOLECULAR FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25401-7585" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1068, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE ORO (III) TRIHIDRATADOHAUCL4 · 3H2O FRASCO 5 G", "classification": { "scheme": "CUCOP", "id": "25401-7588" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 14560, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE POTASIO, ACS, =99,0% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7805" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 320, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE SODIO, GRADO ACS =99,0% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7590" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 384, "currency": "MXN" } } }, { "id": "0", "description": "D-GLUCOSA ANHIDRA FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-5521" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1132, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE SODIO MONOBÁSICO PUREZA 99% FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25101-0049" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 961, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE SODIO DIBÁSICO ANHIDRO PUREZA 99% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7615" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 534, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO MONOBÁSICO DE POTASIO ACS, =99,0% FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7614" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 427, "currency": "MXN" } } }, { "id": "0", "description": "L-(+)-FRUCTUOSA VIAL 50 MG", "classification": { "scheme": "CUCOP", "id": "25401-6855" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3802, "currency": "MXN" } } }, { "id": "0", "description": "MONOFOSFATO CÍCLICO DE ADENOSINA - TRIS SAL FRASCO 500 MG", "classification": { "scheme": "CUCOP", "id": "25401-6813" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8010, "currency": "MXN" } } }, { "id": "0", "description": "MONOFOSFATO DE N 6,2'-O-DIBUTIRIL ADENOSINA 3',5'-CÍCLICO SAL SÓDICA FRASCO 100 MG", "classification": { "scheme": "CUCOP", "id": "25401-6813" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2328, "currency": "MXN" } } }, { "id": "0", "description": "N-HIDROXISUCINIMIDA (NHS) PUREZA 98% FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25901-1873" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 854, "currency": "MXN" } } }, { "id": "0", "description": "PHOSPHATE BUFFERED SALINE (PBS) 100 TABLETAS", "classification": { "scheme": "CUCOP", "id": "25401-7117" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 846, "currency": "MXN" } } }, { "id": "0", "description": "PIRUVATO DE SODIO FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25401-7465" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1175, "currency": "MXN" } } }, { "id": "0", "description": "PONCEAU-S, SODIUM SALT FRASCO 50 G", "classification": { "scheme": "CUCOP", "id": "25401-6076" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1965, "currency": "MXN" } } }, { "id": "0", "description": "SR 95531 HYDROBROMIDE BOTE 10 MG", "classification": { "scheme": "CUCOP", "id": "25301-4038" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 3097, "currency": "MXN" } } }, { "id": "0", "description": "STREPTOZOTOCIN FRASCO 1 G", "classification": { "scheme": "CUCOP", "id": "25901-1192" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2221, "currency": "MXN" } } }, { "id": "0", "description": "TRIS, ULTRAPURO GRADO BIOLOGÍA MOLECULAR FRASCO 1 KG", "classification": { "scheme": "CUCOP", "id": "25401-7392" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1239, "currency": "MXN" } } }, { "id": "0", "description": "TRIS-HCL, PUREZA = 98%, GRADO BIOLOGÍA MOLECULAR FRASCO 500 G", "classification": { "scheme": "CUCOP", "id": "25401-7781" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 1051, "currency": "MXN" } } }, { "id": "0", "description": "2X LAEMMLI SAMPLE BUFFER, PREMIXED PROTEIN FRASCO 30 ML", "classification": { "scheme": "CUCOP", "id": "25401-7392" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1146, "currency": "MXN" } } }, { "id": "0", "description": "BLOTTING-GRADE BLOCKER, NONFAT DRY MILK FRASCO 300 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1153, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE 8 A 240KDA PRETEÑIDO 2 TUBOS DE 500 µL", "classification": { "scheme": "CUCOP", "id": "25501-0067" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 4064, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE PVDF 30 X 3.5 M ROLLO 3.5 M", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7774, "currency": "MXN" } } }, { "id": "0", "description": "CAJA/RACK CON PUNTAS CLARAS PARA MICROPIPETA VOLUMEN DE 1 A 10 MICROLITROS, AUTOCLAVABLES, LIBRES DE PIRÓGENOS RACK 96 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6675" }, "quantity": 70, "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "CRYSTAL CRUZ™ ADHESIVE MICRO SLIDES, 72/P 692.00 34,600.00 CAJA", "classification": { "scheme": "CUCOP", "id": "25401-0549" }, "quantity": 50, "unit": { "name": "PIEZA", "value": { "amount": 485, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA CUBIERTA EPÓXICA PARA TUBOS DE ENSAYO DE 16 MM PARA 72 TUBOS (6 X 12), MEDIDAS 4 5/8\" L X 9 1/4\" ANCHO, 2 1/2 ALTO PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8085" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 208, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE POLIPROPILENO DE 0.2 ML PARA PCR, CÓNICO, TRANSPARENTE, AUTOCLAVEABLE, LIBRE DE PIRÓGENOS, TAPA PLANA BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8029" }, "quantity": 30, "unit": { "name": "PIEZA", "value": { "amount": 366, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE POLIPROPILENO DE 1.5 ML, TRANSPARENTE, AUTOCLAVEABLE, LIBRE DE PIRÓGENOS, TAPA PLANA BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8031" }, "quantity": 37, "unit": { "name": "PIEZA", "value": { "amount": 244, "currency": "MXN" } } }, { "id": "0", "description": "PARAFILM, ROLLO DE 4 PULGADAS X 125 PIES ROLLO", "classification": { "scheme": "CUCOP", "id": "25501-0103" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 600, "currency": "MXN" } } }, { "id": "0", "description": "PUNTA AMARILLA PARA MICROPIPETA DE 200µL. FABRICADAS DE POLIPROPILENO BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6679" }, "quantity": 58, "unit": { "name": "PIEZA", "value": { "amount": 116, "currency": "MXN" } } }, { "id": "0", "description": "PUNTA AZUL PARA MICROPIPETA DE 1000µL. FABRICADAS DE POLIPROPILENO, ESTÉRIL BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6680" }, "quantity": 22, "unit": { "name": "PIEZA", "value": { "amount": 153, "currency": "MXN" } } }, { "id": "0", "description": "PUNTA CLARA PARA MICROPIPETA DE 10µL. FABRICADAS DE POLIPROPILENO BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0095" }, "quantity": 45, "unit": { "name": "PIEZA", "value": { "amount": 152, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CÓNICO DE 2.0 ML PARA CENTRÍFUGA, DE POLIPROPILENO CON TAPA, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS BOLSA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8031" }, "quantity": 16, "unit": { "name": "PIEZA", "value": { "amount": 145, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CÓNICO DE 50 ML PARA CENTRÍFUGA, DE POLIPROPILENO, GRADUACIONES IMPRESAS Y MEMBRETE, LIBRE DE PIRÓGENOS CON TAPA DE ROSCA CJAS 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8028" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1731, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE POLIPROPILENO DE PAREDES FINAS PARA PCR, PARA PIPETAS DE 0.5 ML, ESTÉRIL BOLSA 500 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8023" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 229, "currency": "MXN" } } }, { "id": "0", "description": "AGAR DE MUELLER HINTON MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 1359.12, "currency": "MXN" } } }, { "id": "0", "description": "AGAR DEXTROSA SABOURAUD MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 850.92, "currency": "MXN" } } }, { "id": "0", "description": "AGAR SALMONELLA SHIGELLA MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1412.88, "currency": "MXN" } } }, { "id": "0", "description": "BASE DE AGAR GC FRASCO MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1224.72, "currency": "MXN" } } }, { "id": "0", "description": "BASE DE AGAR SANGRE MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 6, "unit": { "name": "PIEZA", "value": { "amount": 1354.08, "currency": "MXN" } } }, { "id": "0", "description": "CALDO DE SOYA TRIPTICASEÍNA MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 801.36, "currency": "MXN" } } }, { "id": "0", "description": "CALDO MR-VP MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1039.92, "currency": "MXN" } } }, { "id": "0", "description": "CALDO SELENITO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1333.92, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODIO REACTIVO ANALÍTICO FRASCO DE 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 335.4, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO MIO MEDIO DE CULTIVO FRASCO 450 G Ó 500 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1664.04, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACAS 96 POZOS FONDO EN U, NO ESTÉRIL CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 1066.76, "currency": "MXN" } } }, { "id": "0", "description": "SOPORTE DE CARRUSEL GIRATORIO PARA PIPETAS AUTOMATICAS 6 PLAZAS PIEZA", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 2538.78, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO, SIN POLVO, CHICO (COLOR MORADO) CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8248" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 118.05, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO, SIN POLVO, GRANDE (COLOR AZUL) CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8250" }, "quantity": 10, "unit": { "name": "PIEZA", "value": { "amount": 118.05, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO, SIN POLVO, MEDIANO (COLOR MORADO) CAJA 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8249" }, "quantity": 20, "unit": { "name": "PIEZA", "value": { "amount": 118.05, "currency": "MXN" } } }, { "id": "0", "description": "ANTI ¿ GLUTAMIL CISTEIN SINTETASA HECHO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11755.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTI OPA-1 PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTI TIROSINA HIDROXILASA HECHA EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTI TUBULINA ACTINA PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5025.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTI TUBULINA ACTINA PRODUCIDO EN RATÓN VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5025.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-GLUTAMATE RECEPTOR NMDAR2A (NR2A) ANTIBODY PRODUCED IN RABBIT, POLYCLONAL, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 8417.71, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-TNF-ALPHA VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8417.71, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ALFA TUBULINA CONTROL DE CARGA, MONOCLONAL HECHO EN RATÓN; REACTIVIDAD CONTRA HUMANO, RATA Y RATÓN VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5025.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI BETA ACTINA, CONTROL DE CARGA, MONOCLONAL, HECHO EN RATÓN; REACTIVIDAD CONTRA HUMANO, RATA Y RATÓN VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4326.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI DNA-DEPENDENT PROTEIN KINASE (DNA-PK)  REACTIVA A HUMANO, FUENTE: CONEJO VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ERK1/2 FOSFORILADA DE HUMANO Y RATÓN PRODUCIDO EN CONEJO VIAL 200 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI FOSFO-DNA-PKCS (SER2056) (E9J4G) , REACTIVIDAD A HUMANO, FUENTE: CONEJO IGG VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI NFKB P65 FOSFORILADO DE HUMANO Y RATÓN, PRODUCIDO EN CONEJO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI PKC ALPHA FOSFORILADA DE HUMANO Y RATÓN PRODUCIDO EN CONEJO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-ALFA SINUCLEINA FOSFORILADA (SERINA 129) HUMANA HECHA EN CONEJO (CLONA JB22-44, ISOTIPO IGG) QUE RECONOZC LA SERINA 129 (M-P-S(P)-E-E) DERIVADA DE LA ALFASINUCLEÍNA HUMANA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CD9 DE HUMANO HECHO EN CONEJO (ISOTIPO IGG1) QUE RECONOZCA LOS RESIDUOS DE AMINOÁCIDOS 21-51 DE AMINOÁCIDOS DE LA REGIÓN N-TERMINAL DEL CD9 HUMANO VIAL 400 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-DOUBLECORTIN 3E1 MOUSE AB VIAL 50 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 5855.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-HTR1B PRODUCIDO EN CONEJO VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-VCAM-1 (CD106), REACTIVIDAD A HUMANO, A RATA Y RATÒN, FUENTE: CONEJO/IGG MONOCLONAL RECOMBINANTE, 1MG/ML VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CMYC VÍAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI FGF23 DE HUMANO Y RATÓN, HECHO EN CONEJO VIAL 200 µG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-CD11B/C ACOPLADO A ALEXAFLUOR 488 CONTRA RATA PRODUCIDO EN RATÓN VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 865.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-ß-ACTINA CONJUGADA CON PEROXIDASA, PRODUCIDO EN RATÓN, ESPECIES REACTIVAS: RATA Y RATÓN VIAL 200 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 6336.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE CONEJO CONTRA M6A (M6A RABBIT MONOCLONAL ANTOBODY) 100UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE CONEJO DIRIGIDO CONTRA AKT1 FOSFORILADO (SER473) DIRIGIDO CONTRA HUMANO, RATON Y RATA PARA TECNICAS DE WB 100 MICROLITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI NRF2 DE HUMANO, RATA, RATÓN OBTENIDO EN CONEJO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI RECEPTOR A CANNABINOIDE TIPO1 (CB1) DE HUMANO O RATA OBTENIDO EN CONEJO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI-5HT-1A, ESPECIES REACTIVAS: RATÓN, RATA, HUMANO VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI-NMDANR2B PRODUCIDO EN CONEJO, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI-NMDAR1 PRODUCIDO EN CONEJO, ESPECIES REACTIVAS: RATA, RATÓN Y HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 10138.4, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI-SUPERÓXIDO DISMUTASA 1, ESPECIES REACTIVAS: HUMANO, RATA Y RATÓN. HOSPEDERO IGG CONEJO VIAL 50 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 4763.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL ANTI-TNF-A PRODUCIDO EN CONEJO, ESPECIES REACTIVAS: RATA, RATÓN, HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8417.71, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL BNDF 1 VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO ANTI-HSF-1, REACTIVIDAD CONTRA HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11755.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO AQUAPORINA-4 VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO CONTRA FTO HUMANA (HUMAN FTO RABBIT POLYCLONAL ANTIBODY) 100UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO CONTRA PCIF1 HUMANA (HUMAN PCIF1 RABBIT POLYCLONAL ANTIBODY) 100UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO DIRIGIDO CONTRA CNR1 DE HUMANO, RATON Y RATA PARA TECNICAS DE WB, IHC, FACS 100 MICROLITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO, ANTI-BAX; CONTRA HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL DE CONEJO, ANTI-HSP90 (A/ß). REACTIVIDAD CONTRA RATA Y HUMANO VIAL 200 µG/1.0 ML DE PBS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 11755.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL IL-1, POLICLONAL, ESPECIE REACTIVA: RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-CCBL1/KAT1, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-IDO1, PRODUCIDO EN CONEJO, ISOTIPO IGG1, PARA RATÓN Y HUMANO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRIMARIO ANTI-KYNU, PRODUCIDO EN CONEJO, PARA HUMANO, RATA Y RATÓN, 100 UL VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA AMPK ALFA FOSFORILADA EN LA TREONINA 172 DE RATÓN, RATA, HUMANO Y MONO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA HISTONA H3 ACETILADA EN LA LISINA 9 Y LISINA 14 DE RATÓN, RATA, HUMANO, MONO Y S. CEREVISIAE VIAL 300 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 13066.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PRODUCIDO EN CONEJO DIRIGIDO CONTRA LA PROTEÍNA MAP2 DE RATÓN, RATA, HUMANO Y MONO VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO POLICLONAL PURIFICADO ANTI-TUBULINA ß 3 (TUBB3) VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 9133.3, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO ANTI-GAPDH PRODUCIDO EN CONEJO, REACTIVIDAD EN RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8958.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-PROTEÍNA GLIAL FIBRILAR (GFAP), PRODUCIDO EN CONEJO PARA HUMANO, RATÓN Y RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PRIMARIO MONOCLONAL ANTI-TUJ1, PRODUCIDO EN RATÓN, PARA HUMANO RATÓN Y RATA VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO DE CABRA, ALEXA FLUOR PLUS 488 VIAL 100 µG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 405 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN CABRA, ACOPLADO A ALEXA FLUOR 488 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-CONEJO IGG (H+L), PRODUCIDO EN RATÓN, ACOPLADO A HRP VIAL 100 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 2403.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-IGG (H+L) HECHO EN BURRO (ISOTIPO IGG1 ) ACOPLADO A PEROXIDASA DE RÁBANO PICANTE (HRP) VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN DE CABRA, ALEXA FLUOR 488 VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI-RATÓN IGG (H+L), PRODUCIDO EN BURRO, ACOPLADO A HRP VIAL 250 µL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO POLICLONAL PRODUCIDO EN CABRA ANTI-CONEJO IGG (H+L), ESPECIE REACTIVA: CONEJO VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1748, "currency": "MXN" } } }, { "id": "0", "description": "CABRA ANTI-CONEJO IGG H&L (HRP) VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1748, "currency": "MXN" } } }, { "id": "0", "description": "CABRA ANTI-RATON IGG H&L (HRP) VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1748, "currency": "MXN" } } }, { "id": "0", "description": "CONEJO ANTI-ERK1/2 CLONA Y72 VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7625.65, "currency": "MXN" } } }, { "id": "0", "description": "CONEJO ANTI-NFKB VIAL 100 UL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "CONEJO ANTI-PP53 CLONA D4S1H VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 8914.8, "currency": "MXN" } } }, { "id": "0", "description": "CONEJO ANTI-STAT3 CLONA EPR787Y VIAL 1MG/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 7166.8, "currency": "MXN" } } }, { "id": "0", "description": "FLUORÓFORO ALEXA 488 ANTI-CONEJO, CREADO EN BURRO VIAL 1 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 3015.3, "currency": "MXN" } } }, { "id": "0", "description": "FLUORÓFORO ALEXA 594 ANTI-RATÓN, CREADO EN CABRA VIAL 500 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1922.8, "currency": "MXN" } } }, { "id": "0", "description": "GOAT ANTIHUMAN IGG MARCADO CON PEROXIDASA DE RABANO VIAL 1ML", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1748, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HPH I VIAL 1500 UNIDADES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2633.4, "currency": "MXN" } } }, { "id": "0", "description": "GLICEROL GRADO BIOLOGÍA MOLECULAR FRASCO 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1604.66, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESOS MOLECULARES CON FLUOROCROMO LIZ PARA CUANTIFICAR FRAGMENTOS DE DNA CON UN INTERVALO DE 35 A 500 NUCLEOTIDOS, DIVIDIDO EN 16 FRAGMENTOS COMPATIBLE CON EQUIPO DE ELECTROFORESIS CAPILAR (ABI 3130, AB3100, 3130, 3500) VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1345.2, "currency": "MXN" } } }, { "id": "0", "description": "MASTER MIX PARA 100 REACCIONES DE PCR VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1031.02, "currency": "MXN" } } }, { "id": "0", "description": "SEPHADEX G50 O SEFAROSA DE PORO MEDIO EN POLVO PARA FILTRACIÓN EN GEL.M R >30 000 DE MOLÉCULAS MR<1500 FRASCO 100 G", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 307.8, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 19 MER, ABC2677R1 ; 5’-GTT TGA CTC ACC TTC CCA G-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC1236R; 5’-CCT GAC TCA CCA CAC CAA TG-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC2677F; 5’-TGC AGG CTA TAG GTT CCA GG-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435F ; 5’-TGT TTT CAG CTG CTT GAT GG-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435R; 5’-AAG GCA TGT ATG TTG GCC TC-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, CYP3A4*1BF; 5´-TCC AGG CAT AGG TAA AGA TC-3´ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; C677T-R; 5'-AGG ACG GTG CGG TGA GAG TG-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 324, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A4*1BR; 5´-AAT CTA TTA AAT CGC CTC TCA-3´ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 340.2, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3F; 5'-CAT CAG TTA GTA GAC AGA TGA-3' VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 340.2, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3R; 5'-GGT CCA AAC AGG GAA GAA ATA-3' VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 340.2, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22 MER, ABC1236F; 5’-TAT CCT GTC TCT GTG AAT TGC C-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 356.4, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; A1298T-R; 5'-CAC TTT GTG ACC ATT CCG GTT TG-3´ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 372.6, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; C677T-F: 5'-TGA AGG AGA AGG TGT CTG CGG GA-3’ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 372.6, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; A1298T-F; 5'-CTT TGG GGA GCT GAA GGA CTAC TAC-3´ VIAL 80,000 PMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 405, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHR; 5´GGC GGT GGC GGC TGT TGC TGC TGC TGC TGC - 3´ VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 486, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS DE 18 PB, DESALADOS Y LIOFILIZADOS VIAL", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 145.8, "currency": "MXN" } } }, { "id": "0", "description": "MICROPERLAS DE SEPARACIÓN MAGNÉTICA PARA AISLAMIENTO DE CÉLULAS CD11B+ (MICROGLÍAS) DE RATÓN Y DE HUMANO PARA 1X10E08 CÉLULAS TOTALES, COMPATIBLES PARA COLUMNAS DE SEPARACIÓN MAGNÉTICA TIPO LS FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 4, "unit": { "name": "PIEZA", "value": { "amount": 13565.34, "currency": "MXN" } } }, { "id": "0", "description": "MICROPERLAS DE SEPARACIÓN MAGNÉTICA PARA AISLAMIENTO DE CÉLULAS GLAST+ (ASTROCITOS) DE RATÓN Y DE HUMANO PARA 5X10E07 CÉLULAS TOTALES, COMPATIBLES PARA COLUMNAS DE SEPARACIÓN MAGNÉTICA TIPO LS FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1513.26, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE AISLAMIENTO DE NEURONAS DE RATÓN CON MICROPERLAS ANTI-BIOTINA, COMPATIBLES CON COLUMNAS LS PARA 5X10E08 CÉLULAS", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 1945.63, "currency": "MXN" } } }, { "id": "0", "description": "CRIOCAJA DE CARTÓN PARA ALMACENAR TUBOS EN NITRÓGENO LÍQUIDO CON DIVISOR PARA 81 LUGARES PAQUETE 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 201.9, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS PARA JERINGA DE 25 MM, TAMAÑO DE PORO 0.22 MICRAS CON MEMBRANA DE POLIETERSULFONA (PES) ESTÉRILES CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6267" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 1627.18, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE VIDRIO ÁMBAR CON TAPA DE ROSCA DE 50 ML PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-6275" }, "quantity": 25, "unit": { "name": "PIEZA", "value": { "amount": 507.66, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA METÁLICA PARA TUBOS; 12 LUGARES DE 25 MM; DIMENSIONES: DIMENSIONES: 164X64X32 PIEZA", "classification": { "scheme": "CUCOP", "id": "25401-8084" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 364.67, "currency": "MXN" } } }, { "id": "0", "description": "MICROPLACA DE POLIESTIRENO DE 96 POZOS CON FONDO EN U, ESTÉRIL, CON TAPA, CON IDENTIFICACIÓN ALFANUMÉRICA, EMPACADA INDIVIDUALMENTE CAJA 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2227.97, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE POLIPROPILENO DE 0.2 ML, TRANSPARENTE, NO ESTÉRIL, TAPA PLANA EN TIRA CON 8 TUBOS, SE REQUIEREN TAPAS ABAJO BOLSA 125 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8029" }, "quantity": 52, "unit": { "name": "PIEZA", "value": { "amount": 713.07, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE POLIPROPILENO DE 1.5 ML, ÁMBAR, AUTOCLAVEABLE, LIBRE DE PIRÓGENOS, TAPA PLANA BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0454" }, "quantity": 1, "unit": { "name": "PIEZA", "value": { "amount": 579.08, "currency": "MXN" } } }, { "id": "0", "description": "MICROVIAL DE VIDRIO CON CUELLO (TRANSPARENTE, DIÁMETRO 5.5 MM, ALTURA 31.5 MM, FONDO REDONDO, CAPACIDAD: 300 MICROLITROS) PAQUETE 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0133" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 452.34, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CULTIVO DE ESFERAS CELULARES DE 24 POZOS CON TAPA, 1.9 CM2 DE ÁREA, ESTÉRIL, LIBRE DE PIROGÉNOS CAJA 7 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-6407" }, "quantity": 2, "unit": { "name": "PIEZA", "value": { "amount": 2838.74, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CÓNICO DE 0.6 ML PARA CENTRÍFUGA, DE POLIPROPILENO CON TAPA, LIBRES DE DNASAS, RNASAS Y PIRÓGENOS BOLSA 1000 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25401-8024" }, "quantity": 8, "unit": { "name": "PIEZA", "value": { "amount": 450.63, "currency": "MXN" } } }, { "id": "0", "description": "FIB – TEM 10 X 5 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DEL CONTENIDO DE FIBRINOGENO Y POLIMERIZACIÓN DE FIBRINA MEDIANTE TROMBOELASTOMETRÍA. COMPONENTES: CITOCALASINA D, CACL2 Y CONSERVANTES) CAJA CON 10 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 12, "unit": { "name": "PIEZA", "value": { "amount": 22000, "currency": "MXN" } } }, { "id": "0", "description": "HEP – TEM 10 X 7 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA LA EVALUACIÓN DE LA PRESENCIA DE HEPARINA EN LA VÍA INTRÍNSECA DE LA COAGULACIÓN MEDIANTE EL USO DE LA TROMBOELASTOMETRÍA. COMPONENTES DE LIOFILIZADO: HEPARINASA DE FLAVOBACTERIAS, CONSERVANTES) CAJA CON 5 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 3, "unit": { "name": "PIEZA", "value": { "amount": 38385, "currency": "MXN" } } }, { "id": "0", "description": "IN – TEM 10 X 10 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DE LA COAGULACIÓN MEDIANTE ACTIVACIÓN DE LA VÍA INTRINSECA Y LA INFLUENCIA DE ANTICOAGULANTES. COMPONENTES: FOSFOLIPIDO-TROMBOPLASTINA PARCIAL DEL CEREBRO DE CONEJO, ÁCIDO ELAGICO Y CONSERVANTES) CAJA CON 5 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 11, "unit": { "name": "PIEZA", "value": { "amount": 28310, "currency": "MXN" } } }, { "id": "0", "description": "R EX – TEM 10 X 10 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DE LA COAGULACIÓN MEDIANTE ACTIVACIÓN DE LA VÍA EXTRINSECA EN LA TROMBOELASTOMETRÍA. COMPONENTES: FACTOR TISULAR RECOMBINANTE Y FOSFOLIPIDOS, INHIBIDOR DE LA HEPARINA Y CONSERVANTES) CAJA CON 10 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 11, "unit": { "name": "PIEZA", "value": { "amount": 32120, "currency": "MXN" } } }, { "id": "0", "description": "ROTROL N 5 X 4 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA VERIFICAR SEMANALMENTE EL FUNCIONAMIENTO DEL EQUIPO, CON RELACIÓN A UNA MUESTRA NORMAL. COMPONENTES: EL PLASMA DE CONTROL LIOFILIZADO SE OBTIENE DE PLASMA HUMANO EXTRAÍDO CON CITRATO SODICO COMO ANTICOAGULANTE (0.129 MOL/L). CONTENIDO: LIOFILIZADO 4 PRUEBAS, DILUYENTE 1300 MICROLITROS) CAJA CON 5 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 16075, "currency": "MXN" } } }, { "id": "0", "description": "ROTROL P 5 X 4 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA VERIFICAR SEMANALMENTE EL FUNCIONAMIENTO DEL EQUIPO, CON RELACIÓN A UNA MUESTRA NORMAL. COMPONENTES: EL PLASMA DE CONTROL LIOFILIZADO SE OBTIENE A PARTIR DE PLASMA HUMANO EXTRAÍDO CON CITRATO SODICO COMO ANTICOAGULANTE (0.129 MOL/L). CONTENIDO: LIOFILIZADO 4 PRUEBAS, DILUYENTE 1300 MICROLITROS) CAJA CON 5 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 5, "unit": { "name": "PIEZA", "value": { "amount": 17515, "currency": "MXN" } } }, { "id": "0", "description": "STAR – TEM 10 X 10 (REACTIVO PARA LA RECALCIFICACIÓN DE LA SANGRE CITRATADA PARA LA REALIZACIÓN DE PRUEBAS DE TROMBOELASTOMETRÍA. COMPONENTES: CACL2 Y CONSERVANTES) CAJA CON 10 VIALES", "classification": { "scheme": "CUCOP", "id": "25101-0037" }, "quantity": 14, "unit": { "name": "PIEZA", "value": { "amount": 12100, "currency": "MXN" } } } ], "documents": [ { "id": "1", "title": "1.-CONVOCATORIA LPI 2024 S.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:29.426Z" }, { "id": "2", "title": "ACTA DE DIFERIMIENTO DE FALLO.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:56.199Z" }, { "id": "3", "title": "1_ANEXO TECNICO SUST.QUIM Y MAT DE LAB DIR MED ac.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:33.904Z" }, { "id": "4", "title": "2_ANEXO TECNICO DIR. INVES.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:40.396Z" }, { "id": "5", "title": "LISTADO DE PARTIDAS A COTIZAR.xlsx", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:41.592Z" }, { "id": "6", "title": "MODELO DE CONTRATO.docx", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:25.569Z" }, { "id": "7", "title": "ACTA 1ER JUNTA DE ACLARACIONES SQ OK.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:43.042Z" }, { "id": "8", "title": "ACTA 2DA JUNTA DE ACLARACIONES SQ 2.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:44.725Z" }, { "id": "9", "title": "ACTA DE REPREGUNTAS Y CIERRE.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:46.402Z" }, { "id": "10", "title": "ACTA DE PAP SUSTANCIAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:50.443Z" }, { "id": "11", "title": "ACTA DE DIFERIMIENTO DE FALLO.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:56:52.008Z" }, { "id": "12", "title": "ACTA DE FALLO SUSTANCIAS QUIMICAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/d47e69a0c554485d80c4abe2efc17874/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T10:57:05.295Z" } ] }, "awards": [ { "id": "1", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV" } ], "value": { "amount": 509578.72, "currency": "MXN" } }, { "id": "2", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "ABYNTECH SA DE CV", "name": "ABYNTECH SA DE CV" } ], "value": { "amount": 7705025.31, "currency": "MXN" } }, { "id": "3", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "ACCESORIOS PARA LABORATORIOS SA DE CV", "name": "ACCESORIOS PARA LABORATORIOS SA DE CV" } ], "value": { "amount": 976807.47, "currency": "MXN" } }, { "id": "4", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS SA DE CV", "name": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS SA DE CV" } ], "value": { "amount": 11105725.67, "currency": "MXN" } }, { "id": "5", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "BIOADVANCED SYSTEMS SA DE CV", "name": "BIOADVANCED SYSTEMS SA DE CV" } ], "value": { "amount": 226724.26, "currency": "MXN" } }, { "id": "6", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "CIENTIFICA SENNA SA DE CV", "name": "CIENTIFICA SENNA SA DE CV" } ], "value": { "amount": 1435106.44, "currency": "MXN" } }, { "id": "7", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV" } ], "value": { "amount": 1031032.36, "currency": "MXN" } }, { "id": "8", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "COMPAÑIA VILAB SA DE CV", "name": "COMPAÑIA VILAB SA DE CV" } ], "value": { "amount": 737483.92, "currency": "MXN" } }, { "id": "9", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV" } ], "value": { "amount": 1731113.24, "currency": "MXN" } }, { "id": "10", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "name": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV" } ], "value": { "amount": 16111425.6, "currency": "MXN" } }, { "id": "11", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "DESARROLLO QUIMICO HELU SA DE CV", "name": "DESARROLLO QUIMICO HELU SA DE CV" } ], "value": { "amount": 473713.84, "currency": "MXN" } }, { "id": "12", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "DIAGNOCELL LABORATORIOS SA DE CV", "name": "DIAGNOCELL LABORATORIOS SA DE CV" } ], "value": { "amount": 78698.39, "currency": "MXN" } }, { "id": "13", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "MEXICO BIOCARE REPRESENTANTE SA DE CV", "name": "MEXICO BIOCARE REPRESENTANTE SA DE CV" } ], "value": { "amount": 348044.42, "currency": "MXN" } }, { "id": "14", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "MIGUEL CASTILLO FLORES", "name": "MIGUEL CASTILLO FLORES" } ], "value": { "amount": 271897.04, "currency": "MXN" } }, { "id": "15", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "PRODUCTOS Y EQUIPOS BIOTECNOLOGICOS SA DE CV", "name": "PRODUCTOS Y EQUIPOS BIOTECNOLOGICOS SA DE CV" } ], "value": { "amount": 144176.86, "currency": "MXN" } }, { "id": "16", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "QUIMICA INDUSTRIAL Y DE SALUD SA DE CV", "name": "QUIMICA INDUSTRIAL Y DE SALUD SA DE CV" } ], "value": { "amount": 190231.75, "currency": "MXN" } }, { "id": "17", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "name": "REACTIVOS Y MARCAS DE MEXICO SA DE CV" } ], "value": { "amount": 307847.75, "currency": "MXN" } }, { "id": "18", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV" } ], "value": { "amount": 2487168.76, "currency": "MXN" } }, { "id": "19", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "UNIPARTS SA DE CV", "name": "UNIPARTS SA DE CV" } ], "value": { "amount": 871821.9, "currency": "MXN" } }, { "id": "20", "status": "active", "date": "2024-06-05T22:00:00.000Z", "suppliers": [ { "id": "VITALMEX COMERCIAL SA DE CV", "name": "VITALMEX COMERCIAL SA DE CV" } ], "value": { "amount": 1602232.6, "currency": "MXN" } } ], "extensions": { "source": "ComprasMX", "canonical": "https://licitia.com.mx/licitacion/la-12-nck-012nck001-i-39-2024", "license": "https://creativecommons.org/licenses/by/4.0/", "ocidPrefixRegistered": false } }