{ "html_url": "https://licitia.com.mx/licitacion/la-12-nck-012nck001-i-8-2023", "canonical": "https://licitia.com.mx/licitacion/la-12-nck-012nck001-i-8-2023", "id": "f25eab7ab1774beb9b18f1576f9345ae", "procedure_number": "LA-12-NCK-012NCK001-I-8-2023", "file_number": "E-2023-00097113", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "description": { "short": "No existen bienes alternativos o sustitutos, Único Oferente, Derechos exclusivos (patentes, licencias, derechos de autor u otros derechos exclusivos), o por obras de arte.", "detailed": "LICITACIÓN PÚBLICA INTERNACIONAL ELECTRÓNICA A TIEMPOS RECORTADOS PARA LA ADQUISICIÓN DE: SUSTANCIAS QUÍMICAS, REACTIVOS Y MATERIAL DE LABORATORIO" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO PARCIAL", "moved_at": null }, "buyer": { "agency": "INNN", "acronym": "INNN", "branch": "12 - SALUD", "buying_unit": "DIRECCION DE ADMINISTRACION, SUBDIRECCION DE RECURSOS MATERIALES", "requesting_unit": "unidad requiriente data", "requesting_group": "DIRECCIÓN DE ADMINISTRACIÓN, SUBDIRECCIÓN DE RECURSOS MATERIALES", "entity": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "slug": "innn", "unit_slug": "direccion-de-administracion-subdireccion-de-recursos-materiales-012nck001" }, "classification": { "procedure_type": "LICITACIÓN PÚBLICA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "INTERNACIONAL ABIERTO", "fiscal_year": 2023, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "1", "exception_basis": "Art. 41 fr. I", "internal_control_number": "LPI-12230001-002-23", "supply_source_number": null }, "schedule": { "published_at": "2023-10-14T05:07:02.000Z", "clarification_meeting_at": "2023-10-24T16:00:00.000Z", "clarification_questions_deadline_at": "2023-10-23T16:00:00.000Z", "clarification_responses_deadline_at": null, "bid_opening_at": "2023-11-03T22:00:00.000Z", "award_at": "2023-11-13T15:30:00.000Z", "estimated_contract_at": "2023-11-14T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "2,-(4-HYDROXYPHENYLAZO) BENZOIC ACID PUREZA \t= 90 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "2", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "3-INDOLEACETIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "3", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "3-INDOLEPROPIONIC ACID ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "4", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ACIDO 2-3 PIRINEDICARBOXIL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "5", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO 2-TIOBARBITÚRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "6", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO ACÉTICO GLACIAL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "7", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO ASCÓRBICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "8", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO BICINCONINICO (SOLUCIÓN) ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "9", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ACIDO CÍTRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "10", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ACIDO CLORHÍDRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "11", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÀCIDO CLOROACÈTICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "12", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO DIHIDROFENILACÉTICO DOPAC PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "13", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO FOSFOMOLIBDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "14", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO FOSFOTUNGSTICOP ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "15", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO HOMOVANÍLICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "16", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO KAINICO MONOHIDRATADO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "17", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO NITRICO 70% GRADO REACTIVO,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "18", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO NITRICO70%, ALTA PUREZA PURIFIED BY REDISTILLATION, =99.999% TRACE METALS BASIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "19", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ACIDO PERYÓDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "20", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO VALPROICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "21", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "ÁCIDO XANTURÉNICO ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "22", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "HIDROXIDO DE AMONIO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "23", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "INDOLE-3-PROPIONIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "24", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "INDOLE-3-PYRUVIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "25", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "IRON(III) CHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "26", "cucop_code": "25101-0011", "specific_item_code": "25101", "cucop_description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)", "description": "TRIETILAMINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "27", "cucop_code": "25101-0063", "specific_item_code": "25101", "cucop_description": "AGUA BIDESTILADA", "description": "AGUA BIDESTILADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "21", "maximum_amount": "54" }, { "number": "28", "cucop_code": "25101-0062", "specific_item_code": "25101", "cucop_description": "AGUA DESIONIZADA", "description": "AGUA DESIONIZADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "40", "maximum_amount": "100" }, { "number": "29", "cucop_code": "25301-1052", "specific_item_code": "25301", "cucop_description": "010.000.1955.00 GENTAMICINA SOLUCION INYECTABLE 20 MG AMPOLLETA CON 2 ML", "description": "GENTAMICINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "30", "cucop_code": "25301-1048", "specific_item_code": "25301", "cucop_description": "010.000.5438.00 GEMCITABINA SOLUCION INYECTABLE 1 G FRASCO AMPULA", "description": "GENTAMICINA EN SOLUCIÓN DE 100 MG/ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "31", "cucop_code": "25301-1053", "specific_item_code": "25301", "cucop_description": "010.000.1954.00 GENTAMICINA SOLUCION INYECTABLE 80 MG AMPOLLETA CON 2 ML", "description": "GENTAMICINA 80MG/ 2ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "80", "maximum_amount": "200" }, { "number": "32", "cucop_code": "25301-1103", "specific_item_code": "25301", "cucop_description": "010.000.0621.00 HEPARINA SOLUCION INYECTABLE 10 000 UI/ 10 ML (1000 UI/ ML) 50 FRASCOS AMPULA CON 10 ML", "description": "HEPARINA 1000 UI/ML CAJA CON 1 FRASCO ÁMPULA DE 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "17", "maximum_amount": "44" }, { "number": "33", "cucop_code": "25301-1235", "specific_item_code": "25301", "cucop_description": "010.000.0232.00 ISOFLURANO LIQUIDO O SOLUCION 100 ML ENVASE CON 100 ML", "description": "ISOFLUORANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "20", "maximum_amount": "50" }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "(+)-MK-801HYDROGEN MALEATE 25MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMANTADINE HYDROCHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIMICINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "37", "cucop_code": "25301-3467", "specific_item_code": "25301", "cucop_description": "040.000.6215.00 CLORHIDRATO DE APOMORFINA", "description": "APOMORFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "38", "cucop_code": "25301-3467", "specific_item_code": "25301", "cucop_description": "040.000.6215.00 CLORHIDRATO DE APOMORFINA", "description": "APOMORFINA CLORHIDRATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAYTRIL 0.5% SOLUCIÓN INYECTABLE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAYTRIL SOLUCIÓN ORAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "41", "cucop_code": "25301-3467", "specific_item_code": "25301", "cucop_description": "040.000.6215.00 CLORHIDRATO DE APOMORFINA", "description": "BENZETACIL (BENZATINA BENCILPENICILINA), 1,200,000U, CAJA CON FRASCO ÁMPULA CON POLVO Y AMPOLLETA CON 3.0 DE DILUYENTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "16", "maximum_amount": "40" }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BENZONATATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "43", "cucop_code": "25301-2508", "specific_item_code": "25301", "cucop_description": "030.000.5234.01 D-BIOTINA CAPSULAS 5 MG ENVASE CON 60 CAPSULAS", "description": "BIOTINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBAMAZEPINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CEFOPERAZONA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELECOXIB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "47", "cucop_code": "25301-0809", "specific_item_code": "25301", "cucop_description": "010.000.0611.00 EPINEFRINA SOLUCION INYECTABLE 1 MG (1:1 000) 50 AMPOLLETAS DE 1.0 ML", "description": "EPINEFRINA 1MG/1ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ERGOLOIDES MESILATOS, FRASCO CON 300 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GABAPENTINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GENISTEÍNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICLAZIDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KAEMPFEROL, FRASCO CON 10 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KETAMINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KETAMINA 1G/10ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LACOSAMIDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-ASCORBIC ACID", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "57", "cucop_code": "25301-4394", "specific_item_code": "25301", "cucop_description": "LEVETIRACETAM", "description": "LEVETIRACETAM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIDOCAÍNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LUMEFANTRINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARAVIROC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "61", "cucop_code": "25301-3636", "specific_item_code": "25301", "cucop_description": "MEMANTINA", "description": "MEMANTINA HCL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "62", "cucop_code": "25301-3677", "specific_item_code": "25301", "cucop_description": "NATAMICINA SOLUCION OFTALMICA, FRASCO GOTERO CON 10 ML 50 MG.", "description": "NATAMICINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITAZOXANIDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OSTHOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OXCARBAZEPINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "66", "cucop_code": "25301-1685", "specific_item_code": "25301", "cucop_description": "010.000.0106.00 PARACETAMOL SOLUCION ORAL 100 MG/ML ENVASE CON GOTERO 15 ML", "description": "PARACETAMOL JARABE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PENTILENTETRAZOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PENTOBARBITAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIPERACILINA, FRASCO DE 1G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAQUINAVIR, FRASCO DE 10 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TEMOZOLOMIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILACINA 20MG/1ML, FRASCO DE 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "8", "maximum_amount": "20" }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO RETINOICO GRADO HPLC 98 % DE PUREZA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GRAMICIDIN A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZOLETIL50 (696MG/ 5 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZOLETIL (TILETAMINA HCL 250 MG Y ZOLAZEPAM HCL 250 MG)-ANESTÉSICO-SEDANTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "12", "maximum_amount": "30" }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TILETAMINA (COMO CLORHIDRATO)/ZOLAZEPAM (COMO CLORHIDRATO) 125MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MALEATO DE ACEPROMACINA 5 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "[KO VALIDATED] LAMIN A/C RABBIT MAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ACTIN (C-2)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AHR ANTIBODY [RPT1]", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ANTI RABBIT ACOPLADO A ALEXA 488", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HUMAN CD3 ACOPLADO A ALEXA FLUOR 488", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALEXA FLUOR 647 ANTI-HUMAN CD41", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMINOBUTYRIC ACID MONOCLONAL ANTIBODY (5A9) 25 ¿G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMPK¿ ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTCUERPO: MAP LC3¿/B (G-4).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI - TIROSINA HIDROXILASA RABBIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI CUERPO ANTI-A2B5", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI GALECTINA3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI GCLC RABBIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBODY ANTI GFAP", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBODY ANTI HIF-1 ALPHA MOUSE MAB (D5F3M)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI RATÓN F4/80 PE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-AADT(KAT II) (HUMANO, RATON, RATA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-BCL-2 (C-2) ANTICUERPO MONOCLONAL IGG1 (KAPPA LIGHT CHAIN) BCL-2 ANTIBODY.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUEPO ANTI-CONNEXIN 43 (D-7)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUEPO ANTI-NEUN (FOXO3)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI 1L-1 BETA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI 1L-6", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI ACTINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI ALFA ACTINA HUMANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI KLOTHO DE HUMANO Y RATON", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI TNF ALFA DE HUMANO, RATON, RATA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI FACTOR VON WILLEBRAND /VWF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CABRA-PE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-CASPASA 3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-FGF-2", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HIF-2 ALFA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-MOUSE IGG-TRITC.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-OCCLUDIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-TIROSINA HIDROXILASA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-VEGFA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ZO-1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BCL-2 ANTIBODY (1N2), N-TERM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CALPAIN 3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CASPASE 3 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CASPASE 9 ANTIBODY (N2C3)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CAVEOLIN-3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO DYSTROPHIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO GROWTH HORMONE ANTIBODY (N1C3)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO INTEGRINA BETA1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL ANTI-RABBIT IGG, PRODUCIDO EN RATÓN.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MONOCLONAL DE RATON ANTI-VDAC1 CLONA (B-6) ISOTIPO IGG1 (CADENA LIGERA KAPPA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO OPA1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO VS CABRA (SISTEMA DE TINCIÓN ABC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PRIMARIO VS RATÓN (SISTEMA DE TINCIÓN ABC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PROHIBITIN 2 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PROHIBITIN ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PROLACTIN ANTIBODY (N1C3)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PURIFICADO ANTI-TUBULIN ¿3 (TUBB3)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-CONEJO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-RATÓN 1ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO VS BAX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO VS CASPASA 9 (C9)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ¿-SARCOGLYCAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ¿-SARCOGLYCAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO G-SARCOGLYCAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ¿-SARCOGLYCAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO: ATG7 ANTIBODY (B-9).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO: ANTI-BAX.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO: ANTI-CYCLIN D3 (18B6-10).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO: WAF1/CIP1/CDKN1A P21.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-ERK1 (PT202/PY204) + ERK2 (PT185/PY187) ANTIBODY [EP197Y] (AB76299)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-ERK1 + ERK2 ANTIBODY [EPR17526]", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-GAPDH ANTIBODY, MOUSE MONOCLONAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IGG PRODUCED IN GOAT .", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-KATI (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-KMO (HUMAN, MOUSE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-KYAT3 (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-NF-KB P65 ANTIBODY PRODUCED IN RABBIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-NR4A2 (N-TERMINAL) ANTIBODY PRODUCED IN RABBIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-NRF2 ANTIBODY PRODUCED IN RABBIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-RABBIT IGG, HRP-LINKED ANTIBODY, 100 UL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC MOUSE ANTI-HUMAN CD25 CLONE 2A3 (RUO (GMP))", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC/CYANINE7 ANTI-HUMAN CD4 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC/CYANINE7 ANTI-MOUSE CD3 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APC/CYANINE7 MOUSE IGG2B, ¿ ISOTYPE CTRL ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATRX ANTIBODY (D-5), MOUSE MONOCLONAL IGG2A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAX ANTIBODY (B9), MOUSE MONOCLONAL IGG2B", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "162", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BETA TUBULIN 3/ TUJ1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI HUMAN CD63 BRILLIANT VIOLET 711", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BV421 MOUSE ANTI-TCF1 50UG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BV510 MOUSE ANTI LY108 50UG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BV605 ANTI-MOUSE CD185 125UL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "167", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBODY CASPASE 8 - RABBIT PAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "168", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBODY CASPASE-3 ANTIBODY (E-8), MOUSE MONOCLONAL IGG2A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI CASPASA-8, MONOCLONAL DE RATÓN IGG1 (KAPPA LIGHT CHAIN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "170", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CD11B POLYCLONAL ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "171", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD8 (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "172", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CDKN1B/P27KIP1 RABBIT PAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "173", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO C-FMS/CSF-1R ACOPLADOA ALEXA FLUOR 594", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "174", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CMYC ANTIBODY (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "175", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CX3CR1 ANTIBODY (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "176", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CYCLIN D1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "177", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOCHROME C ANTIBODY (7H8), MOUSE MONOCLONAL IGG2B.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "178", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "E-CALDHERIN ANTIBODY (G-10) IS A GOAT, MOUSE MONOCLONAL IGG1 (KAPPA LIGHT CHAIN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "179", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ERBB2/HER2 ACOPLADO A ALEXAFLUOR 680", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "180", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUORESCEIN (FITC)-AFFINIPUR RABBIT ANTI-GOAT IGG (H+L).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "181", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUORESCEIN (FITC)-AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "182", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GCLM RABBIT PAB (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "183", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUR-2 ANTICUERPO MONOCLONAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "184", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT ANTI-RABBIT IGG ANTIBODY (H+L), PEROXIDASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "185", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HDAC1 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "186", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HORSE ANTI-MOUSE IGG ANTIBODY (H+L), PEROXIDASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "187", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HRP ANTI-RABBIT IGG ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "188", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HSP90ALPHA/BETAANTICUERPO(F-8)PE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "189", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IBA1A ACOPLADO A LEXAFLUOR 680", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "190", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IGG ANTI CONEJO FITC DE CABRA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "191", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IGG ANTI RATÓN HRP DE CABRA 2 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "192", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO INTEGRIN¿M/CD11B ACOPLADO A ALEXAFLUOR 488 (MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "193", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KMO ANTIBODY N-TERMINAL REGION (HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "194", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LAMIN B1 RABBIT MAB - NUCLEAR LOADING CONTROL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "195", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO LAMP1 ACOPLADO A ALEXAFLUOR 405", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "196", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO LAMP2 (D5C2P) RABBIT MAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "197", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN NEUROINFLAMMATION PANEL 1 (13-PLEX)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "198", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MAB ANTI ACTINA DE RATÓN IGG1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "199", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MAB ANTI C-SRC DE RATÓN IGG2A 200 ¿G/ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "200", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MONOCLONAL ANTI-S100B ANTIBODY PRODUCED IN MOUSE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "201", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOUSE-ANTI GFAP/PE PRIMARY ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "202", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NAVL1 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "203", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO NCAM/CD56", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "204", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NMDA RECEPTOR NR2C SUBUNIT POLYCLONAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "205", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NMDA RECEPTOR NR2C SUBUNIT POLYCLONAL ANTIBODY 10 ¿G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "206", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NRF ANTICUERPO (A-10) DE RATÓN IGG1 (KAPPA LIGHT CHAIN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "207", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NRF1 ANTICUERPO (H-4)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "208", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OCCLUDIN ANTIBODY (E-5), MOUSE MONOCLONAL IGG2B (KAPPA LIGHT CHAIN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "209", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAQUETEDECORONAVIRUS(FIPV3-70):M-IGGFCBP-HRP100 ¿G AB; 10 ¿G BP", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "210", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-HUMAN CD25 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "211", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-MOUSE CD279 (PD-1) ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "212", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE ANTI-MOUSE CD3 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "213", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PE/CYANINE7 ANTI-MOUSE CD274 (B7-H1, PD-L1) ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "214", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERCP ANTI-HUMAN CD279 (PD-1)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "215", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERCP MOUSE IGG1, ¿ ISOTYPE CTRL ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "216", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASE-AFFINIPURE 1.50M GOAT ANTI-RABBIT IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "217", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-GOAT IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "218", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-HUMAN IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "219", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHOSPHO-ULK1 (SER317) ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "220", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PURIFIED ANTI-MOUSE F4/80 ANTIGEN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "221", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QPRT RABBIT PAB ANTIBODY(HUMAN, MOUSE, RAT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "222", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT ANTI-BDNF ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "223", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RECOMBINANT ANTI-L-KYNURENINE HYDROLASE ANTIBODY BSA AND AZIDE FREE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "224", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RHODAMINE (TRITC)–CONJUGATED GOAT ANTI-RABBIT IGG(H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "225", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RHODAMINE RED-X-AAFFINI PURE GOAT ANTI-RABBIT IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "226", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RHODAMINE RED-X-AFFINIPURE GOAT ANTI-MOUSE IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "227", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RHODAMINE RED-X-CONJUGATED AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "228", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RHODAMINE RED-X-CONJUGATED AFFINIPURE RA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "229", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SARS/SARS-COV-2 SPIKE PROTEIN S2 MONOCLONAL ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "230", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SARS-COV-2 SPIKE PROTEIN S1 MONOCLONAL ANTIBODY (HL6)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "231", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ß-CATENIN ANTIBODY (E-5) IS A MOUSE MONOCLONAL IGG1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "232", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TL1A (HUMAN) MONOCLONAL ANTIBODY (L4G9), 100 ¿G,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "233", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TNFA - ANTICUERPO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "234", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TREM2 - ANTICUERPO MAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "235", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TREM2 POLYCLONAL ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "236", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ULK1 (D8H5) RABBIT MAB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "237", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VDAC1 RABBIT MAB - MITOCHONDRIAL LOADING CONTROL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "238", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VGLUT 1 ANTIBODY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "239", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WNT-2 ANTICUERPO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "240", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1,4 DITIOTREITOL (DTT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "241", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "100 BP DNA LADDER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "242", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACRILAMIDA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "243", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ADENOSINE 5'-TRIPHOSPHATE MAGNESIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "244", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ADN POLIMERASA PLATINUM TAQ", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "245", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAROSA GRADO BIOLOGIA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "246", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA LIBRE DE DNA Y RNA, PARA BIOLOGÍA MOLECULAR 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "247", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA LIBRE DE NUCLEASAS NO TRATADA CON DEPC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "248", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMERSHAM ECL RAINBO MARKER - FULL RANGE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "249", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMPLITAQ GOLD 360 MASTER MIX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "250", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN BAMHI HF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "251", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BETA-MERCAPTOETANOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "252", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIS ACRILAMIDA GRADO BIOLOGIA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "253", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BROMURO DE ETIDIO P/BIOL. MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "254", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CATALASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "255", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CHAMALEON VUE PRE-STAINED PROTEIN LADDER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "256", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CHITOSAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "257", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COMPLETE, MINI PROTEASE INHIBITOR COCKTAIL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "258", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOKINE & CHEMOKINE CONVENIENCE PROCARTAPLEX HUMAN INFLAMMATION PANEL (20PLEX).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "259", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA CLEAN & CONCENTRATOR-5 (50 PREPS) W / ZYMO-SPIN IC COLUMNS (CAPPED)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "260", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA LADDER (1 KB) VIAL DE 500 µL P/BIOL. MOL. SOL 10 MM TRIS HCL (PH 8.0) 1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "261", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNASA I GRADO BIOLOGÍA MOLECULAR 50MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "262", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNASE I (RNASE-FREE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "263", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNTP MIX (10 MM EACH)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "264", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUAL LUCIFERASE REPORTER ASSAY SYSTEM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "265", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN ECORI HF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "266", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN ECORV HF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "267", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN RATON SONDA FAM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "268", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN SLC38A3 EN RATON SONDA FAM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "269", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN C_1202883_20 MTHFR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "270", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN C_850486_20 MTHFR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "271", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN HUMANO SONDA FAM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "272", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMAN PARA LA DETECCION DE RNAM DEL GEN SLC38A1 SONDA FAM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "273", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENSAYO TAQMA RNASAP, SONDA VIC DYE/QSY, LIMITADO POR CEBADORES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "274", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HAE III", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "275", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HHA I", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "276", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HINFI", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "277", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN HPH I", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "278", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN MBO I", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "279", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN MBOII", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "280", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN SSP I", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "281", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESCALERAS DE PROTEÍNAS PRETEÑIDAS 10 A 25 KDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "282", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESP3I (BSMBI) (10 U/µL)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "283", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTÁNDAR DE PESO MOLECULAR DUAL PARA PROTEÍNAS DE 2 A 250,000 DALTONES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "284", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXONUCLEASE I (E. COLI)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "285", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOLIN CICALTEU PARA DETERMINACION DE PROTEINAS. FCO. 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "286", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GDNF PROTEÍNA RECOMBINANTE HUMANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "287", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GEL LOADING SOLUTION TYPE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "288", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GEL RED NUCELIC ACID", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "289", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GENESCAN 500 LIZ SIZE STANDARD FOR SIZING DNA FRAGMENTS IN THE 35-500 NUCLEOTIDES RANGE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "290", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "291", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUANOSINE 5'-TRIPHOSPHATE SODIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "292", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HABA/AVIDIN REAGENT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "293", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "11-250 KDA PRESTAINED PROTEIN LADDER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "294", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE PERLAS MAGNÉTICAS PARA AISLAMIENTO DE ADN Y ARN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "295", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100-1000 PB EN ESCALERA DE 100 PB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "296", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA PROTEÍNAS DE 10-250KDA, 500µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "297", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR; 10-250KDA WIDE RANGE BLUE/RED TW O COLOR,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "298", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADORES DE PESO MOLECULAR DE PROTEÍNAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "299", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MASTER MIX PARA 100 REACCIONES DE PCR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "300", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MAXIMA SYBR GREEN/ROX QPCR MASTER MIX 2X. MASTER MIX 200 REACTIONS. CAT K0221", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "301", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HRM MASTER MIX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "302", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA POWERTRACK SYBR GREEN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "303", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEZCLA MAESTRA UNIVERSAL DE PCR TAQMAN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "304", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEBUILDER HIFI DNA ASSEMBLY MASTER MIX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "305", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NONIDET P40. FCO. 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "306", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGO (DT)12-18 PARA SINTESÍS DE CDNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "307", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PESO MOLECULAR (MEZCLA DE NUEVE PROTEÍNAS TEÑIDAS DE AZUL, NARANJA Y VERDE (DE 10 KDA A 250 KDA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "308", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ADN POLIMERASA PLATINUM TAQ", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "309", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN PMEI", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "310", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALL BLUE PRESTAINED PROTEIN STANDARDS, VALUE PACK.. 2.5 ML (5 X 500 µL), MIXTURE OF TEN BLUE-STAINED RECOMBINANT PROTEINS (10–250 KD), INCLUDING THREE REFERENCE BANDS (25, 50, 75 KD), 250 APPLICATIONS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "311", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PROTEÍNAS PRECISION PLUS PROTEIN DUAL COLOR STANDARDS, 500 UL, 50 APLICACIONES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "312", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA A/G SEFAROSA PARA INMUNOPRECIPITAR 5ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "313", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "314", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEINASE K EN POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "315", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEINASE K SOLUTION", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "316", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIGH-FIDELITY DNA POLYMERASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "317", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUICK-GDNA MINIPREP, 200 PREPS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "318", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REVERTAID REVERSE TRANSCRIPTASE (200 U/UL)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "319", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RNA CLEAN & CONCENTRATOR-5 (DNASE NOT INCLUDED)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "320", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RNASA GRADO BIOLOGÍA MOLECULAR 50MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "321", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE ÁCIDOS NUCLÉICOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "322", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE ÁCIDOS NUCLÉLICOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "323", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2A; 6FAM GGG CCC CTC ACC ATG TCG 3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "324", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2B; 5´-CGG GCT TGC GGA CAT TGG- 3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "325", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; JPH3R; 5´- AGATGCCACCGCATTCGG -3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "326", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; SCA17F; 5´-FAM-GCC AGC GCA CTC ACC CTC-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "327", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; TBP-F; 5´-5¨-FAM-GACCCCACAGCCTATTCAGA-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "328", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 19 MER, ABC2677R1 ; 5’-GTT TGA CTC ACC TTC CCA G-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "329", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC1236R; 5’-CCT GAC TCA CCA CAC CAA TG-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "330", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC2677F; 5’-TGC AGG CTA TAG GTT CCA GG-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "331", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435F ; 5’-TGT TTT CAG CTG CTT GAT GG-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "332", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435R; 5’-AAG GCA TGT ATG TTG GCC TC-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "333", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, CYP3A4*1BF; 5´-TCC AGG CAT AGG TAA AGA TC-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "334", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, SCA7R; 5´-ACT TCA GGA CTG GGC AGA GG-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "335", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; C677T-R; 5'-AGG ACG GTG CGG TGA GAG TG-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "336", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; MJD52; 5´-VIC-CCA GTC ACT ACT TTG ATT CG-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "337", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPF; 5´- GATGCTGGTTCTCTTTGTGG -3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "338", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPR; 5´- CCCACTATCAGGAAGATGAG -3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "339", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; SCA17R; 5´- TTG ACT GCT GAA CGG CTG CA-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "340", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; TBP-R; 5´- GGGACGTTGACTGCTGAAC -3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "341", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A4*1BR; 5´-AAT CTA TTA AAT CGC CTC TCA-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "342", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3F; 5'-CAT CAG TTA GTA GAC AGA TGA-3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "343", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22 MER, ABC1236F; 5’-TAT CCT GTC TCT GTG AAT TGC C-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "344", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER ; MJD255; 5'-TGG CCT TTC ACA TGG ATG TGA A-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "345", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER; JPH3F; 5´- FAM-GGTTCCCTGCACAGAAACCATC - 3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "346", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; A1298T-R; 5'-CAC TTT GTG ACC ATT CCG GTT TG-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "347", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; ATN1F; 5´-FAM-CCCAGTCCACCGCCCACCCACCA -3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "348", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; C677T-F: 5'-TGA AGG AGA AGG TGT CTG CGG GA-3’", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "349", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; A1298T-F; 5'-CTT TGG GGA GCT GAA GGA CTAC TAC-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "350", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; ATN1R; 5´- TGCTCCAGGAGGAGGGGGCCCAGA -3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "351", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; SCA10TPF; 5´-6-FAM-CAG ATG GCA GAA TGA TAA ACT CAA-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "352", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 25 MER; TPR2 (TAIL); 5´-AGA ATA GAA TAG AAT AGA ATA GAA T-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "353", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHF; 5´-56FAM ATGAAG GCC TTC GAG TCC CTC AAG TCC TTC-3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "354", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHR; 5´GGC GGT GGC GGC TGT TGC TGC TGC TGC TGC - 3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "355", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 46 MER; SCA10TPR1; 5´-TACGCATCCCAGTTTGAGACGAGAATAGAATAGAATAGAATAGAAT-3´", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "356", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO DE 20 MER; SCA7F; 5'-PET-TAG GAG CGG AAA GAA TGT CG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "357", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-F; 5’-TAA GCT TGG CAC GGC TGT CCA AGG A-3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "358", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-R; 5'-ACAGAATTCGCCCCGGCCTGGTACACTGCCA-3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "359", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SÍNTESIS  DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3R; 5'-GGT CCA AAC AGG GAA GAA ATA-3'", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "360", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOL DE LISIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "361", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOL DE PRECIPITACIÓN DE PROTEÍNAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "362", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SONIC HEDGEHOG RECOMBINANTE HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "363", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO QUIMIOLUMINISCENTE SUPERSIGNAL™ WEST PICO PLUS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "364", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "T4 DNA LIGASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "365", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "T4 POLYNUCLEOTIDE KINASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "366", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "T7 DNA LIGASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "367", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQ POLIMERASA DE ARRANQUE EN CALIENTE 5U/¿L, 500U", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "368", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQ POLIMERASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "369", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN GENOTYPING MASTER MIX 10 ML. CAT. 4371355", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "370", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMAN RNASE P INSTRUMENT VERIFICATION PLATE, FAST 48-WELL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "371", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAQMANUNIV MMIX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "372", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TEMED (50 ML) ULTRAPURO, GRADO BIOLOGIA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "373", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TGF-BETA 3 RECOMBINANTE HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "374", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "M-MLV TRANSCRIPTASA INVERSA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "375", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS (HIDROXYMETHYL)-AMINOMETHANE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "376", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS BASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "377", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS-HCI, GRADO REACTIVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "378", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZMA HYDROCHLORIDE PARA BIOLOGÍA MOLECULAR,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "379", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZMA-BASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "380", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "381", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "APO-BRDU", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "382", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WESTERN BLOTTING LUMINOL REAGENT IS A NON-RADIOACTIVE, LIGHT-EMITTING SYSTEM FOR DETECTING PROTEINS ON A WESTERN BLOT MEMBRANE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "383", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DE RESTRICCIÓN XHOI", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "384", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "10X TRIS/GLYCINE/SDS. BIORAD. PKG OF 1, 1 L, 10X PREMIXED ELECTROPHORESIS BUFFER, CONTAINS 25 MM TRIS, 192 MM GLYCINE, 0.1% SDS, PH 8.3 FOLLOWING DILUTION TO 1X WITH WATER.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "385", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2X LAEMMLI SAMPLE BUFFER.30 ML, PREMIXED PROTEIN SAMPLE BUFFER FOR SDS-PAGE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "386", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE REFERENCIA STD PARA PH 4 FRASCO 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "387", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE REFERENCIA STD PARA PH 7 FRASCO 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "388", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL LYSIS-M BUFFER.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "389", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN BUFFER PH 10 PARA CALIBRACIÓN DE POTENCIÓMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "390", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACTINOMYCIN D", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "391", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBUMINA SÉRICA BOVINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "392", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBIÓTICO-ANTIMICÓTICO (10.000 UNIDADES/ML DE PENICILINA, 10.000 µG/ML DE ESTREPTOMICINA Y 25 µG/ML DE ANFOTERICINA B )", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "393", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBIÓTICO-ANTIMICÓTICO (100X) FRASCO CON 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "25" }, { "number": "394", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOCHALASIN B", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "395", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIMETIL SULFOXIDO GRADO BIOLOGÍA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "396", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIMETILSULFOXIDO (DMSO)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "397", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM, POWDER, HIGH GLUCOSE, 10 X 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "398", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DMEM/F-12, POWDER, HIGH GLUCOSE, 10 X 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "399", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DUBELCCOD'S MODIFIED EAGLE'S MEDIUM-HIGH GLUCOSE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "400", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "401", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM F-12, CON GLUTAMAX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "402", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DMEM/F12", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "403", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO KNOCKOUT(TM) D-MEM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "404", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO NEUROBASAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "405", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO OPTIMEM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "406", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO RPMI 1640, EN POLVO. 10 X. CAJA CON 10 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "407", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESSENTIAL 8 MEDIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "408", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FGF8 RECOMBINANTE HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "409", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FGF-BÁSICO HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "410", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUO-4 PENTAPOTASSIUM SALT, CELL IMPERMEANT (500 ¿G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "411", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUORESCEIN DIACETATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "412", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOAT SERUM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "413", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HISTOPAQUE-1077", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "414", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL PERMEANT.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "415", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTATHIONE REDUCED.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "416", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LINEA CELULAR DE GLIOBLASTOMA U87- MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "417", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LINEA CELULAR DE GLIOBLASTOMA M059J", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "418", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÌNEA CELULAR RG2", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "419", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOFECTAMIN 30000", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "420", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MATRIZ DE LA MEMBRANA BASAL DE FACTOR DE CRECIMIENTO REDUCIDO LISTA PARA USAR Y CUALIFICADA PARA HESC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "421", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MATRIGEL GROWTH FACTOR REDUCED (GFR) BASEMENT MEMBRANE MATRIX, LDEV-FREE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "422", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE EAGLE MODIFICADO POR DUBELCO (DMEM), CON GLUTAMINA, GLUCOSA ALTA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "423", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLI-L-LISINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "424", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN TRIPSINA EDTA AL 2.5 % (10X)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "425", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "13", "maximum_amount": "34" }, { "number": "426", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUERO FETAL BOVINO, INACTIVADO CON CALOR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "427", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPLEMENTO B27", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "428", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPLEMENTO B-27 (50X) SIN VITAMINA A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "429", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPLEMENTO N2 (100X)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "430", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SV12 CRL-8621™ CELL LINE - FETAL GLIAL CELLS FROM HUMAN BRAIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "431", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA-EDTA (0.05%) ROJO FENOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "432", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPSINA-EDTA (0.25% TRIPSINA, EDTA•4NA) (1X),", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "433", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRYPLE EXPRESS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "434", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BAPTA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "435", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VECTASHIELD MEDIO DE MONTAJE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "436", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DODECILSULFATO DE SODIO (SDS) PARA ELECTROFORESIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "437", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE BENZALCONIO AL 1% , ENVASE CON 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "438", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEOXICOLATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "439", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DETERGENTE ALCALINO CONCENTRADO (EXTRAN). FRASCO. 4 L.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "440", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DETERGENTE ALCALINO HYCLIN PLUS ALCALINO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "441", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DETERGENTE DESINFECTANTE NEUTRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "442", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEXTRANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "443", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRAN NEUTRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "444", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRITÓN X-100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "445", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "446", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 100% NON-IONIC DETERGENT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "447", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20, 100% NONIONIC DETERGENT. BIORAD. 100 ML, ENZYME IMMUNOASSAY GRADE POLYSORBATE SURFACTANT (DETERGENT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "448", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 80", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "449", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DYEEX 2.0 SPIN (250)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "450", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELISA KIT FOR AMYLOID BETA PEPTIDE 1-40 (AB1-40), UOM 96T*5,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "451", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GEL DNA RECOVERY KIT (50 PREP)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "452", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AEC STAINING KIT LIQUID, FCO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "453", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGE (ADVANCED GLYCATION END) ASSAY KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "454", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALLTAQ MASTER MIX KIT (500)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "455", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDASE IN SITU APOPTOSIS DETECTION KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "456", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICINCHONINIC ACID KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "457", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYCLE SEQUENCING KIT (100 REACTIONS) WITH BUFFER TUBE 5X SEQ", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "458", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYCLE SEQUENCING KIT, 24 REACTIONS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "459", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASPASE 3 COLORIMETRIC ACTIVITY ASSAY KIT,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "460", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CASPASE 9 COLORIMETRIC ACTIVITY ASSAY KIT,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "461", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL FRACTIONATION KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "462", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CELL PROLIFERATION KIT (MTT).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "463", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CONJUNTO DE TAMPONES DE TINCIÓN DE FACTOR DE TRANSCRIPCIÓN/FOXP3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "464", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DAB SUBSTRATE KIT PEROXIDASE (HRP) WITH NICKEL, (3,3-DIAMINOBENZIDINE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "465", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTIBODY LABELING KITS 594 NM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "466", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EPIQUIK TISSUE CHROMATIN IMMUNOPRECIPITATION (CHIP) KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "467", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EPITECT BISULFITE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "468", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HISTONE DEACETYLASE (HDAC) ANTIBODY SAMPLER KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "469", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN IL-35(INTERLEUKIN 35) ELISA KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "470", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HUMAN TH1/TH2/TH17 CYTOKINE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "471", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IL-10 HUMAN ELISA KIT, HIGH SENSITIVITY 96 TEST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "472", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IN SITU CELL DEATH DETECTION KIT, FLUORESCEIN.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "473", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INSULIN MOUSE ELISA KIT 96 TEST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "474", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE DE TUBERIA Y UNIONES PARA CROMATOGRAFIA COMPATIBLE CON AGILENT Y PERKIN ELMER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "475", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA DETECTAR KLOTHO EN RATON", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "476", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ELISA PARA DETECTAR KLOTHO HUMANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "477", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE ENSAYO DE PROTEÍNAS BCA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "478", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE DNA DE SANGRE COLUMNAS DE MEMBRANA DE SILICA MAXI SPIN CAPACIDAD 10ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "479", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE LIQUIDOS REVELADOR Y FIJADOR PARA RADIOGRAFIA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "480", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SÍNTESIS DE CDNA PARA 50 REACCIONES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "481", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "482", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT ELISA IL-1-¿ PARA RATA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "483", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT P/ELISA IL-10 P/RATA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "484", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA GLUCOSA FOSFATO ISOMERASA, 100 PRUEBAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "485", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA HEXOQUINASA, 100 PRUEBAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "486", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PEROXIDASE MOUSE & RABBIT, READY TO USE 1000 TESTS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "487", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT TNF-¿ DE RATA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "488", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT SOLUCIÓN DESINFECTANTE CLORUROBENZALCONIO AL 12%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "489", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MITOCHONDRIAL MEMBRANE POTENTIAL KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "490", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NAD/NADH ASSAY KIT (COLORIMETRIC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "491", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FS DNA LIBRARY PREP KIT FOR ILLUMINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "492", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OPTI-4CN SUBSTRATE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "493", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POTENCIADOR DE LA QUIMIOLUMINISCENCIA (ECL) PARA WESTERN BLOT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "494", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT PARA PCR DE 200 PRUEBAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "495", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUINOLINIC ACID ELISA KIT:96 WELLS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "496", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAT IFN-GAMMA ELISA KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "497", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAT IL-4 ELISA KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "498", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RAT IL6 ELISA KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "499", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SENESCENCE ¿-GALACTOSIDASE STAINING KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "500", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPERMEZCLA DE IQ-SYBR GREEN PARA 50 REACCIONES DE RT-PCR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "501", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TGFBI (BIGH3) HUMAN ELISA KIT 96 TEST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "502", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TOTAL RNA PURIFICATION PLUS KIT (50). 50 PREPS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "503", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VECTASTAIN ELITE ABC-HRP KIT PEROXIDASE, R.T.U. (UNIVERSAL) VECTOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "504", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA SEQUENCING CLEAN-UP KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "505", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE MICROMOLDES O MICROMATRIZ DE SILICÓN PARA MICROARREGLOS O HISTOARREGLOS, PARA TEJIDOS INCLUIDOS EN PARAFINA. MOLDE CON 15 NUCLEOS DE 4 MM DE DIÁMETRO, CON SACABOCADO DE 4 MM DE DIÁMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "506", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PLASMID MIDIPREP KIT, 50 PREPS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "507", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CÁMARA P/CULTIVO DE 8 POZOS DE VIDRIO VOLUMEN: 0.2-0.5ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "508", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS UNIVERSALES PARA MICROPIPETA DE 0.1 A 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "509", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO/CULTIVO DE POLIESTIRENO DE 12.5 CM2; VENT. FILTRO EN LA TAPA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "510", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TIRAS DE 8 TUBOS DE .2 ML PARA PCR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "511", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO VACUTAINER DE 8.5 ML CON TAPA AMARILLA CON ACD SOLUCIÓN A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "512", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ACRÍLICO DENTAL AUTOCURABLE NO. 66 C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "513", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D 1.65, I.D 1.20 (BOROSILICATE GLASS WITH FILAMENT O.D 1.65 MM, I.D 1.20MM, 10 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "514", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.2, I.D. 0.94 (BOROSILICATE GLASS WITH FILAMENT O.D. 1.2 MM, I.D.: 0.94MM, 10 CM LENGTH,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "515", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAPILARES DE BOROSILICATO CON FILAMENTO DE O.D. 1.5, I.D. 0.86 (BOROSILICATE GLASS WITH FILAMENT O.D. 1.5 MM, I.D.: 0.86MM, 10 CM LENGTH,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "516", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MONÓMERO PARA ACRÍLICO DENTAL AUTOCURABLE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "517", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 100 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "518", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 250 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "519", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "(TUBO AL VACIÓ CON ANTICOAGULANTE (EDTA, TAPÓN MORADO ) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. S", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "520", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "10 µL, MODEL 701 CEMENTED NEEDLE SPECIAL (SN) SYRINGE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "521", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "100 µL MICROLITER SYRINGE MODEL 710 N, CEMENTED NEEDLE, 22S GAUGE, 2 IN, POINT STYLE 3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "522", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "100-WELL MICROTUBE STORAGE BOX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "523", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "15ML TUBO CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "524", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "50ML TUBO PARA CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE 25 POR PAQUETE CAJA CON 500 NEST CAT.602052 NEST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "525", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE 0.2 ML PARA PCR CON TAPA PLANA).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "526", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "AJUSTE MANUAL PEEK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "527", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "AMICON ULTRA-0.5 ML CENTRIFUGAL FILTERS , ULTRACEL 3K, REGENERAED CELLULOSE 3000NMWL, CAJA CON 96 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "528", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ANILLOS PARA INCLUSIÓN DE TEJIDOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "529", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "APLICADORES DE MADERA, 6\"X 1/12\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "530", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "APLICADORES DE PLÁSTICO 15 CM CON ALGODÓN; PAQUETES CON 3 PIEZAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "531", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BENZAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "532", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BNC HOLDER STRAIGHT WIRE SUCTION FOR 1.0MM GLASS OD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "533", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BNC HOLDER STRAIGHT WIRE SUCTION FOR 1.5MM GLASS OD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "534", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BNC HOLDER STRAIGHT WIRE SUCTION FOR 1.7MM GLASS OD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "535", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTE AL CALOR, CON BOCA ANCHA. DE 100 MLILITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "536", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. PIREX DE 250MILILITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "537", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. DE 500 MLILITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "538", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOX FILAMENTS P-97 (FB330B 3.0 MM SQUARE BOX FILAMENT, 3.0MM WIDE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "539", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BROWNIEE AQUAPORE ODS RP-18 NEWGUARD CARTRIDGE, 7 UM 15X3.2 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "540", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE ALMACENAMIENTO PARA 100 MICROTUBOS DE 2 ML DE BASE PLANA PARA CONGELACIÓN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "5", "maximum_amount": "14" }, { "number": "541", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "CAJA DE PAPEL FILTRO . TAMAÑO DEL PORO 125 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "542", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE POLIPROPILENO, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "543", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA PETRI DE VIDRIO, TAMAÑO DE 35X10 MILÍMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "544", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA PETRI DESECHABLE, PARA CULTIVO CELULAR DE POLIESTIRENO, ESTÉRIL; TAMAÑO DE 35X10 MILÍMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "545", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS CON INSERTO DE 12 MULTIPOZOS, PORO 3.0 µM PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "546", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE COPPLIN DE VIDRIO PARA TINCIÓNCAPACIDAD DE 500 ML CON CANASTILLA METÁLICA, CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "547", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE POLIESTIRENO DE 24 POZOS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "548", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE POLIESTIRENO DE 48 POZOS TRATADAS ESTÉRILES, LIBRES DE\nPIROGÉNOS PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "549", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE CULTIVO CELULAR CON TAPA DE POLIESTIRENO, DE 96 POZOS, TRATADO CON TC, FONDO REDONDO \"U\", ESTERIL. EMPACADAS INDIVIDUALMENTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "550", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE POLIESTIRENO DE 6 POZOS ESTÈRILES, LIBRES DE PIROGÈNOS PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "551", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS DE POLIESTIRENO DE 96 POZOS TRATADAS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "552", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS ESTÉRILES PARA CULTIVO CELULAR DE 100 X15 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "553", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CANULA DE POLIETILENO (PE10), DIÁMETRO INTERNO 0.28MM , DIÁMETRO EXTERNO .61MM. ROLLO DE 100 PIES (FT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "554", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CARTUCHO / FILTRO DESECANTE (SS-238) PARA OSMOMETRO VAPRO MODEL 5600 (DESICCANT CARTRIDGE/FILTER)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "555", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CILINDRO DE METAL PARA GUARDAR Y ESTERILIZAR PIPETA PASTEUR, DE 20 CM LARGO X 20 CM DE DIÁMETRO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "556", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CINTA TESTIGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "9", "maximum_amount": "24" }, { "number": "557", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "COLADOR CELULAR 40UM AZUL ESTERIL EMPAQUE INDIVIDUAL CAJA(S) CON 50 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "558", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA PARA CROMATOGRAFÍA ADSORBOSPHERE OPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "559", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA, AGILENT, ZORBAX ECLIPSE XDB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "560", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "COLUMNA, AGILENT, ZORBAX SB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "561", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CONECTOR PARA TUBERÍA PEEK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "562", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRIOCAJAS DE ALMACENAMIENTO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "563", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRIOTUBO ESTERIL. 2 ML \"SELF STANDING\" (CON BASE PARA COLOCAR VERTICALMENTE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "564", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRIOTUBOS DE POLIPROPILENO, LIBRES DEPIRÓGENOS, RNASAS Y DNASAS ESTÉRILES DE 1.7 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "565", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRONOMETRO 3 CANALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "566", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBREOBJETOS 24 X 24", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "567", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBRE-OBJETOS DE 24X60 MILIMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "568", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "CUBREOBJETOS DE VIDRIO CIRCULAR 12MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "569", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CUCHILLAS DESECHABLES DE ACERO INOXIDABLE ALTO PERFIL ULTRAFINAS;", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "5", "maximum_amount": "14" }, { "number": "570", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CUVETTES DE CUARZO PARA ESPECTROFOTÓMETRO, 45MM ALTURA, 3.5ML DE CAPACIDAD.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "571", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "DESECANTE DRIERITE CON INDICADOR, EL COLOR VIRA DE AZUL A ROSA CUANDO ABSORBE HUMEDAD, MALLA 8,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "572", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "DISCOS DE ESMERILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "12", "maximum_amount": "30" }, { "number": "573", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ECLIPSE PLUS C18, COLUMNA ANALÍTIA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "574", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ECLIPSE XDB-C18, CARTUCHOS PARA PRECOLUMNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "575", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 12 TUBOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "576", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 32 TUBOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "577", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "EQUIPO PARA VENOCLISIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "578", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ESTUCHE BARRAS MAGNETICAS PARA AGITACIÓN DE DIFERENTES TAMAÑOS (16 BARRAS EN TOTAL)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "579", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "EXTRA THICK BLOT PAPER. FILTER PAPER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "580", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA MICROPIPETA ESTÉRILES CAPACIDAD 5-200 UL)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "46", "maximum_amount": "115" }, { "number": "581", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTRO DE PIRINOLA (FILTRO PARA JERINGA) DE 28 MM Y 0.20 MICRAS MEMBRANA CFSA NO PIROGHENICOS ESTERIL, EMPAQUETADOS INDIVIDUALMENTE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "582", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTRO DE VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "583", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE NYLON PIRINOLA, 0.22 UM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "584", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTROS DE NYLON PIRINOLA, 0.45 UM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "585", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOTELLA DE POLIESTIRENO DE 25MM CON FILTRO, PARA CULTIVO CELULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "586", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO CON 100 GRAMOS BOVINE SERUM ALBUMIN LYOPHILISED PH ~7. \tHEAT SHOCK FRACTION, PROTEASE FREE, FATTY ACID FREE, ESSENTIALLY GLOBULIN FREE =98% FRASCO CON 100 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "587", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO DE CULTIVO CELULAR DE POLIESTIRENO, 75 CM2, ESTÉRIL, TRATADOS P/CULTIVO Y FILTRO DE VENTILACIÓN EN LA TAPA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "588", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO. VIDRIO. TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/5 PZAS. 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "589", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO. VIDRIO TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "590", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "FRASCO. VIDRIO. AUTOCLAVEABLE. TIPO SCHOTT. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "591", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FRESAS DE CARBURO SSW HP-1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "592", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FRITTS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "593", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA ENFRIADORA PARA TUBOS DE 0.2 CON CAPACIDAD PARA 96 TUBOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "594", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA PARA 96 MICROTUBOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "595", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJA DE BISTURÍ NUM. 11", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "596", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJA DE BISTURÍ NUM. 15", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "597", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "HOJA DE BISTURÍ NUM. 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "598", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 2 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "599", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "600", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "601", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 15 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "602", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 1ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "603", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 7ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "604", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "INSERTOS DE CULTIVO CELULAR DE POLICARBONATO CON TAMAÑO DE PORO DE 8 MICRAS EN PLACA DE 12 POCILLOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "605", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ISODINE ESPUMA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "606", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JARRA CUADRADA DE TINCIÓN PARA PORTAOBJETOS FABRICADO EN POLIPROPILENO, SUJETA A 10 LAMINILLAS, CONSECUTIVAS. DISEÑADO EN FORMA CUADRADA Y CUERPO CORTO PARA AHORRAR ESPACIO Y SOLUCIÓN DE TINCIÓN. CUANDO SE QUITA LA TAPA, LOS PORTAOBJETOS SE PUEDEN MANIPULAR SIN TOCAR LA SOLUCIÓN. LA TAPA DE ROSCA TIENE UN REBAJE DE BLOQUEO PARA SOSTENER LAS CORREDERAS. EL CUERPO Y LA TAPA TIENEN UNA LENGÜETA MOLDEADA PARA PERMITIR QUE SE CONECTEN ENTRE SÍ PARA SU TRANSPORTE. LAS MEDIDAS DE LA JARRA: 83 MM (ALTO) X 33 MM (ANCHO) X 3 MM (ALTO)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "607", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE 3 PIPETAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "608", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE BARRAS MAGNETICAS (10 PZAS.)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "609", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "LÁPIZ PUNTA DIAMANTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "610", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADOR PARA PORTAOBJETOS, \"PAP-PEN\", NORMAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "611", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ AFORADO. VIDRIO. 2 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "612", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ AFORADO. VIDRIO. 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "613", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ AFORADO. VIDRIO. 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "614", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ AFORADO. VIDRIO. 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "615", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ VOLUMÉTRICO “A”. VIDRIO. TAPÓN. 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "616", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MECHERO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "617", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA DE DIÁLISIS SPECTRA/POR 3. MWCO 3.5 KDA DE 34 MILÍMETROS DE DIÁMETRO, 54 MILÍMETROS DE ANCHO Y 50 PIES DE LARGO DAIGGER X6026 ROLLO DE 50 PIES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "618", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.22¿M DEL PORO. DIÁMETRO DE 47MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "619", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.45¿M DEL PORO. DIÁMETRO DE 47MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "620", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA DE NITROCELULOSA 0.4 UM\n30 CM X 3.5 M", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "621", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "622", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "IMMUN-BLOT MEMBRANA DE PVDF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "623", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA PARA FILTRACIÓN CON PORO DE 0.45 MICROMETROS, HVLP HIDROFÍLICAS DE ÉSTERES DE CELULOSA DE 47MM DE DIÁMETRO. PAQ. C/100 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "624", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANA PARA FILTRACIÓN DE DISOLVENTES ORGANICOS (HIDROFÓBICA) TIPO HVLP 0.45 MM. CAJA C/100 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "625", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANAS DE FILTRADO HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "626", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MEMBRANAS DE FILTRADO HIDROFÓBICAS DE PVDF, 0.22 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "627", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROESPATULA ODONTOLÓGICA DE ACERO INOXIDABLE (CONICA Y PLANA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "628", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROJERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACION DE 1 MICROLITRO, PUNTA BISELADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "629", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROPIPETA DIGITAL DE 12 CANALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "630", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN COMB, 10-WELL, 0.75 MM, 33 ¿L. PKG OF 5, COMBS FOR MINI-PROTEAN ELECTROPHORESIS CELL, USE WITH 0.75 MM GLASS PLATES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "631", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN SHORT PLATES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "632", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN SHORT PLATES. PKG OF 5, SHORT PLATE FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "633", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN SPACER PLATES WITH 1.0 MM INTEGRATED SPACERS. PKG OF 5, SPACER PLATE WITH 1.0 MM INTEGRATED SPACER, FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "634", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN CASTING FRAME", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "635", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINI-PROTEAN CASTING FRAME", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "636", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MOLDE PARA INCLUSIÓN, PLANO C/CAV.TERM. ADELGAZADAS,14X5X6 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "637", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MP TETRA 4GEL/STAIN-FREE FASTC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "638", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJA PARA BISTURI NO.20 ACERO INOXIDABLE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "639", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJAS DE AFEITAR DOBLE FILO, C/", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "640", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJAS DE UN SOLO FILO. CAJA C/100 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "641", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL ALUMINIO GRUESO EN ROLLO JUMBO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "642", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL ALUMINIO, ROLLO DE 30.5 CM X 304.8 M", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "643", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL ESTRAZA SIN BLANQUEAR, 18 PULGADAS X 1,100 ', 50 LBS ROLLO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "644", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "645", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO GRADO 1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "646", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO GRADO 3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "647", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO PAPEL FILTRO 589/3 DE 12.5 CMS. CJ. C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "648", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO PAPEL FILTRO NUM. 1 DE 12.5 CMS. CJ. C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "649", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL PARAFILM 10 CM X 7.6 M (4PULGADAS X 125 PIES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "650", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL PH DE 0.0 A 14.0 CJ. C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "651", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIO, BLOCK CON 100 HOJAS DE 10 X 15 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "652", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "653", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PELÍCULA ADHESIVA ÓPTICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "654", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZA C/PUNTA FINA Y ASERRADA, DE ACER, INOX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "655", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PINZA EMS DE 110MM CON PUNTA DOBLADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "656", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETA DESECHABLE ESTÉRIL 10ML SUBDIVISIÓN O.5ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "657", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETA DESECHABLE ESTÉRIL 5ML SUBDIVISIÓN O.5ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "658", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETA SEROLOGICA DE POLIESTIRENO 5MLX0.01ML ESTERILES, LIBRE\nPIROGÉNOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "659", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS DE PLÁSTICO CON BULBO INCLUIDO DE 1 ML ESTÉRILES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "660", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS SEROLOGICAS DE 10 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, CAJA CON 200,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "661", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETAS SEROLOGICAS DE 25 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, GARANTIZA UNA PRECISIÓN DE DISPENSACIÓN DE +/-1 %, CAJA CON 100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "662", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PIPETEADORES ELÉCTRICOS. CAPACIDAD 0.1 A 100 ML CONTROLADOR DE PIPETA ELÉCTRICA, RELLENO AUTOMÁTICO DE PIPETAS MOTORIZADAS, PIPETA ELÉCTRICA, 0,1-100 ML, VELOCIDAD AJUSTABLE CON FILTRO, 115V.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "663", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PISETA DE PLÁSTICO. 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "664", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE CON 96 POZOS CON FONDO DE CUARZO, UNA PIEZA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "665", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, NEGRAS DE FONDO TRANSPARENTE. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "666", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, TRANSPARENTES. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "667", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACA DE REACCIÓN DE 48 POCILLOS ÓPTICA RÁPIDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "668", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE CULTIVO ESTÉRILES DE 6 POZOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "669", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE VIDRIO CORTAS DE 10.01X7.3 CM PARA PREPARAR GELES DE ELECTROFORESIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "670", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS PARA CULTIVO CELULAR CON 96 POZOS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "671", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS CORTE DIAMANTADO DE TAMAÑO 25X75 MM Y 0.8-1.1 MM GROSOR, BORDES PULIDOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "28", "maximum_amount": "70" }, { "number": "672", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DE 1 A 1.2MM DE ESPESOR CON BORDES ESMERILADOS Y BANDA MATE PARA ETIQUETAR. TAMAÑO 25X75MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "60", "maximum_amount": "150" }, { "number": "673", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PORTAOBJETOS DE CULTIVO CELULAR CON CÁMARA DE 8 POZOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "674", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PROBETA DE VIDRIO. 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "675", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PROBETA DE VIDRIO. 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "676", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PROBETA DE VIDRIO. GRADUADA. 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "677", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PROBETA DE VIDRIO. GRADUADA. 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "678", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "PROBETA DE VIDRIO. GRADUADA. 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "679", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA MICROPIPETA DE 10 UL BOLSA CON 1000 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "5", "maximum_amount": "14" }, { "number": "680", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS ESTERILES PARA PIPETA AUTOMATICA DE 10 MICROLITROS CAJA C/96 10 RACKS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "681", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO 0.2 A 10 UL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "682", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO DE 20- 200 UL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "683", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS DE 200 µL EN RACK.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "684", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS AMARILLAS 200 UL. NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "15", "maximum_amount": "39" }, { "number": "685", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS AZULES 1000 UL, NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS. RESISTENTA A LA ESTERILIZACIÓN EN AUTOCLAVE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "26" }, { "number": "686", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA PIPETAS ESTERIL CON FILTRO 1000 UL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "687", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS DESECHABLES PARA PIPETAS AUTOMATICAS VOLUMEN VARIABLE 1000 A 5000 MICROLITROS BOLSA C/1000", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "688", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "RACK DE POLIPROPILENO CON CAPACIDAD PARA 96 TUBO EPENDORF DE 1.5- 2.0 ML, DE UNA CARA Y DE LA PARTE INFERIOR PARA 96 TUBO DE .5 A 1.0 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "689", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "RASTRILLOS DE CULTIVO (CELLTREAT CELL SCRAPER) DE 25 CENTÍMETROS DE LARGO DEL MANGO; ESTÉRILES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "690", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "REJILLAS DE COBRE 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "691", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "REJILLAS DE NIQUEL 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "692", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "RESERVORIOS DE POLIESTIRENO PARA PIPETA MULTICANAL. CAPACIDAD 100 MILILITROS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "693", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ROLLO DE MANGUERA TUBO HOLY LATEX2040. DIAMETRO INTERIOR 6.2MM, EXTERIOR 10.6 MM, ESPESOR 2.2MM. 15 M", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "694", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "695", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SEAL PIPETTE PUNCHED FOR 1.0MM GLASS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "696", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SEAL PIPETTE PUNCHED FOR 1.5MM GLASS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "697", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SEAL PIPETTE PUNCHED FOR 1.7MM GLASS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "698", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SELLADORES DE PLACAS DE ELISA (PLATE SEALER) NO ESTERILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "699", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SISTEMA DE FILTRACIÓN DE 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "700", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SPECTROFOTOMETER QUARTZ CELLS 3.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "701", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "STREPTAVIDIN MAGNETIC BEADS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "702", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SUPPORTED NITROCELLULOSE MEMBRANE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "703", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA CATGUT CRÓMICO 4-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "704", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA NYLON 4-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "705", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA QUIRÚRGICA SEDA PRETA/NEGRA TRENZADA CON AGUJA 4-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "706", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SUTURA SEDA 4-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "707", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SYRINGE DRIVEN FILTER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "708", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 100 MICRÓMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "709", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 40 MICRÓMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "710", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 70 MICRÓMETROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "711", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAPA OPTICA EN TIRA DE 8 P/TIRAS DE TUBOS DE 0.2 ML PARA PCR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "712", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAPÓN DE SELLO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "713", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAPONES Y SEPTAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "714", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TELA QUIRÚRGICA ADHESIVA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "715", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "25501-0096 DE MERCURIO DE -20°C A 110°C INMERSIÓN TOTAL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "716", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBERÍA PEEK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "717", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS 0.5 ML, 1000/BLS CLAROS. DE POLIPROPILENO. AUTOCLAVABLES A 121 °C A 15 PSI. DURANTE 20 MINUTOS, Y SE ALMACENA A -80 °C.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "718", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE GRAFITO TRANSVERSO COMPATIBLES CON ESPECTRO DE ABSORCIÓN ATÓMICA PE AA600 CAJA CON 5", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "719", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE MICROCENTRIFUGA DE FONDO\nCONICO, TRANSPARENTE, TAPA A PRESION,DE POLIPROPILENO, 1.5 ML, RCF 30000 XG. AUTOCLAVABLES A 121 ° C A 15 PSI. DURANTE 20\nMINUTOS, Y SE ALMACENA A -80 ° C.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "20", "maximum_amount": "50" }, { "number": "720", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO TIPO EPPENDORF CON TAPA COLOR AMBAR. BOLSA C/1000 PZAS. 1.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "721", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO FILTRADOR,500ML,45MM,.22UM,ACETAT. VASO DE POLIESTIRENO CON MEMBRANA DE ACETATO DE CELULOSA (PORO DE 0.22 ¿M) PARA FILTRACIO´N AL VACIO´CAPACIDAD DE 500 ML, , CONEXIO´N PARA MANGUERA DE TOMA DE VACI´O.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "722", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO P/CENTRIFUGA 15ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "723", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO P/CENTRIFUGA 50ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "724", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 0.6 ML. BOLSA C/1000 PZAS (TIPO EPENDORF)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "725", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS CON TAPA (TIPO EPENDORF)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "726", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS (TIPO EPENDORF) AMBAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "727", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE 1.5 ML ESTÉRILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "728", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE POLIPROPILENO DE 5ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "729", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS PARA CITOMETRÌA DE FLUJO DE POLIESTIRENO, ESTÈRILES VOL.5ML 12X75MM CON TAPÒN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "730", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRACIÓN 500 ML ESTÉRIL 0.22 MICRAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "731", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRACIÓN POR VACÍO; UN EMBUDO DE VIDRIO Y UNA ABRAZADERA DE ALUMINIO. EL EMBUDO GRADUADO DE 300 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "732", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRO DE JERINGA MILLEX-GS, 0,22 µM, DIÁMETRO 25 MM, CAJA CON 50 PZS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "733", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDADES DE FILTRACIÒN FLUJO RAPIDO PES0.22MM, 45MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "734", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDADES DE FILTRADO (FILTRO PIRINOLA) HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 13 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "735", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADO DE POLIPROPILENO DE 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "736", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO 20 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "737", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "738", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "739", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADODE VIDRIO TEMPLADO DE 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "11" }, { "number": "740", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO TEMPLADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "741", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO TEMPLADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "742", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 1000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "743", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 2000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "744", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VASOS DE KOPLIN DE VIDRIO PARA 8 LAMINILLAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "745", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "VIALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "746", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS DELGADOS MINI PROTEAN SHORT PLATES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "747", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIDRIOS ESPACIADOR DE 0.75 MM MINI PROTEAN SPACER PLATES WITH 0.75 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "748", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "WIRE SILVER 0.01 INCHES CUT TO LENGTH AND COILED", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "749", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE PCR CON TAPÓN PLANO 1.5 ML TRANSPARENTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "750", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE PCR CON TAPÓN PLANO 100 µL TRANSPARENTES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "751", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA DE POLIPROPILENO CON TAPA, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "752", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CONTADOR DE CÉLULAS SANGUÍNEAS DE 5 LLAVES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "753", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CRONÓMETRO DE 3 CANALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "754", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "EMBUDO DE POLIPROPILENO DE 10 CM DIÁMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "755", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "EMBUDO DE POLIPROPILENO DE 15 CM DIÁMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "756", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FILTRO DE JERINGA DIÁMETRO: 25 MM, TAMAÑO DEL PORO: 0,45 UM,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "757", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA DE PLÁSTICO PARA 80 VIALES DE 1.5 Y 2.0 ML., MICROTUBOS, TUBOS DE 25*32 MM. PAQUETE CON 5 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "758", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA DE PLASTICO PARA 80 TUBOS TIPO CON TAPÓN PLANO 1.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "759", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "LLAVE PARA DESECADOR DE VACÍO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "760", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MATRAZ DEWARD DELABS04950", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "761", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINIBOMBA OSMÓTICA (0.25µL/H)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "762", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "MINIBOMBA OSMÓTICA (0.5µL/H)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "763", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "N,N-DIISOPROPYLETHYLAMINE (DIPEA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "764", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "NAVAJAS PARA MICROTOMO DE ALTO PERFIL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "765", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL DE ESTRAZA ROLLO DE 45CM X 220 METROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "766", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PICETA DE POLIETILENO 1L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "767", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PICETA DE POLIETILENO 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "768", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PICETA DE POLIETILENO 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "769", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PLACAS DE 96 POZOS BLANCAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "770", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA MICROPIPETA DE 0.5 µL A 20 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "771", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "PUNTAS PARA MICROPIPETA DE 1 µL A 200 µL BLANCAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "772", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TEMPORIZADOR DIGITAL CUENTA TRIPLE DE ABAJO/ARRIBA, PANTALLA LCD GRANDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "773", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "UNIDAD DE FILTRACIÓN MILLEX-LH; 0,45 µM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "774", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "VIAL DE VIDRIO CON TAPA DE ROSCA PARA CENTELLEO DE 20 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "775", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ADHESIVE MICRO SLIDES, 72/P 692.00 34,600.00", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "20", "maximum_amount": "50" }, { "number": "776", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBOS DE PCR DE 8 TIRAS CON TAPONES INDIVIDUALES ADJUNTOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "777", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ZORBAX ECLIPSE XBD-C18", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "778", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N,N,N',N'-TETRAMETHYLETHYLENEDIAMINE (TEMED)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "779", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CNQX C127-50MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "780", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SR-95531 S106-50MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "781", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "(3-AMINOPROPYL) TRIETHOXYSILANE (APTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "782", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "(3-AMINOPROPYL)TRIETHOXYSILANE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "783", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1,3-DIPHENYLISOBENZOFURAN (DPBF)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "784", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-4 DINITROFENOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "785", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-ARAQUIDONOILGLICEROL(2AG) 2-ARACHIDONOYL GLYCEROL SIGMA870450 FRASCO DE 5 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "786", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-CHLORO-N6-CYCLOPENTYLADENOSINE CCPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "787", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-MERCAPTOETANOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "788", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3-(TRIMETHOXYSILYL)PROPYL METHACRYLATE (SILANE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "789", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3,4-DIHYDROXYPHENYLACETIC ACID, DOPAC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "790", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3-HYDROXY-DL-KYNURENINE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "791", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3-NITROPROPANOIC ACID", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "792", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "4-HYDROXYNONENAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "793", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "5-HYDROXYTRYPTAMINE CLORHIDRATO(SEROTONINA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "794", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "5-IODOTUBERCIDIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "795", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "6-HYDROXYDOPAMINE HYDROBROMIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "796", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "8-CYCLOPENTYL-1,3-DIPROPYLXANTHINE DPCPX", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "797", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE TRANSPARENTE. SECADO RAPIDO. POLVO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "798", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO. FCO. 100 GRS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "799", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. POLVO. FCO. 100 GRS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "800", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGE MODIFIED BSA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "801", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBUMIN, BOVINE, FATTY ACID-FREE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "802", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBUMINA DE SUERO BOVINO (BSA) LIBRE DE IGGS Y LIOFILIZADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "803", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALBUMINA SÉRICA BOVINA FRACCIÓN V, GRADO BIOLOGÍA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "804", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM251 (CB1 CANNABINOID RECEPTOR ANTAGONIST)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "805", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM251, CB1 RECEPTOR ANTAGONIST / INVERSE AGONIST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "806", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM630 (CB2 ANTAGONIST)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "807", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AM630, CB2 RECEPTOR ANTAGONIST", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "808", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANANDAMIDA (ANANDAMIDE-AEA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "809", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ARACHIDONYL-2'-CHLOROETHYLAMIDE HYDRATE (ACEA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "810", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ARACHIDONYLETHANOLAMIDE (ANADAMIDA, AEA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "811", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOCYTIN 98% (TLC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "812", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BLOTTING-GRADE BLOCKER. 300 G, NONFAT DRY MILK FOR WESTERN BLOTTING APPLICATIONS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "813", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BLOTTO, NON-FAT DRY MILK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "814", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CACODILATO DE SODIO, TRIHIDRATADO,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "815", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARESTREAM BIOMAX LIGHT FILM. STANDARD CHEMILUMINESCENCE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "816", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CESIUM METHANESULFONATE, USED IN PATCH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "817", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CHIR 99021", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "818", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CITOCROMO C DE CORAZÓN BOVINO, FRASCO 50 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "819", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CP-55940", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "820", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CYTOCHALASIN D", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "821", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DAPT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "822", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIALIL TRISULFURO (DI-2-PROPENYL TRISULFIDE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "823", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DL-2-AMINO-5-PHOSPHONOPENTANOIC ACID", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "824", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DOPAMINE HYDROCHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "825", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DYETHYLPYROCARBONATE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "826", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELCUBRAGISTAT  (SYNONYMS: ABX-1431)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "827", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ELECTROGEL CONDUCTIVO ELECTRO-CAP", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "828", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EM PROTEÍN-A/ GOLD, 25 NM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "829", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ERITROSINA B", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "830", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FCCP", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "831", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUOROMOUNT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "832", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FRASCO DE 500 GRAMOS DE LECHE DESCREMADA PARA WESTERN BLOT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "833", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GBX FIJADOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "834", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GBX REVELADOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "835", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GELATINA DE PIEL DE CERDO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "836", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "837", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUCOSE 6-PHOSPHATE DEHYDROGENASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "838", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTAMAX 100X", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "839", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLUTATHIONE REDUCTASE FROM BAKER'S YEAST (S. CEREVISIAE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "840", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GOLD (III) CHLORIDE TRIHYDRATE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "841", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUINEA PIG LIVER ACETONE TISSUE (POLVO DE HÍGADO) FCO. 1 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "842", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRAZINA MONOHIDRATADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "843", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HISTIDINE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "844", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HRP CONJUGATE SUBSTRATE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "845", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IMMOBILON CRESCENDO WESTERN HRP SUBSTRATE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "846", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOPROPÓXIDO DE TITANIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "847", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MONOACYLGLYCEROL LIPASE (MAGL) INHIBITOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "848", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LACTOTRANSFERRINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "849", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LAMININ FROM ENGELBRETH-HOLM-SWARM MURINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "850", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-CISTEINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "851", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-CISTEÍNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "852", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LECHE DESCREMADA EN POLVO BASE PARA USO EN MEDIO DE CULTIVO MICROBIOLÓGICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "853", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTAMINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "854", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-GLUTATIÓN OXIDADO (GSSG)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "855", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIPOPOLYSACCHARIDES FROM ESCHERICHIA COLI O111:B4", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "856", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LÍQUIDO REFRIGERANTE, DE ALTO RENDIMIENTO, AZUL UV, 23.7 FL OZ (24 FL OZ)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "857", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE INCLUSIÓN PARA TEJIDO EN FRESCO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "858", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METHOXYPOLYETHYLENE GLYCOL AMINE (PEG AMINA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "859", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N,N-DIMETHYL-4-NITROSOANILINE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "860", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-ETHYLMALEIMIDE CRYSTALLINE, =98% FRASCO 25 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "861", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-ETIL-N'-(3- DIMETILAMINOPROPIL)CARBODIIMIDA HYDROCHLORIDE (EDAC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "862", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGOMICINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "863", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PARAFINA, PAQUETE DE 1 KG.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "864", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PARAFORMALDEHÍDO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "865", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PARAFORMALDEHÍDO GRANULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "866", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PENTAACETATO DE DIETILENTRIAMINA 3820", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "867", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHTALDIALDEHIDO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "868", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIRIDOXAL 5 FOSFATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "869", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLYETHYLENIMINE MN 2100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "870", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLY-L-LYSINE SOLUTION. (100 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "871", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RESINA LR WHITE GRADO MEDIO, PARA MICROSCOPIA ELECTRONICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "872", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SACAROSA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "873", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SACAROSA GRADO ACS, 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "874", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SAG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "875", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SB 431542", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "876", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SPAUTIN-1. =98% (HPLC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "877", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "STREPTOZOCIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "878", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUSTRATO QUIMIOLUMINISCENTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "879", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TARIQUIDAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "880", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TAURINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "881", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TETRAÓXIDO DE OSMIO, CRISTALINO PARA MICROSCOPÍA ELECTRONICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "882", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THIOUREA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "883", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TISSUE TECK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "884", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRANSFERRIN RECEPTOR (TFR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "885", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRANSFERRINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "886", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WIN 55,212-2", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "887", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XANTINA -FRASCO DE 25MG (XANTHINE =99%)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "888", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XANTINA OXIDASA =99.5% (HPLC), FRASCO 5 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "889", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XANTINE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "890", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XANTINE OXIDASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "891", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "Y-27632 DIHYDROCHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "892", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZM 241385", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "893", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE SODIO ACS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "894", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROQUINA SAL DIFOSFATADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "895", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MTT (BROMURO DE 3-(4,5-DIMETILTIAZOL-2-IL)-2,5-DIFENILTETRAZOLIO)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "896", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "897", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO GRADO ACS FRASCO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "898", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBONATO DE POTASIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "899", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDROXIDO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "900", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE CALCIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "901", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PIRUVATO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "902", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROQUINA DIFOSFATO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "903", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE SODIO CRISTALES GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "904", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-KYNURENINE SULFATE SALT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "905", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "906", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GUANOSINE 5’-TRIPHOSPHATE SODIUM SAL HYDRATE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "907", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ADENOSINE 5´ TRIPHOSPHATE MAGNESIUM SALT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "908", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIBUTYRYL-CAMP, SODIUM SALT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "909", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO TRICLOROACÉTICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "910", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO FÉRRICO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "911", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XYLENOL ORANGE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "912", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERSULFATO DE AMONIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "913", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AMMONIUM PERSULFATE (APS). CATALYST.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "914", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBONATO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "915", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERBORATO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "916", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETATO DE PLOMO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "917", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "O-VANADATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "918", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXADECYLTRIMETHYLAMMONIUM BROMIDE (CTAB)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "919", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-HIDROXISULFOSUCCINIMIDA (SULFO- NHS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "920", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETATO DE ZINC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "921", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2,6 DICLOROFENOLINDOFENOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "922", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ARSENITO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "923", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-GLUCOSA 6 PHOSPHATE SODIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "924", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "925", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDROSULFITO DE SODIO (DT)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "926", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO FERROSO AMONIACAL GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "927", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERSULFATO DE AMONIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "928", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2,3,5-TRIPHENYLTETRAZOLIUM CHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "929", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO NAH2PO4. H2O GRADO ACS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "930", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS FRASCO 500 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "931", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DIBÁSICO DE SODIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "932", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO MONOBÁSICO DE POTASIO GRADO REACTIVO ACS =99.0%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "933", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2',7'-DICHLOROFLUORESCEIN, FRASCO DE 5 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "934", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2',7'-DICHLOROFLUORESCEIN DIACETATE (DIACETATO DE DICLOROFLUORESCEÍNA), FRASCO 1 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "935", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS, FRASCO 250MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "936", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "7-AAD VIABILITY STAINING SOLUCIÓN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "937", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANNEXINV-FITC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "938", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL BRILLANTE DE COOMASIE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "939", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL DE ANILINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "940", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL DE BROMOFENOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "941", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL DE BROMOFENOL DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "942", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL DE TIAZOLIL BROMURO DE TETRAZOLIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "943", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL TRIPANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "944", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BRU (5-BROMO.2`-DEOXYURIDINE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "945", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DE AZUL BRILLANTE DE COOMASSIE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "946", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CRYSTAL VIOLET", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "947", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DAPI", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "948", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DI-4-ANEPPDHQ", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "949", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EOSINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "950", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EOSINA AMARILLENTA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "951", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ER-TRACKER GREEN (BODIPY FL GLIBENCLAMIDE), FOR LIVE-CELL IMAGING", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "952", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESCARLATA DE BIEBRICH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "953", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUORESCEIN ISOTHIOCYANATE (FITC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "954", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUORO JADE B", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "955", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FLUOROJADE C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "956", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEMATOXILINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "957", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEMATOXILINA DE HARRIS LISTA PARA USAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "958", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEMATOXILINA FÉRRICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "959", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "H2DCFDA (H2-DCF, DCF).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "960", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "O-FTALADEHÍDO = 98% , FRASCO 5 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "961", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ORANGE G (25 G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "962", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PAP PEN TED PELLA FOR IMMUNOSTAINING 2MM.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "963", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PONCEAU-S, SODIUM SALT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "964", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROPIDIUM IODIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "965", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE SCHIFF", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "966", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SYTO 9 STAIN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "967", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TINCIÓN DE PONCEUS (PONCEUS STAIN). FCO. 500 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "968", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "VECTASHIELD, MEDIO DE MONTAJE. FCO. 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "969", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "970", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "2-PROPANOL, GRADO BIOLOGÍA MOLECULAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "971", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "972", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA CON PUREZA DE 99%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "973", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA EN ENVASE DE PLÁSTICO. PRESENTACION DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "974", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO GRADO HPLC , FRASCO 4 LT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "975", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETÍLICO 96% PORRON DE 20L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "8", "maximum_amount": "22" }, { "number": "976", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETILICO ABSOLUTO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "977", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFORMO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "978", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFORMO GRADO BIOLOGÍA MOLECULAR 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "979", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DILUYENTE PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "980", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DILUYENTE PARA WESTERN BLOT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "981", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL ABSOLUTO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "982", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL GRADO BIOLOGÍA MOLECULAR 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "983", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "984", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÉTER ETÍLICO ANHIDRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "985", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38% PORRÓN 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "986", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISOPROPANOL GRADO HPLC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "987", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL GRADO HPLC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "988", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL GRADO HPLC. FCO. 4 L.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "5", "maximum_amount": "13" }, { "number": "989", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "990", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLVENTE PARA ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "991", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SPAN60", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "992", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TETRAHIDROFURANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "993", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILENO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "994", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "995", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "4-NITROPHENYL PHOSPHATE DISODIUM SALT HEXAHYDRATE 5 MG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "996", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONA EN ENVASE DE PLÁSTICO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "16" }, { "number": "997", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO ACETICO (JT BAKER)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "998", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO CLORHÍDRICO REACTIVO ANALÍTICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "999", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO NITRICO 68-70% CONCENTRACION.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1000", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR DE MUELLER HINTON MEDIO DE CULTIVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1001", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAR MAC CONKEY MEDIO DE CULTIVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1002", "cucop_code": "25101-0063", "specific_item_code": "25101", "cucop_description": "AGUA BIDESTILADA", "description": "AGUA BIDESTILADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "11" }, { "number": "1003", "cucop_code": "25101-0062", "specific_item_code": "25101", "cucop_description": "AGUA DESIONIZADA", "description": "AGUA DESIONIZADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1004", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-BRAF (MUTATED V600 E) ANTIBODY, CLONA VE1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1005", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ALFA-SINUCLEINA (FOSFORILADA) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1006", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ALFA 1 ANTITRIPSINA (A1AT) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1007", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ALFA-TAU (FOSFORILADA) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1008", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI PRION PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1009", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-ACTH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1010", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-FSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1011", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-HORMONA DE CRECIMIENTO (GH) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1012", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-LH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1013", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-PROLACTINA (PRL) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1014", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-RECEPTOR DE ESTROGENOS PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1015", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-RECEPTOR DE PROGESTERONA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1016", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-SARS-COV-2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1017", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ANTI-TSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1018", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO ATRX PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1019", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO BETA CATENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1020", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO C1Q PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1021", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO C3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1022", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD166 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1023", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD20 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1024", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1025", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD30 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1026", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD34 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1027", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD35 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1028", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD38 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1029", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1030", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD56 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1031", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD57 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1032", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD68 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1033", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CD8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1034", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CÉLULAS PLASMÁTICAS PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1035", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CK 5/6 COCKTAIL PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1036", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CK AE1/AE3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1037", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CK-HMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1038", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CK-LMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1039", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CLAUDINA 1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1040", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CLAUDINA 3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1041", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CLAUDINA 5 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1042", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO CMV PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1043", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO EBV EBNA-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1044", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO EBV ZEBRA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1045", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO E-CADERINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1046", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO EMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1047", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FACTOR VIII PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1048", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO FASCINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1049", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO GAB-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1050", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO H3K27 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1051", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO HISTONE H3K27ME3 CLONA RM175 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1052", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO HIV PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1053", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO HMB45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1054", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IDH1 SILVESTRE PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1055", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IDH1-R132H PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1056", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IDH2 CLONA R511-KMAB-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1057", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IDH2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1058", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IGG PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1059", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO IL-2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1060", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO INI-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1061", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO INSM1 CLONA BSB-123 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1062", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO INSM1 CLONA A-8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1063", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO KAPPA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1064", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO KI-67 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1065", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO L1CAM CLONA UJ127.11 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1066", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO L1CAM PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1067", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO LAMBDA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1068", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO LISOZIMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1069", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MAP 2 CLONA HM-2PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1070", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MGMT CLONA MT3.1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1071", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MIOGENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1072", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO MN1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1073", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO NEUN FOX3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1074", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO NKP46 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1075", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO NMDAR1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1076", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO NSE PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1077", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO OCLUIDINA ZO-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1078", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO OLIG-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1079", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO OLIG2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1080", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO OSTEONECTINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1081", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO P16 CLONA GT1249 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1082", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO P53 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1083", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO P65 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1084", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PANTRK CLONA RM423 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1085", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PGFA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1086", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PLAP PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1087", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PS100 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1088", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO PS6 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1089", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SINAPTOFISINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1090", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1091", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SSTR2A CLONA 11H21L13 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1092", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO STAT6 CLONA YE361 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1093", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO STAT6 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1094", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO SV40 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1095", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO TDP-43 (FOSFORILADA) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1096", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO TERT CLONA 2C4 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1097", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO TTF1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1098", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO VIMENTINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1099", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTICUERPO YAP1 CLONA SU33-06 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IGG (µ-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANTI-HUMAN IGG (¿-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AZUL DE CRESIL BRILLANTE AL 1%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BASE DE MEDIO LOWESTEIN-JENSEN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE FOSFATOS PARA WRIGTH DE 7.4 (MERK) SIN COLOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE REFERENCIA STD PARA PH 4 SIN COLOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE REFERENCIA STD PARA PH 7 SIN COLOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE DE WRIGTH (MERK)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE STERNHEIMER-MALBIN COL. PARA SEDIMENTO URINARIO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CRIOVIAL DE POLIPROPILENO DE 2 ML BASE PLANA PARA CONGELACION, CON TAPAROSCA Y GRADUADO, ESTERILES Y LIBRES DE PIROGENOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEXTROSA EN POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEXTROSOL SOLUCION GLUCOSADA 75 G EN 250 ML. SE SUGIERE HYCEL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "57", "maximum_amount": "144" }, { "number": "1112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIETANOLAMIDA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL ABSOLUTO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL AL 70%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETANOL AL 96%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FIB – TEM 10 X 5 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DEL CONTENIDO DE FIBRINOGENO Y POLIMERIZACIÓN DE FIBRINA MEDIANTE TROMBOELASTOMETRÍA. COMPONENTES: CITOCALASINA D, CACL2 Y CONSERVANTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEMATOXILINA DE HARRIS LIBRE DE OXIDO DE MERCURIO ROJO, LISTA PARA USARSE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEP – TEM 10 X 7 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA LA EVALUACIÓN DE LA PRESENCIA DE HEPARINA EN LA VÍA INTRÍNSECA DE LA COAGULACIÓN MEDIANTE EL USO DE LA TROMBOELASTOMETRÍA. COMPONENTES DE LIOFILIZADO: HEPARINASA DE FLAVOBACTERIAS, CONSERVANTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO REACTIVO ANALÍTICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "IN – TEM 10 X 10 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DE LA COAGULACIÓN MEDIANTE ACTIVACIÓN DE LA VÍA INTRINSECA Y LA INFLUENCIA DE ANTICOAGULANTES. COMPONENTES: FOSFOLIPIDO-TROMBOPLASTINA PARCIAL DEL CEREBRO DE CONEJO, ÁCIDO ELAGICO Y CONSERVANTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE AGLUTINACIÓN EN LÁTEX PARA DETECCIÓN DE HISTOPLASMA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE AMPLIFICACION PARA METILACION DEL GEN MGMT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1124", "cucop_code": "25901-0012", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA LIQUIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE CONVERSION DE DNA CON BISULFITO DE SODIO PARA EVALUAR METILACION MEDIANTE PCR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE DNA DE TEJIDO EMBEBIDO EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE DNA, RNA Y PROTEÍNAS A PARTIR DE TEJIDO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE EXTRACCIÓN DE RNA DE TEJIDO EMBEBIDO EN PARAFINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LEVOFLOXACINO 5 MCG SENSIDISCOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LIMPIADOR DE PARAFINA DC EN SPRAY, NO TOXICO Y A BASE DE ACEITE MINERAL EN MEDIO ALCOHÓLICO (PANREAC)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100 PB EN ESCALERA DE 100 PB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 50 PB EN ESCALERA DE 50 PB", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR PAP PEN (PLUMA) PARA INMUNOHISTOQUÍMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL GRADO HPLC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MIDDLEBROOK 7H9 BROTH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE PLATA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NUEVO AZUL DE METILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO ACTIN F PARA PCR CON SECUENCIA AGGGAGTATATAGGTTGGGGAAGTT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO ACTIN R PARA PCR CON SECUENCIA AACACACAATAACAAACACAAATTCAC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO GADPH FW 5'-GAAGGTCGGAGTCAACGGATTT-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO GADPH RV 5'-CTGGAAGATGGTGATGGGATT-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO GB FW 5´-ACTGGAACTTTACTCGCAGAAAGA-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO GB RV 3'-CTCCACGTACTTTACCCGCTG-5' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO IE-1-A FW 5'-GAAGGCTGAGTTCTTGGTAA-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO IE-1-B RV 3'-AGCTGCATGATGTGAGCAAG-5' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO IE-1-C RV 3'-TGAGGATAAGCGGGAGATGT-5' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO IE-1-D FW 5'-CTGAGGCAAGTTCTGCAATG-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO LMP-1 FW 5'-CCAGACAGCAGCCAATTGTC-3' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO LMP-1 RV 3'-GGTAGAAGACCCCCTCTTAC-5' 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E1F PARA PCR CON SECUENCIA GCGCTCTCTTGCTTTTCTCA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E1R PARA PCR CON SECUENCIA GACACTCACCAAGTCGCAAA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E2F PARA PCR CON SECUENCIA TGGAGCTGTCTGGTTGTGAG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E2R PARA PCR CON SECUENCIA TGGAAAACATGCCGTTATCA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E5F PARA PCR CON SECUENCIA CCGTGAAG-GAATGGCTTCTG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO MGMGT E5R PARA PCR CON SECUENCIA TAGCTCCCGCTCCCTTG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO P1METHF PARA PCR CON SECUENCIA TTTCGACGTTCGTAGGTTTTCGC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO P1UNMETHF PARA PCR CON SECUENCIA TTTGTGTTTTGATGTTTGTAGGTTTTTGT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA CTCGAAACTACCACCGTCCCGA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA GCACTCTTCCGAAAACGAAACG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO P2UNMETHR PARA PCR CON SECUENCIA AACTCCACACTCTTCCAAAAACAAAACA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 3´-CAACTTCATCCACGTTCACC-5´ 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 5´-GAAGAGCCAAGGACAGGTAC-3´ 200 NANOMOLES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1162", "cucop_code": "24101-0126", "specific_item_code": "24101", "cucop_description": "PARAFINA", "description": "PARAFINA PARAPLAST, HISTOPLAST, MERCK O SAKURA, CON PUNTO DE FUSIÓN 56°-58°C, PRESENTACIÓN EN LENTEJAS PARA USO EN EQUIPO CENTRO DE INCLUSIÓN LEICA MODELO EG1160 PROPIEDAD DEL INNN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "8", "maximum_amount": "20" }, { "number": "1163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PCR MASTER MIX KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLI-L-LISINA EN SOLUCIÓN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROTEINASA K EN SOLUCIÓN DE 20 MG / ML, VIAL DE 1.0 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1167", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PRUEBA DE UN PASO ANTI HCV. REACTIVO PARA LA DETERMINACIÓN DE HEPATITIS C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1168", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R EX – TEM 10 X 10 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DE LA COAGULACIÓN MEDIANTE ACTIVACIÓN DE LA VÍA EXTRINSECA EN LA TROMBOELASTOMETRÍA. COMPONENTES: FACTOR TISULAR RECOMBINANTE Y FOSFOLIPIDOS, INHIBIDOR DE LA HEPARINA Y CONSERVANTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE SCHIFF FUCSINA - SULFITO LISTO PARA USARSE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1170", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROJO NUCLEAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1171", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROSA DE BENGALA, AGLUTINACIÓN EN PORTA. KIT DE DETERMINACIÓN CUALITATIVA DE ANTICUERPOS ANTI-BRUCELLA IVD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1172", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROTROL N 5 X 4 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA VERIFICAR SEMANALMENTE EL FUNCIONAMIENTO DEL EQUIPO, CON RELACIÓN A UNA MUESTRA NORMAL. COMPONENTES: EL PLASMA DE CONTROL LIOFILIZADO SE OBTIENE DE PLASMA HUMANO EXTRAÍDO CON CITRATO SODICO COMO ANTICOAGULANTE (0.129 MOL/L). CONTENIDO: LIOFILIZADO 4 PRUEBAS, DILUYENTE 1300 MICROLITROS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1173", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROTROL P 5 X 4 (RECATIVO LIOFILIZADO (POLVO COLOR BLANCO) Y DILUYENTE TRANSPARENTE PARA VERIFICAR SEMANALMENTE EL FUNCIONAMIENTO DEL EQUIPO, CON RELACIÓN A UNA MUESTRA NORMAL. COMPONENTES: EL PLASMA DE CONTROL LIOFILIZADO SE OBTIENE A PARTIR DE PLASMA HUMANO EXTRAÍDO CON CITRATO SODICO COMO ANTICOAGULANTE (0.129 MOL/L). CONTENIDO: LIOFILIZADO 4 PRUEBAS, DILUYENTE 1300 MICROLITROS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1174", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA CROMÓGENO DIAMINOBENCIDINA K3468 (DAB + CHROMOGEN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1175", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA LSAB - HRP SISTEMA DE DETECCIÓN K0690 (LINK Y ESTREPTAVIDINA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1176", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SISTEMA PARA IDENTIFICACIÓN DE ENTEROBACTERIAS 20 E", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1177", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN DESCONTAMINANTE DE RNASAS DE SUPERFICIES, EN SPRAY (RNASEZAP)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1178", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION YODO LUGOL PARA COPROPARASITOSCOPICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1179", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "STAR – TEM 10 X 10 (REACTIVO PARA LA RECALCIFICACIÓN DE LA SANGRE CITRATADA PARA LA REALIZACIÓN DE PRUEBAS DE TROMBOELASTOMETRÍA. COMPONENTES: CACL2 Y CONSERVANTES)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1180", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TARGET SOLUCIÓN RECUPERADORA DE ANTÍGENOS PARA INMUNOHISTOQUÍMICA PH 6 (CONCENTRADA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1181", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TINCION EA50 PARA PAPANICOLAOU LISTA PARA USARSE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1182", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TINCION OG-6 PARA PAPANICOLAOU LISTA PARA USARSE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1183", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIZOL PARA EXTRACCIÓN DE RNA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1184", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "XILOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1185", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "ACCESO CERRADO LUER CON TECNOLOGIA SPLIT SEPTUM PARA TOMA DE CURVAS DE INSULINA Y HORMONA DE CRECIMIENTO. SE SUGIERE EL NUM DE REF 385100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1186", "cucop_code": "25501-0059", "specific_item_code": "25501", "cucop_description": "ACEITE DE INMERSION", "description": "ACEITE DE INMERSION EN BOTELLA AMBAR SE SUGIERE MERCK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1187", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "AGITADOR MAGNETICO DE COLORES (BARRA MAGNETICA) DE 10 X 3 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1188", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "AGITADORES DE VIDRIO 6.4MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1189", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA EMG, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG50.PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "12", "maximum_amount": "32" }, { "number": "1190", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMF37. SE REQUIERE MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "1191", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG37. SE REQUIERE MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "1192", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 21G X 1 \" ( 0.8 MM X 25 MM) COLOR VERDE REF. 301746", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "45", "maximum_amount": "113" }, { "number": "1193", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 22G X 1 \" ( 0.7 MM X 25 MM ) COLOR NEGRO REF. 301747", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1194", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, ESTERIL Y DESECHABLE DE 22G X 1.5 \" ( 0.7 X 38 MM ) COLOR NEGRO REF. 360211", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1195", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGUJAS PARA TOMA DE MUESTRAS SANGRE AL VACÍO 21 G X 38 MM (VERDE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "48", "maximum_amount": "120" }, { "number": "1196", "cucop_code": "25501-0091", "specific_item_code": "25501", "cucop_description": "MATERIAL DE MADERA PARA USO EN LABORATORIO DE MEDICION", "description": "APLICADORES DE MADERA CON PUNTA DE ALGODÓN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "24", "maximum_amount": "60" }, { "number": "1197", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "BANDA DE ESFUERZO RESPIRATORIO Z-RIP GRANDE 114-312 CMS, (SENSOR PARA RESPIRACIÓN ABDOMINAL) NECESARIO MUESTRA FISICA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1198", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BANDAS TORAXICAS ABDOMINALES DE PLETISMOGRAFIA NO CALIBRADAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1199", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BANDAS TORAXICAS ABDOMINALES Y DE TORAX. NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1200", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BASE PARA TUBO TIPO VACUTAINER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "24", "maximum_amount": "60" }, { "number": "1201", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BASES PLASTICAS PARA LAS AGUJAS DE TOMA DE MUESTRA SANGUINEA AL VACIO (DE LA MISMA MARCA DE LAS AGUJAS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "1202", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 18 CM X 20 CM TIPO ZIPLOC CAJA C/25 BOLSAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "12", "maximum_amount": "30" }, { "number": "1203", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 27 CM X 28 CM TIPO ZIPLOC CAJA CON 25 BOLSAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1204", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "BOLSAS DE PIPETAS DE TRANSFERENCIA DE 2 ML C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1205", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BULBO DE SUCCION DE GOMA PARA PIPETA DE VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1206", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "BULBOS PARA PIPETA PASTEUR PARA 2 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1207", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJA DE PETRI DESECHABLE ESTÉRIL DE 90 X 150 MM (MUESTRA FÍSICA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1208", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "CAJA DE PLASTICO PARA 25 LAMINILLAS COLOR NEGRO PARA PORTA OBJETOS DE MEDIDA ESTANDAR 75 X 25 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1209", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 100µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1210", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 1000µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1211", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAJAS PARA ALMACENAR MICROTUBOS Y CRIOTUBOS (CRIOVIALES) DE 2ML DE BASE PLANA PARA CONGELACIÓN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1212", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CAMARA DE FUSCH ROSENTHAL CUADRICULA DOBLE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1213", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "CANULA (CATETER) CANULA PARA MEDICIÓN DE FLUJO RESPIRATORIO Y/O MEDICIÓN DE CO2 RESPIRATORIO COD. S11057 LONGITUD 2.1 MTRS NASAL ADULTO DESECHABLE NECESARIO MUESTRA FISICA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1214", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "CANULA (CATETER) CANULA PARA MEDICIÓN DE FLUJO RESPIRATORIO Y/O MEDICIÓN DE CO2 RESPIRATORIO COD. S11058 LONGITUD 2.1 MTRS ORONASAL ADULTO DESECHABLE NECESARIO MUESTRA FISICA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1215", "cucop_code": "25501-0079", "specific_item_code": "25501", "cucop_description": "PAÑUELOS ANTIESTATICOS", "description": "CEPILLO CON ESPONJA ONE-STEP (GLUCONATO DE CLORHEXIDINA 2%, ALCOHOL ISOPROPILICO 70%)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "240", "maximum_amount": "600" }, { "number": "1216", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "CHAIRA DE 30 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1217", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "CONOS PARA OTOSCOPIO MCA. WELCH ALLYN 4.25 MM SINGLE-USE, ADULT TIP, REF 52434-U CAJA CON 25 PAQUETES C/ 34 PZAS C/U", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1218", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 15 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 29 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1219", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 20 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 36 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1220", "cucop_code": "25501-0109", "specific_item_code": "25501", "cucop_description": "CUBREHEMATIMETRO", "description": "CUBRE HEMACIÍMETRO/CUBRE OBJETOS 22 X 22 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1221", "cucop_code": "25501-0106", "specific_item_code": "25501", "cucop_description": "CUCHILLAS PARA MICROTOMO", "description": "CUCHILLAS DESECHABLES DE ALTO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 14 X 0.35 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "1222", "cucop_code": "25501-0106", "specific_item_code": "25501", "cucop_description": "CUCHILLAS PARA MICROTOMO", "description": "CUCHILLAS DESECHABLES DE BAJO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 8 X 0.25 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "1223", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "DENSIMETRO CON PROBETA DE CRISTAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "72", "maximum_amount": "180" }, { "number": "1224", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES 2.5 LONGITUD. NECESARIO MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1225", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES. 2.0 DE LONGITUD. NECESARIO MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1226", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODO CON PARCHE ADHESIVO (TWO CHANNEL LARYNGEAL SUFARCE ELECTRO DE DRAGONFLY) LSE500DCS NECESARIO MUESTRA FISICIA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1227", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODO PARA IONES ESPECIFICOS (ELECTRODO PARA NEUROESTIMILADOR DE 5CM X 5CM, CUADRADO, MODELO CF5050 COMPATIBLE CON EQUIPO VALU TRODE PROPIEDAD DEL INNN PAQUETE CON 4 PIEZAS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1228", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS DE ANILLO PARA NEUROCONDUCCIÓN SENSITIVA DESECHABLE. NECESARIO MUESTRA FÍSICA (ELECTRODO DE TIERRA CON TERMINACION EN ARGOLLA DE ACERO INOXIDABLE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1229", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS DE TIERRA DESECHABLE PARA LA REALIZACIÓN DE ESTUDIOS NEUROFISIOLÓGICOS. NECESARIO MUESTRA FÍSICA UN PAR EN CADA PAQUETE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1230", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326A (AUDIFONOS DE INSERCIÓN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1231", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326B (AUDIFONOS DE INSERCIÓN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1232", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 A. (AUDIFONOS DE INSERCIÓN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "1233", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 B. (AUDIFONOS DE INSERCIÓN)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1234", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. ELECTRODOS CONDUCTORES ADHESIVOS PARA EGK KENDAL MEDI-TRACE 100. EQUIPO PROPIEDAD DEL INNN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "1235", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. PARA ESTUDIOS PSG CON CONECTOR DE BROCHE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1236", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ELECTRODOS TIMPÁNICO PARA ELECTROCOCLEOGRAFÍA N° PARTE 8049550 PARA EQUIPO PARA EQUIPO ECLIPSE PROPIEDAD DEL INNN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1237", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "EMBUDO DE PLASTICO 75 MM. DE DIAMETRO X 110 DE ALTURA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1238", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "EMBUDO SENCILLO DE VIDRIO DE 1 LITRO DE CAPACIDAD", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1239", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "EQUIPO ALADO ULTRA-TOUCH PARA TOMA DE MUESTRAS SANGUINEAS AL VACIO CON AGUJA NO. 23 G X .75 CON TUBO DE PLASTICO FLEXIBLE DE 7\"(AZUL CLARO) CON TECNOLOGIA DE PARED ULTRAFINA RIGTHGAUGE QUE PERMITE UTILIZAR CALIBRES MAS PEQUEÑOS PARA LOS ACCESOS VENOSOS DIFICILES Y CON DISEÑO PENTAPOINT DE 5 BISELES EL CUAL DISMINUYE LA FUERZA DE PENETRACIÓN DE LA AGUJA CON SISTEMA DE BOTÓN DE SEGURIDAD PARA LA RETRACCIÓN DE LA AGUJA (\"PUSH BUTTON\")", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1240", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLON CERDA NATURAL, PARA LAVADO DE MATERIAL DE LABORATORIO, ELABORADO DE CERDA NATURAL QUE NO RAYA, CON UN SOPORTE DE ALAMBRE GALVANIZADO O ACERO INOXIDABLE. ANILLO EN EL EXTREMO DEL MANGO PARA COLGAR, LONGITUD TOTAL 40 CM, DIÁMETRO DE BARRIDO 15CM, DIÁMETRO DE CEPILLO 5 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1241", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLON DE DE 60 CM DE LARGO CON CERDAS DE 18 CM X 5 CM DIÁMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1242", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 10 X 75 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1243", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 100 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1244", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 75 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1245", "cucop_code": "25501-0097", "specific_item_code": "25501", "cucop_description": "ESCOBILLON PARA LABORATORIO", "description": "ESCOBILLONES PARA PROBETAS DE 2000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1246", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "ESTIMULADORES MONOPOLARES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "1247", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "ESTUCHE DE CARTON PLEGABLE PARA 1 LAMINILLA DE 1 X 3 PULGADAS, DE 4 X 9.5 CM Y 0.5 CM DE GROSOR UNA VEZ CERRADA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "40", "maximum_amount": "100" }, { "number": "1248", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "FILTRO PERMANENTE PARA CONTENEDOR ESTÁNDAR. FILTRO REDONDO MOD. JK090 FORMA REDONDA PARA 100 CICLOS DE LAVADO Y ESTERILIZACIÓN, 190 MM DE DIÁMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "17" }, { "number": "1249", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "FILTROS 2097 P100 PARA 3M RESPIRADOR 6200", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1250", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "FLECHA DE EVIDENCIA PARA CONTENEDOR PARA ESTERILIZACIÓN EN VAPOR (FLECHA COLOR BLANCO) CAJA CON 500 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "17" }, { "number": "1251", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "FLEXI WRAP TAPES DESECHABLES PARA SENSOR SPO2, CINTA PARA FIJACION DE OXIMETRO DE PULSO DESECHABLE TAMAÑO ADULTO. NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "7" }, { "number": "1252", "cucop_code": "25501-0018", "specific_item_code": "25501", "cucop_description": "FRASCO AMBAR", "description": "FRASCO AMBAR (FRASCO DE PLASTICO AMBAR, PARA MANTENER LA INTEGRIDAD DE LOS METABOLITOS SENCIBLES A LA LUZ, CON ESCALA DE GRADUACION QUE PERMITE MEDIR EL VOLUMEN DE LA ORINA REDUCIENDO EL RIESGO DE EXPOSICION. CON TAPA HERMETICA QUE EVITA RIESGO DE FUGAS Y CONTAMINACION Y ADAPTADOR DE TRANSFERENCIA INTEGRADO PARA LA RECOLECCION DE ORINA DE 24HRS VOL 3LTS REF.364999)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1253", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCO DE BOCA ANCHA ESTÉRI PARA UROCULTIVO DE 60 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1254", "cucop_code": "25501-0018", "specific_item_code": "25501", "cucop_description": "FRASCO AMBAR", "description": "FRASCO DE PLASTICO CON TAPA DE ROSCA (PARA MUESTRAS DE ORINA), NO ESTERIL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "600", "maximum_amount": "1500" }, { "number": "1255", "cucop_code": "25501-0018", "specific_item_code": "25501", "cucop_description": "FRASCO AMBAR", "description": "FRASCOS DE VIDRIO ÁMBAR TIPO JARABE DE 100 ML CON TAPÓN DE ROSCA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "25" }, { "number": "1256", "cucop_code": "25501-0078", "specific_item_code": "25501", "cucop_description": "GEL REFRIGERANTE", "description": "GEL CONDUCTIVO PARA ESTUDIOS DE ULTRASONIDO. FORMULA ESTABILIZADA ANTI RESEQUEDAD, RESISTENTE A SALES Y TRANSPIRACIÓN DEL CUERPO. NO MANCHA Y ES FACIL DE LIMPIAR. GARRAFON DE 4LITROS INCLUYE ENVASE APLICADOR DE 250 ML PARA RELLENAR.. NECESARIO MUESTRA FÍSICA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1257", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA MULTI-TUBOS. UNA CARA PARA 32 MICROTUBOS 0.5 ML, OTRA PARA MICROTUBOS 1.5 ML, OTRA PARA 12 TUBOS CÓNICOS 15 ML Y UNA PARA 4 TUBOS CÓNICOS 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1258", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLA PARA TUBO DE WINTROBE CON NIVEL DE BURBUJA Y TORNILLOS PARA AJUSTE DE NIVEL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1259", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GRADILLAS DE PLASTICO DE 25 CM. DE LARGO X 10.5 CM. DE ANCHO X 5.5 CM. DE ALTO, PARA 90 TUBOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1260", "cucop_code": "25501-0033", "specific_item_code": "25501", "cucop_description": "PORTA DELANTALES Y GUANTES", "description": "GUANTES DE HULE LATEX ROJOS TALLA MEDIANA N°8", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1261", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA CHICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1262", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA MEDIANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1263", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO GRANDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "24", "maximum_amount": "60" }, { "number": "1264", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO MEDIANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "60", "maximum_amount": "150" }, { "number": "1265", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTROS TAMAÑO CHICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1266", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JERINGA PRE LLENADA CON SOLUCION SALINA AL 0.9 % CON O SIN CANULA PLASTICA SIN FILTRO CUENTA CON UN PIVOTE LUER LOCK CON TAPON PROTECTOR EN EL PIVOTE PRE LLENADA CON SOLUCION ISOTONICA DE NA AL 0.9 (USP) CON UN DIAMETRO DE BARRIL EQUIVALENTE AL DE UNA JERINGA DE 10 ML. PRODUCTO INTERNAMENTE ESTERIL, PARA USARSE UNA SOLA VEZ Y DESECHARSE NO TOXICO LIBRE DE PIROGENOS, LIBRE DE CONSERVADORES Y LIBRE DE LATEX POSI FLUSH SE SUGIERE EL NUM DE REF.306574", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1267", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO INTERACUSTIC. MOD. AT 235, MED. 7, 8, 9.5, 11, 12.5, 14, 16 MM. CAT. BET25", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1268", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO MARCA MADSEN, MOD. ZODIAC 901 EQUIPO PROPIEDAD DEL INNN CAT. 8-69-29601", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1269", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "KIT DE ELECTRODOS AUTOADHERIBLES, CON ALOE VERA Y GEL, PARA PACIENTES CON PROBLEMA DE DEGLUCION, REG 59000, COMPATIBLE CON EQUIPO VITAL SLIM PROPIEDAD DEL INNN CAJA CON 12 SOBRES CON 2 PIEZAS DCADA SOBRE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1270", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "LAMINILLA CON REJILLAS PARA ORINA (GLASSTIC SLIDE 10 WITH GRIDS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1271", "cucop_code": "25501-0104", "specific_item_code": "25501", "cucop_description": "LAPIZ PUNTA DIAMANTE", "description": "LÁPICES CON PUNTA DIAMANTE PARA ROTULAR PORTAOBJETOS RETRACTILES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1272", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "MANGO DE LARINGOSCOPIO DE FIBRA OPTICA ILUMINACION HALOGENA CON HOJA CURVA # 3", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1273", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "MANGO DE LARINGOSCOPIO DE FIBRA OPTICA ILUMINACION HALOGENA CON HOJA CURVA # 4", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1274", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 1000 ML, VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1275", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 2000 ML, VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1276", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ERLENMEYER DE 2 LT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1277", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1278", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1279", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1280", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "MICRO ESPÁTULA DE ACERO INOXIDABLE CON CUCHARA EN UN EXTREMO DE 12.5 MM X 3 MM, CON ESPATULA EN EL OTRO EXTREMO DE 31 MM, DE 16 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1281", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROTUBO DE 1.5 ML TRANSPARENTE (TUBO TIPO EPENDORF) CAJA C/500", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1282", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROTUBOS DE POLIPROPILENO CÓNICOS DE 1.5 ML DE TAPA PLANA PARA MICROCENTRÍFUGA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1283", "cucop_code": "25501-0089", "specific_item_code": "25501", "cucop_description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION", "description": "MICROTUBOS PARA PCR DE 0.2 ML DE TAPA PLANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1284", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO CON MANO GRANDE DEPORCELANA 400 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1285", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "OXIMETRO DE FLEX (CINTA) OXIMETRO DE PULSO COMPATIBLE CON POLISOMNOGRAFIA DESECHABLE NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1286", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO LISO, FILTRACIÓN MEDIA / RÁPIDA, GRUESO, CON RETENCIÓN DE PARTÍCULAS DE 8-10 MICRAS CAJA C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1287", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO WHATMAN NO. 1 CIRCULAR DE 185 MM DE DIÁMETRO CAJA C/100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1288", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PAPEL PARA EQUIPO INTERACUSTICS AT 235 PROPIEDAD DEL INNN REF 1011002 EN ROLLO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1289", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PAPEL PARAFILM 10.16 CM X 38 MTS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "25" }, { "number": "1290", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PAPEL SEDA PARA LIMPIAR OBJETIVOS DE MICROSCOPIO DE 4 X 6 PULGADAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1291", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PIEDRA DE REEMPLAZO FINA PARA CARRUSEL DE 11.4 X 2.5 PULGADAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1292", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PIEDRA DE REEMPLAZO GRUESA PARA CARRUSEL DE 11.4 X 2.5 PULGADAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1293", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PIEDRA DE REEMPLAZO MEDIANA PARA CARRUSEL DE 11.4 X 2.5 PULGADAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1294", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PIEDRA PARA AFILAR, RECTANGULAR, CON UN LADO POROSO Y OTRO LISO, DE APROXIMADAMENTE 15 X 5 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1295", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "PIEZA FACIAL DE MEDIA CARA 3M MODELO 6100/07024 PARA FILTRO 3M MOD. 07024 PROPIEDAD DEL INNN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1296", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZA BAYONETA CHICA PARA ORL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1297", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZA BAYONETA GRANDE PARA ORL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1298", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZA CAIMÁN DE OIDO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1299", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZA ELECTRONICA DE RODILLO PARA BOLSAS DE SANGRE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1300", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS CON PUNTA GRUESA CON SIERRA DE 15 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1301", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS CURVAS FINAS DE 15 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1302", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS CURVAS GRUESAS DE 15 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1303", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS DE DISECCION SIN DIENTES DE 20 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1304", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS DE PUNTA FINA CON SIERRA DE 15 CM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1305", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS KELLY", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1306", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA PASTEUR CORTA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "1307", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA PASTEUR LARGA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "1308", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "PIPETAS AUTOMATICAS DE VOLUMEN VARIABLE DE 10 A 1000 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1309", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "PIPETAS AUTOMATICAS VOLUMEN VARIABLE 10 A 200 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1310", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETAS DE PLASTICO PARA TRANSFERENCIA DE UN SOLO PASO LIBRE DE DECANTACIÓN DESPUES DE CENTRIFUGACION PARA TUBO CONICO DE 12 ML PARA RETENER 1.0 ML DE ORINA MARCA KOVA REF. HY 87135", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1311", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETAS PASTEUR DE PLASTICO DE 1.5 ML REF. 200003.C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1312", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETAS PASTEUR DE VIDRIO DE 145 MM DE LARGO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1313", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETAS PASTEUR DE VIDRIO DE 210 MM DE LARGO ESTÉRILES CON ALGODÓN EN LA PARTE SUPERIOR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1314", "cucop_code": "25501-0068", "specific_item_code": "25501", "cucop_description": "PISETA", "description": "PISETA DE PLÁSTICO DE 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1315", "cucop_code": "25501-0068", "specific_item_code": "25501", "cucop_description": "PISETA", "description": "PISETA DE PLÁSTICO DE 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "5" }, { "number": "1316", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS CON PANTALLA ESMERILADA DE 75 MM X 25 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "40", "maximum_amount": "100" }, { "number": "1317", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM CON TEJIDO CONTROL POSITIVO PARA HONGOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1318", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOQUERATINA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1319", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE AMIGDALA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1320", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE APENDICE PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1321", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE GANGLIO PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1322", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE OVARIO PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1323", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PANCREAS PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1324", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PIEL PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1325", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PLACENTA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1326", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE TUMORES GERMINALES PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1327", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE UTERO PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1328", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ALFA FETOPROTEINA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1329", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ATRX PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1330", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA BHGC PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1331", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CEA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1332", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOMEGALOVIRUS PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1333", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA EMA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1334", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA HERPES VIRUS PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1335", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA IDH1 R132H PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1336", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA IDH2PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1337", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA KI67 PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1338", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA OLIG 1 PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1339", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA OLIG 2 PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1340", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PGFA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1341", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLACAS DE AMILODE PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1342", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLAP PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1343", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PROTEINA PRION PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1344", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PS100 PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1345", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA SINAPTOFISINA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1346", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA TOXOPLASMA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1347", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIH PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1348", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIMENTINA PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1349", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIRUS EPSTEIN BARR PARA INMUNOHISTOQUIMICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1350", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ZIEHL-NEELSEN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1351", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS ELECTROCARGADOS DE 75MM X 25MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1352", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS PARA MICROCOSPIA, 25 X 75 MM CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FISICA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1353", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS PARA MICROSCOPIA DE 25 X 75 MM, BORDES LISOS SIN ESMERILADO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1354", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTAOBJETOS PARA MICROSCOPIA, 25 X 75 MM, CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FÍSICA) CAJA CON 50 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "24", "maximum_amount": "60" }, { "number": "1355", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTATUBOS CON ADAPTADOR PARA EXTRACCION MULTIPLE PREMONTADO LUER LOCK PARA TOMA DE CURVAS DE INSULINA Y HORMONA DE CRECIMIENTO. SE SUGIERE EL NUM DE REF 364902 CAJA C/200", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1356", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETA DE VIDRIO 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1357", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETA DE VIDRIO 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1358", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETA DE VIDRIO 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1359", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETAS DE PLASTICO 1000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "120", "maximum_amount": "300" }, { "number": "1360", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETAS DE PLASTICO 2000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "120", "maximum_amount": "300" }, { "number": "1361", "cucop_code": "25501-0037", "specific_item_code": "25501", "cucop_description": "PROBETA", "description": "PROBETAS DE PLASTICO 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "72", "maximum_amount": "180" }, { "number": "1362", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS AZULES PARA PIPETA AUTOMATICA VOLUMEN 1000 µL (MICROLITROS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "9" }, { "number": "1363", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA DE 0.5 A 10 µL (BLANCAS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1364", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1365", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA PIPETAS AUTOMÁTICAS VOLUMEN 1 A 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1366", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE CO2 A PRUEBA DE GOLPES Y AGUA PARA MONITOR DE TRASLADO PARA SIGNOS VITALES. MARCA NIHON KOHDEN MODELO VISMOCATALOGO PVM-4763K", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1367", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE DEDO PARA SPO2. MONITOR CARE SCAPE. GE. NO. PARTE TS-SA-D", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1368", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE ESFUERZO RESPIRATORIO MAXXRIP SENSOR DE ESFUERZO POR PLETISMOGRAFIA DE INDUCTANCIA, PERMITE CAPTAR LOS MOVIMIENTOS EN TODA SU EXTENSION CON EL REGISTRO DE TODOS LOS CICLOS RESPIRATORIOS COD. S11664 LONGITUD DEL CABLE 2.1 MTRS, SENSOR DE TORAX, DESECHABLE, NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1369", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE ESFUERZO RESPIRATORIO MAXXRIP SENSOR DE ESFUERZO POR PLETISMOGRAFIA DE INDUCTANCIA, PERMITE CAPTAR LOS MOVIMIENTOS EN TODA SU EXTENSION CON EL REGISTRO DE TODOS LOS CICLOS RESPIRATORIOS COD. S11666 LONGITUD DEL CABLE 2.1 MTRS, SENSOR ABDOMEN, DESECHABLE, NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1370", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE FLUJO RESPIRATORIO MAXXIFLOW SENSOR ELECTRICO QUE DETECTA EL MOVIMIENTO DEL FLUJO RESPIRATORIO ORAL Y NASAL COD. S11486 LONGITUD 2.1 MTRS. TIPO DE CONECTOR PINO TP DESECHABLE NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "25" }, { "number": "1371", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE INTERFACE MAXXRIP SENSOR DE PIEZO ELECTRICO PARA LA DETECCIÓN DE LOS MOVIMIENTOS RESPIRATORIOS Y ABDOMINALES. COD. S11659 LONGITUD DE CABLE 2.44 MTRS. TIPO DE CONECTOR PINO TP DESECHABLE, NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "12" }, { "number": "1372", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE POSICION MAXXI POSITIVO DETECTA LA POSICIÓN DEL PACIENTE CON PRESICIÓN Y RAPIDES EN EL REGISTRO DEL MOVIMIENTO. COD. S11247 LONGITUD DE CABLE 2.44 MTRS. TIPO DE CONECTOR PINO TP DESECHABLE, NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1373", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE PRESIÓN/FLUJO RESPIRATORIO MAS RONQUIDO CON CONECTOR EN LLAVE PARA EQUIPO PSG PROPIEDAD DEL INNN. NECESARIO MUESTRA FÍSICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1374", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE RONQUIDO CON SEÑAL DE SALIDA NO MAYOR A 1000 MV PICO DIAMETRO MAYOR A 200 MV CON CONECTOR DIN DE 1.5 MM, (SENSOR PARA MEDICIÓN DE SUEÑO) NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1375", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE RONQUIDO MAXXINORE, SENSOR PIEZOELECTRICO QUE DETECTA EL RONQUIDO POR VIBRACIÓN, CON ALTA SENSIBILIDAD. COD. S11036 LONGITUD 2.44 MTRS, TIPO DE CONECTOR PINO TP DESECHABLE NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "10", "maximum_amount": "25" }, { "number": "1376", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE TEMPERATURA DE SUPERFICIE REUSABLE. AVANCE GE # PARTE M1024254", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1377", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. PARTE M1024254", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1378", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. 3 PARTE M1024247", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1379", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "SENSOR NEONATAL/ADULTO PARA LA MEDICIÓN DE SPHB, SPO2, SPMET. PARA USO EN EQUIPO MARCA MASIMO, MODELO RAINBOW (R1 25L)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1380", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "SET DE CABLES PINCH (8500410)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1381", "cucop_code": "25501-0086", "specific_item_code": "25501", "cucop_description": "ELECTRODO PARA IONES ESPECIFICOS", "description": "SET DE ELECTRODOS SUBDERMICOS DE DOS CANALES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL EQUIPO PROPIEDAD DEL INNN", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "7", "maximum_amount": "18" }, { "number": "1382", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "SISTEMA CERRADO DE CATETER INTRAVENOSO - DOS PUERTOS PARA TOMA DE CURVAS DE INSULINA Y HORMONA DE CRECIMIENTO ( 24 GA 0.75 IN 0.7 X 19 MM) SE SUGIERE EL NUM DE REF 383531 CAJA C/20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1383", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "SISTEMA DE SEGURIDAD CON ADAPTADOR BIFURCADO PARA TOMA DE CURVAS INSULINA Y HORMONA DE CRECIMIENTO ( 22 GA 0.75 IN 0.9 X 19 MM ) SE SUGIERE EL NUM REF 383323 CAJA C/25", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "2", "maximum_amount": "6" }, { "number": "1384", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "SOPORTE DE CARRUSEL GIRATORIO PARA PIPETAS AUTOMATICAS 6 PLAZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1385", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAPA PARA TUBO CONICO PARA EGO MARCA KOVA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1386", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAPON CONECTOR DE SEGURIDAD Q-SYTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1387", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TERMISTOR DE FLUJO NASAL CON ENTRADA DIN (DE RESPIRACIÓN) NECESARIO MUESTRA FISICA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "4", "maximum_amount": "10" }, { "number": "1388", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "25501-0096 DE VARILLA PARA LABORATORIO CON RANGO DE TEMPERATURA DE -10°C A 150°C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1389", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "25501-0096 INFRARROJO SIN CONTACTO TIPO PISTOLA PARA USO HOSPITALARIO Y TOMAS CONTINUAS CON RANGO DE TEMPERATURA DE 32° A 42° C CON PRECISIÓN DE 0.3°C Y RESOLUCIÓN DE 0.1°C", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "3", "maximum_amount": "8" }, { "number": "1390", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "TUBO AL VACIO CON ANTICOAGULANTE CITRATO (TAPÓN AZUL) 2.7 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ALTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "53", "maximum_amount": "134" }, { "number": "1391", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "TUBO AL VACIO CON ANTICOAGULANTE EDTA (TAPÓN LILA) 4 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ANTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "49", "maximum_amount": "123" }, { "number": "1392", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE, CON GEL SEPARADOR, CON ACTIVADOR DE LA COAGULACIÓN Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 5 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "43", "maximum_amount": "108" }, { "number": "1393", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ROJO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "31", "maximum_amount": "78" }, { "number": "1394", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO CONICO PARA EGO DE 12 ML MARCA KOVA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "3" }, { "number": "1395", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 10 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1396", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 12 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "24", "maximum_amount": "60" }, { "number": "1397", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO DE ENSAYO VIDRIO SIN LABIO FONDO EN U, 13 X 100 MM, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1398", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "TUBO DE POLIESTIRENO DE 5 ML TRANSPARENTE DE (13 X 75 MM) CON TAPON BOLSA C/1000", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "6", "maximum_amount": "15" }, { "number": "1399", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADO VIDRIO DE 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1400", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADO VIDRIO DE 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "4" }, { "number": "1401", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADO. VIDRIO. 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1402", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "2" }, { "number": "1403", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" }, { "number": "1404", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS PARA HISTOQUINETTE DE VIDRIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1" } ] } ], "awards": [ { "id": "C-2023-00152122", "internal_reference": "INNN-DG-DA-SRM--408-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "BRI BIORESEARCH SA DE CV", "normalized_name": "BRI BIORESEARCH", "rfc_type": null, "slug": "bri-bioresearch" }, "contract_period": { "published_at": "2023-11-28T01:27:00.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "267500", "tax": "42800", "total": "310300", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-RATÓN 1ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4600", "subtotal": "9200", "tax": "1472", "other_taxes": null, "total": "10672" }, { "number": "0", "cucop_code": "25101-0037", "description": "IGG ANTI CONEJO FITC DE CABRA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2600", "subtotal": "2600", "tax": "416", "other_taxes": null, "total": "3016" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-HUMAN CD25 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-MOUSE CD279 (PD-1) ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3820", "subtotal": "3820", "tax": "611.2", "other_taxes": null, "total": "4431.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE/CYANINE7 ANTI-MOUSE CD274 (B7-H1, PD-L1) ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5660", "subtotal": "5660", "tax": "905.6", "other_taxes": null, "total": "6565.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERCP MOUSE IGG1, ¿ ISOTYPE CTRL ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2780", "subtotal": "2780", "tax": "444.8", "other_taxes": null, "total": "3224.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "100 BP DNA LADDER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "780", "subtotal": "780", "tax": "124.8", "other_taxes": null, "total": "904.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA LIBRE DE DNA Y RNA, PARA BIOLOGÍA MOLECULAR 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "440", "subtotal": "440", "tax": "70.4", "other_taxes": null, "total": "510.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "CHAMALEON VUE PRE-STAINED PROTEIN LADDER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3440", "subtotal": "3440", "tax": "550.4", "other_taxes": null, "total": "3990.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNA LADDER (1 KB) VIAL DE 500 µL P/BIOL. MOL. SOL 10 MM TRIS HCL (PH 8.0) 1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "780", "subtotal": "780", "tax": "124.8", "other_taxes": null, "total": "904.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA POWERTRACK SYBR GREEN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6560", "subtotal": "6560", "tax": "1049.6", "other_taxes": null, "total": "7609.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEÍNA A/G SEFAROSA PARA INMUNOPRECIPITAR 5ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12480", "subtotal": "12480", "tax": "1996.8", "other_taxes": null, "total": "14476.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "REVERTAID REVERSE TRANSCRIPTASE (200 U/UL)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7020", "subtotal": "7020", "tax": "1123.2", "other_taxes": null, "total": "8143.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "RNASA GRADO BIOLOGÍA MOLECULAR 50MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "320", "subtotal": "320", "tax": "51.2", "other_taxes": null, "total": "371.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELL LYSIS-M BUFFER.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2920", "subtotal": "2920", "tax": "467.2", "other_taxes": null, "total": "3387.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM F-12, CON GLUTAMAX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "800", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25101-0037", "description": "FGF8 RECOMBINANTE HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2740", "subtotal": "2740", "tax": "438.4", "other_taxes": null, "total": "3178.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "FGF-BÁSICO HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2740", "subtotal": "2740", "tax": "438.4", "other_taxes": null, "total": "3178.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE EAGLE MODIFICADO POR DUBELCO (DMEM), CON GLUTAMINA, GLUCOSA ALTA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "620", "subtotal": "620", "tax": "99.2", "other_taxes": null, "total": "719.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLI-L-LISINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1120", "subtotal": "2240", "tax": "358.4", "other_taxes": null, "total": "2598.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELISA KIT FOR AMYLOID BETA PEPTIDE 1-40 (AB1-40), UOM 96T*5,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11260", "subtotal": "11260", "tax": "1801.6", "other_taxes": null, "total": "13061.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALLTAQ MASTER MIX KIT (500)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3120", "subtotal": "3120", "tax": "499.2", "other_taxes": null, "total": "3619.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN IL-35(INTERLEUKIN 35) ELISA KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12300", "subtotal": "12300", "tax": "1968", "other_taxes": null, "total": "14268" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA DETECTAR KLOTHO EN RATON", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12600", "subtotal": "12600", "tax": "2016", "other_taxes": null, "total": "14616" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ELISA PARA DETECTAR KLOTHO HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12300", "subtotal": "12300", "tax": "1968", "other_taxes": null, "total": "14268" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT ELISA IL-1-¿ PARA RATA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8680", "subtotal": "8680", "tax": "1388.8", "other_taxes": null, "total": "10068.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT P/ELISA IL-10 P/RATA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8820", "subtotal": "8820", "tax": "1411.2", "other_taxes": null, "total": "10231.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT TNF-¿ DE RATA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9780", "subtotal": "9780", "tax": "1564.8", "other_taxes": null, "total": "11344.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAT IFN-GAMMA ELISA KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8800", "subtotal": "8800", "tax": "1408", "other_taxes": null, "total": "10208" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAT IL-4 ELISA KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9280", "subtotal": "9280", "tax": "1484.8", "other_taxes": null, "total": "10764.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "RAT IL6 ELISA KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8820", "subtotal": "8820", "tax": "1411.2", "other_taxes": null, "total": "10231.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 12 TUBOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25501-0090", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 32 TUBOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "580", "subtotal": "580", "tax": "92.8", "other_taxes": null, "total": "672.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA ENFRIADORA PARA TUBOS DE 0.2 CON CAPACIDAD PARA 96 TUBOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "580", "subtotal": "580", "tax": "92.8", "other_taxes": null, "total": "672.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "IMMUN-BLOT MEMBRANA DE PVDF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16260", "subtotal": "48780", "tax": "7804.8", "other_taxes": null, "total": "56584.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "RESERVORIOS DE POLIESTIRENO PARA PIPETA MULTICANAL. CAPACIDAD 100 MILILITROS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "840", "subtotal": "840", "tax": "134.4", "other_taxes": null, "total": "974.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAPA OPTICA EN TIRA DE 8 P/TIRAS DE TUBOS DE 0.2 ML PARA PCR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2420", "subtotal": "2420", "tax": "387.2", "other_taxes": null, "total": "2807.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAPÓN DE SELLO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1620", "subtotal": "1620", "tax": "259.2", "other_taxes": null, "total": "1879.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS PARA CITOMETRÌA DE FLUJO DE POLIESTIRENO, ESTÈRILES VOL.5ML 12X75MM CON TAPÒN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1580", "subtotal": "1580", "tax": "252.8", "other_taxes": null, "total": "1832.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE PCR DE 8 TIRAS CON TAPONES INDIVIDUALES ADJUNTOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1420", "subtotal": "1420", "tax": "227.2", "other_taxes": null, "total": "1647.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "HRP CONJUGATE SUBSTRATE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6640", "subtotal": "6640", "tax": "1062.4", "other_taxes": null, "total": "7702.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO QUIMIOLUMINISCENTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13280", "subtotal": "26560", "tax": "4249.6", "other_taxes": null, "total": "30809.6" } ] }, { "id": "C-2023-00151441", "internal_reference": "INNN-DG-DA-SRM-402-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "ABALAT SA DE CV", "normalized_name": "ABALAT", "rfc_type": null, "slug": "abalat" }, "contract_period": { "published_at": "2023-11-28T01:53:30.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "195034", "tax": "31205.44", "total": "226239.44", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "BV421 MOUSE ANTI-TCF1 50UG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8447", "subtotal": "8447", "tax": "1351.52", "other_taxes": null, "total": "9798.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "BV510 MOUSE ANTI LY108 50UG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11155", "subtotal": "11155", "tax": "1784.8", "other_taxes": null, "total": "12939.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOKINE & CHEMOKINE CONVENIENCE PROCARTAPLEX HUMAN INFLAMMATION PANEL (20PLEX).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "69634", "subtotal": "69634", "tax": "11141.44", "other_taxes": null, "total": "80775.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HAE III", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1756", "subtotal": "5268", "tax": "842.88", "other_taxes": null, "total": "6110.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN SSP I", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5054", "subtotal": "15162", "tax": "2425.92", "other_taxes": null, "total": "17587.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100-1000 PB EN ESCALERA DE 100 PB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1522", "subtotal": "10654", "tax": "1704.64", "other_taxes": null, "total": "12358.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUSTRATO QUIMIOLUMINISCENTE SUPERSIGNAL™ WEST PICO PLUS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5806", "subtotal": "5806", "tax": "928.96", "other_taxes": null, "total": "6734.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMANUNIV MMIX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11567", "subtotal": "23134", "tax": "3701.44", "other_taxes": null, "total": "26835.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "TGF-BETA 3 RECOMBINANTE HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5067", "subtotal": "5067", "tax": "810.72", "other_taxes": null, "total": "5877.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "APO-BRDU", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13758", "subtotal": "13758", "tax": "2201.28", "other_taxes": null, "total": "15959.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO RPMI 1640, EN POLVO. 10 X. CAJA CON 10 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1052", "subtotal": "1052", "tax": "168.32", "other_taxes": null, "total": "1220.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "VECTASHIELD MEDIO DE MONTAJE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4293", "subtotal": "4293", "tax": "686.88", "other_taxes": null, "total": "4979.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "IL-10 HUMAN ELISA KIT, HIGH SENSITIVITY 96 TEST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10802", "subtotal": "21604", "tax": "3456.64", "other_taxes": null, "total": "25060.64" } ] }, { "id": "C-2023-00153001", "internal_reference": "INNN-DG-DA-SRM-403-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "ABYNTECH SA DE CV", "normalized_name": "ABYNTECH", "rfc_type": null, "slug": "abyntech" }, "contract_period": { "published_at": "2023-11-27T21:54:16.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "7370188.55", "tax": "1179230.17", "total": "8549418.72", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0011", "description": "ACIDO 2-3 PIRINEDICARBOXIL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5220", "subtotal": "5220", "tax": "835.2", "other_taxes": null, "total": "6055.2" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO 2-TIOBARBITÚRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "47300", "subtotal": "47300", "tax": "7568", "other_taxes": null, "total": "54868" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÀCIDO CLOROACÈTICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "48360", "subtotal": "48360", "tax": "7737.6", "other_taxes": null, "total": "56097.6" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO DIHIDROFENILACÉTICO DOPAC PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "27660", "subtotal": "27660", "tax": "4425.6", "other_taxes": null, "total": "32085.6" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO KAINICO MONOHIDRATADO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "97500", "subtotal": "97500", "tax": "15600", "other_taxes": null, "total": "113100" }, { "number": "0", "cucop_code": "25101-0037", "description": "[KO VALIDATED] LAMIN A/C RABBIT MAB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "164400", "subtotal": "164400", "tax": "26304", "other_taxes": null, "total": "190704" }, { "number": "0", "cucop_code": "25101-0037", "description": "PE ANTI-MOUSE CD3 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12150", "subtotal": "12150", "tax": "1944", "other_taxes": null, "total": "14094" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERCP ANTI-HUMAN CD279 (PD-1)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "27760", "subtotal": "27760", "tax": "4441.6", "other_taxes": null, "total": "32201.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "RHODAMINE RED-X-AAFFINI PURE GOAT ANTI-RABBIT IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14750", "subtotal": "14750", "tax": "2360", "other_taxes": null, "total": "17110" }, { "number": "0", "cucop_code": "25101-0037", "description": "RHODAMINE RED-X-CONJUGATED AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15200", "subtotal": "15200", "tax": "2432", "other_taxes": null, "total": "17632" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUAL LUCIFERASE REPORTER ASSAY SYSTEM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "51904.2", "subtotal": "51904.2", "tax": "8304.67", "other_taxes": null, "total": "60208.87" }, { "number": "0", "cucop_code": "25101-0037", "description": "GDNF PROTEÍNA RECOMBINANTE HUMANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "99000", "subtotal": "99000", "tax": "15840", "other_taxes": null, "total": "114840" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEOXICOLATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13600", "subtotal": "27200", "tax": "4352", "other_taxes": null, "total": "31552" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASE IN SITU APOPTOSIS DETECTION KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "89150", "subtotal": "89150", "tax": "14264", "other_taxes": null, "total": "103414" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICINCHONINIC ACID KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13000", "subtotal": "26000", "tax": "4160", "other_taxes": null, "total": "30160" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA GLUCOSA FOSFATO ISOMERASA, 100 PRUEBAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8064", "subtotal": "16128", "tax": "2580.48", "other_taxes": null, "total": "18708.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PEROXIDASE MOUSE & RABBIT, READY TO USE 1000 TESTS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "47532", "subtotal": "95064", "tax": "15210.24", "other_taxes": null, "total": "110274.24" }, { "number": "0", "cucop_code": "25501-0090", "description": "BROWNIEE AQUAPORE ODS RP-18 NEWGUARD CARTRIDGE, 7 UM 15X3.2 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "20040", "subtotal": "40080", "tax": "6412.8", "other_taxes": null, "total": "46492.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "COLUMNA PARA CROMATOGRAFÍA ADSORBOSPHERE OPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "28000", "subtotal": "28000", "tax": "4480", "other_taxes": null, "total": "32480" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.45¿M DEL PORO. DIÁMETRO DE 47MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2404.8", "subtotal": "4809.6", "tax": "769.54", "other_taxes": null, "total": "5579.14" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANAS DE FILTRADO HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3768", "subtotal": "3768", "tax": "602.88", "other_taxes": null, "total": "4370.88" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL ALUMINIO GRUESO EN ROLLO JUMBO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1800", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25501-0089", "description": "PLACAS DE VIDRIO CORTAS DE 10.01X7.3 CM PARA PREPARAR GELES DE ELECTROFORESIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9200", "subtotal": "82800", "tax": "13248", "other_taxes": null, "total": "96048" }, { "number": "0", "cucop_code": "25501-0090", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3996", "subtotal": "23976", "tax": "3836.16", "other_taxes": null, "total": "27812.16" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO DE GRAFITO TRANSVERSO COMPATIBLES CON ESPECTRO DE ABSORCIÓN ATÓMICA PE AA600 CAJA CON 5", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "89600", "subtotal": "179200", "tax": "28672", "other_taxes": null, "total": "207872" }, { "number": "0", "cucop_code": "25501-0090", "description": "ZORBAX ECLIPSE XBD-C18", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "60640", "subtotal": "424480", "tax": "67916.8", "other_taxes": null, "total": "492396.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-ARAQUIDONOILGLICEROL(2AG) 2-ARACHIDONOYL GLYCEROL SIGMA870450 FRASCO DE 5 MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31840", "subtotal": "127360", "tax": "20377.6", "other_taxes": null, "total": "147737.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "3-NITROPROPANOIC ACID", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16080", "subtotal": "16080", "tax": "2572.8", "other_taxes": null, "total": "18652.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "4-HYDROXYNONENAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "27520", "subtotal": "27520", "tax": "4403.2", "other_taxes": null, "total": "31923.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBUMINA DE SUERO BOVINO (BSA) LIBRE DE IGGS Y LIOFILIZADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "544800", "subtotal": "544800", "tax": "87168", "other_taxes": null, "total": "631968" }, { "number": "0", "cucop_code": "25101-0037", "description": "CESIUM METHANESULFONATE, USED IN PATCH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7040", "subtotal": "14080", "tax": "2252.8", "other_taxes": null, "total": "16332.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "CITOCROMO C DE CORAZÓN BOVINO, FRASCO 50 MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10176", "subtotal": "10176", "tax": "1628.16", "other_taxes": null, "total": "11804.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "CP-55940", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45056", "subtotal": "45056", "tax": "7208.96", "other_taxes": null, "total": "52264.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ELCUBRAGISTAT  (SYNONYMS: ABX-1431)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "157760", "subtotal": "315520", "tax": "50483.2", "other_taxes": null, "total": "366003.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "EM PROTEÍN-A/ GOLD, 25 NM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "37880", "subtotal": "37880", "tax": "6060.8", "other_taxes": null, "total": "43940.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ERITROSINA B", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3120", "subtotal": "3120", "tax": "499.2", "other_taxes": null, "total": "3619.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "GELATINA DE PIEL DE CERDO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4480", "subtotal": "4480", "tax": "716.8", "other_taxes": null, "total": "5196.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCOSE 6-PHOSPHATE DEHYDROGENASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7412", "subtotal": "22236", "tax": "3557.76", "other_taxes": null, "total": "25793.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUINEA PIG LIVER ACETONE TISSUE (POLVO DE HÍGADO) FCO. 1 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "26000", "subtotal": "26000", "tax": "4160", "other_taxes": null, "total": "30160" }, { "number": "0", "cucop_code": "25101-0037", "description": "HISTIDINE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "21760", "subtotal": "21760", "tax": "3481.6", "other_taxes": null, "total": "25241.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "METHOXYPOLYETHYLENE GLYCOL AMINE (PEG AMINA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15488", "subtotal": "15488", "tax": "2478.08", "other_taxes": null, "total": "17966.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "N,N-DIMETHYL-4-NITROSOANILINE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3776", "subtotal": "3776", "tax": "604.16", "other_taxes": null, "total": "4380.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-ETIL-N'-(3- DIMETILAMINOPROPIL)CARBODIIMIDA HYDROCHLORIDE (EDAC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7004", "subtotal": "7004", "tax": "1120.64", "other_taxes": null, "total": "8124.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "PARAFORMALDEHÍDO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1843.2", "subtotal": "3686.4", "tax": "589.82", "other_taxes": null, "total": "4276.22" }, { "number": "0", "cucop_code": "25101-0037", "description": "PARAFORMALDEHÍDO GRANULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5529.6", "subtotal": "5529.6", "tax": "884.74", "other_taxes": null, "total": "6414.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHTALDIALDEHIDO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "38808", "subtotal": "38808", "tax": "6209.28", "other_taxes": null, "total": "45017.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLYETHYLENIMINE MN 2100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11232", "subtotal": "11232", "tax": "1797.12", "other_taxes": null, "total": "13029.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLY-L-LYSINE SOLUTION. (100 ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "22176", "subtotal": "22176", "tax": "3548.16", "other_taxes": null, "total": "25724.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8024", "subtotal": "8024", "tax": "1283.84", "other_taxes": null, "total": "9307.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "SPAUTIN-1. =98% (HPLC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9144", "subtotal": "9144", "tax": "1463.04", "other_taxes": null, "total": "10607.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "TETRAÓXIDO DE OSMIO, CRISTALINO PARA MICROSCOPÍA ELECTRONICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2800", "subtotal": "5600", "tax": "896", "other_taxes": null, "total": "6496" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRANSFERRINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "239200", "subtotal": "239200", "tax": "38272", "other_taxes": null, "total": "277472" }, { "number": "0", "cucop_code": "25101-0037", "description": "XANTINA OXIDASA =99.5% (HPLC), FRASCO 5 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6080", "subtotal": "6080", "tax": "972.8", "other_taxes": null, "total": "7052.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROQUINA DIFOSFATO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5100", "subtotal": "5100", "tax": "816", "other_taxes": null, "total": "5916" }, { "number": "0", "cucop_code": "25101-0037", "description": "ADENOSINE 5´ TRIPHOSPHATE MAGNESIUM SALT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3944", "subtotal": "3944", "tax": "631.04", "other_taxes": null, "total": "4575.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ARSENITO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7004", "subtotal": "7004", "tax": "1120.64", "other_taxes": null, "total": "8124.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "2',7'-DICHLOROFLUORESCEIN DIACETATE (DIACETATO DE DICLOROFLUORESCEÍNA), FRASCO 1 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "60800", "subtotal": "182400", "tax": "29184", "other_taxes": null, "total": "211584" }, { "number": "0", "cucop_code": "25101-0037", "description": "7-AAD VIABILITY STAINING SOLUCIÓN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "122400", "subtotal": "122400", "tax": "19584", "other_taxes": null, "total": "141984" }, { "number": "0", "cucop_code": "25101-0037", "description": "4-NITROPHENYL PHOSPHATE DISODIUM SALT HEXAHYDRATE 5 MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6980", "subtotal": "6980", "tax": "1116.8", "other_taxes": null, "total": "8096.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IGG (µ-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29614", "subtotal": "29614", "tax": "4738.24", "other_taxes": null, "total": "34352.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IGG (¿-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29614", "subtotal": "29614", "tax": "4738.24", "other_taxes": null, "total": "34352.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIMPIADOR DE PARAFINA DC EN SPRAY, NO TOXICO Y A BASE DE ACEITE MINERAL EN MEDIO ALCOHÓLICO (PANREAC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29321", "subtotal": "29321", "tax": "4691.36", "other_taxes": null, "total": "34012.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA CROMÓGENO DIAMINOBENCIDINA K3468 (DAB + CHROMOGEN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "74716", "subtotal": "224148", "tax": "35863.68", "other_taxes": null, "total": "260011.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA LSAB - HRP SISTEMA DE DETECCIÓN K0690 (LINK Y ESTREPTAVIDINA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "73114", "subtotal": "292456", "tax": "46792.96", "other_taxes": null, "total": "339248.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "SISTEMA PARA IDENTIFICACIÓN DE ENTEROBACTERIAS 20 E", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5609.5", "subtotal": "5609.5", "tax": "897.52", "other_taxes": null, "total": "6507.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DESCONTAMINANTE DE RNASAS DE SUPERFICIES, EN SPRAY (RNASEZAP)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3900", "subtotal": "3900", "tax": "624", "other_taxes": null, "total": "4524" }, { "number": "0", "cucop_code": "25501-0102", "description": "BANDA DE ESFUERZO RESPIRATORIO Z-RIP GRANDE 114-312 CMS, (SENSOR PARA RESPIRACIÓN ABDOMINAL) NECESARIO MUESTRA FISICA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "43257.85", "subtotal": "216289.25", "tax": "34606.28", "other_taxes": null, "total": "250895.53" }, { "number": "0", "cucop_code": "25501-0086", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES 2.5 LONGITUD. NECESARIO MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33614", "subtotal": "165864", "tax": "26538.24", "other_taxes": null, "total": "192402.24" }, { "number": "0", "cucop_code": "25501-0086", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES. 2.0 DE LONGITUD. NECESARIO MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "48924", "subtotal": "587088", "tax": "93934.08", "other_taxes": null, "total": "681022.08" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODO CON PARCHE ADHESIVO (TWO CHANNEL LARYNGEAL SUFARCE ELECTRO DE DRAGONFLY) LSE500DCS NECESARIO MUESTRA FISICIA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33614", "subtotal": "168070", "tax": "26891.2", "other_taxes": null, "total": "194961.2" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326A (AUDIFONOS DE INSERCIÓN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7381", "subtotal": "7381", "tax": "1180.96", "other_taxes": null, "total": "8561.96" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326B (AUDIFONOS DE INSERCIÓN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7381", "subtotal": "7381", "tax": "1180.96", "other_taxes": null, "total": "8561.96" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 A. (AUDIFONOS DE INSERCIÓN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3214", "subtotal": "25712", "tax": "4113.92", "other_taxes": null, "total": "29825.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 B. (AUDIFONOS DE INSERCIÓN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3214", "subtotal": "16070", "tax": "2571.2", "other_taxes": null, "total": "18641.2" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. ELECTRODOS CONDUCTORES ADHESIVOS PARA EGK KENDAL MEDI-TRACE 100. EQUIPO PROPIEDAD DEL INNN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "700", "subtotal": "12600", "tax": "2016", "other_taxes": null, "total": "14616" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. PARA ESTUDIOS PSG CON CONECTOR DE BROCHE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "700", "subtotal": "2800", "tax": "448", "other_taxes": null, "total": "3248" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS TIMPÁNICO PARA ELECTROCOCLEOGRAFÍA N° PARTE 8049550 PARA EQUIPO PARA EQUIPO ECLIPSE PROPIEDAD DEL INNN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "124800", "subtotal": "249600", "tax": "39936", "other_taxes": null, "total": "289536" }, { "number": "0", "cucop_code": "25501-0094", "description": "FLEXI WRAP TAPES DESECHABLES PARA SENSOR SPO2, CINTA PARA FIJACION DE OXIMETRO DE PULSO DESECHABLE TAMAÑO ADULTO. NECESARIO MUESTRA FISICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7560", "subtotal": "52920", "tax": "8467.2", "other_taxes": null, "total": "61387.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO GRANDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "189", "subtotal": "11340", "tax": "1814.4", "other_taxes": null, "total": "13154.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO MARCA MADSEN, MOD. ZODIAC 901 EQUIPO PROPIEDAD DEL INNN CAT. 8-69-29601", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11824", "subtotal": "11824", "tax": "1891.84", "other_taxes": null, "total": "13715.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "LAMINILLA CON REJILLAS PARA ORINA (GLASSTIC SLIDE 10 WITH GRIDS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "38921", "subtotal": "116763", "tax": "18682.08", "other_taxes": null, "total": "135445.08" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 2000 ML, VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "800", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "250", "subtotal": "250", "tax": "40", "other_taxes": null, "total": "290" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "290", "subtotal": "290", "tax": "46.4", "other_taxes": null, "total": "336.4" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETAS DE PLASTICO PARA TRANSFERENCIA DE UN SOLO PASO LIBRE DE DECANTACIÓN DESPUES DE CENTRIFUGACION PARA TUBO CONICO DE 12 ML PARA RETENER 1.0 ML DE ORINA MARCA KOVA REF. HY 87135", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29306", "subtotal": "87918", "tax": "14066.88", "other_taxes": null, "total": "101984.88" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM CON TEJIDO CONTROL POSITIVO PARA HONGOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "30920", "subtotal": "30920", "tax": "4947.2", "other_taxes": null, "total": "35867.2" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOQUERATINA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "58200", "subtotal": "58200", "tax": "9312", "other_taxes": null, "total": "67512" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE AMIGDALA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE APENDICE PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE GANGLIO PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE OVARIO PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PANCREAS PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PIEL PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PLACENTA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE TUMORES GERMINALES PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE UTERO PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ALFA FETOPROTEINA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ATRX PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA BHGC PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CEA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOMEGALOVIRUS PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29100", "subtotal": "29100", "tax": "4656", "other_taxes": null, "total": "33756" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA EMA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA HERPES VIRUS PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA IDH1 R132H PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA KI67 PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA OLIG 2 PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLACAS DE AMILODE PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31321", "subtotal": "31321", "tax": "5011.36", "other_taxes": null, "total": "36332.36" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLAP PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA SINAPTOFISINA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA TOXOPLASMA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIMENTINA PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "32300", "subtotal": "32300", "tax": "5168", "other_taxes": null, "total": "37468" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIRUS EPSTEIN BARR PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31800", "subtotal": "31800", "tax": "5088", "other_taxes": null, "total": "36888" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE CO2 A PRUEBA DE GOLPES Y AGUA PARA MONITOR DE TRASLADO PARA SIGNOS VITALES. MARCA NIHON KOHDEN MODELO VISMOCATALOGO PVM-4763K", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "28109", "subtotal": "28109", "tax": "4497.44", "other_taxes": null, "total": "32606.44" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE DEDO PARA SPO2. MONITOR CARE SCAPE. GE. NO. PARTE TS-SA-D", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "18994", "subtotal": "75976", "tax": "12156.16", "other_taxes": null, "total": "88132.16" }, { "number": "0", "cucop_code": "25501-0086", "description": "SET DE CABLES PINCH (8500410)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9800", "subtotal": "9800", "tax": "1568", "other_taxes": null, "total": "11368" }, { "number": "0", "cucop_code": "25501-0086", "description": "SET DE ELECTRODOS SUBDERMICOS DE DOS CANALES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL EQUIPO PROPIEDAD DEL INNN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13800", "subtotal": "248400", "tax": "39744", "other_taxes": null, "total": "288144" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAPA PARA TUBO CONICO PARA EGO MARCA KOVA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29306", "subtotal": "87918", "tax": "14066.88", "other_taxes": null, "total": "101984.88" }, { "number": "0", "cucop_code": "25501-0096", "description": "25501-0096 INFRARROJO SIN CONTACTO TIPO PISTOLA PARA USO HOSPITALARIO Y TOMAS CONTINUAS CON RANGO DE TEMPERATURA DE 32° A 42° C CON PRECISIÓN DE 0.3°C Y RESOLUCIÓN DE 0.1°C", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "850", "subtotal": "6800", "tax": "1088", "other_taxes": null, "total": "7888" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO CONICO PARA EGO DE 12 ML MARCA KOVA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29306", "subtotal": "87918", "tax": "14066.88", "other_taxes": null, "total": "101984.88" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS PARA HISTOQUINETTE DE VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "23600", "subtotal": "23600", "tax": "3776", "other_taxes": null, "total": "27376" } ] }, { "id": "C-2023-00151510", "internal_reference": "INNN-DG-DA-SRM-404-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "normalized_name": "APPLIED BIOSYSTEMS DE MEXICO", "rfc_type": null, "slug": "applied-biosystems-de-mexico" }, "contract_period": { "published_at": "2023-11-28T01:52:53.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "561194.8", "tax": "89791.17", "total": "650985.97", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HUMAN CD3 ACOPLADO A ALEXA FLUOR 488", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4399.04", "subtotal": "8798.08", "tax": "1407.69", "other_taxes": null, "total": "10205.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI GCLC RABBIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7402.4", "subtotal": "7402.4", "tax": "1184.38", "other_taxes": null, "total": "8586.78" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBODY ANTI GFAP", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2942.81", "subtotal": "2942.81", "tax": "470.85", "other_taxes": null, "total": "3413.66" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBODY ANTI HIF-1 ALPHA MOUSE MAB (D5F3M)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8753.6", "subtotal": "8753.6", "tax": "1400.58", "other_taxes": null, "total": "10154.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI 1L-1 BETA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6507.55", "subtotal": "6507.55", "tax": "1041.21", "other_taxes": null, "total": "7548.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI 1L-6", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6507.55", "subtotal": "6507.55", "tax": "1041.21", "other_taxes": null, "total": "7548.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI KLOTHO DE HUMANO Y RATON", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6340.69", "subtotal": "6340.69", "tax": "1014.51", "other_taxes": null, "total": "7355.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CABRA-PE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5657.12", "subtotal": "5657.12", "tax": "905.14", "other_taxes": null, "total": "6562.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-MOUSE IGG-TRITC.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4990.64", "subtotal": "4990.64", "tax": "798.5", "other_taxes": null, "total": "5789.14" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CALPAIN 3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6325.52", "subtotal": "6325.52", "tax": "1012.08", "other_taxes": null, "total": "7337.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO GROWTH HORMONE ANTIBODY (N1C3)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7417.7", "subtotal": "7417.7", "tax": "1186.83", "other_taxes": null, "total": "8604.53" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PROLACTIN ANTIBODY (N1C3)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7144.66", "subtotal": "7144.66", "tax": "1143.15", "other_taxes": null, "total": "8287.81" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO VS BAX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6507.55", "subtotal": "6507.55", "tax": "1041.21", "other_taxes": null, "total": "7548.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO VS CASPASA 9 (C9)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7235.66", "subtotal": "7235.66", "tax": "1157.71", "other_taxes": null, "total": "8393.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-NF-KB P65 ANTIBODY PRODUCED IN RABBIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8233.69", "subtotal": "8233.69", "tax": "1317.39", "other_taxes": null, "total": "9551.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC MOUSE ANTI-HUMAN CD25 CLONE 2A3 (RUO (GMP))", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5172.67", "subtotal": "5172.67", "tax": "827.63", "other_taxes": null, "total": "6000.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBODY CASPASE 8 - RABBIT PAB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6446.87", "subtotal": "6446.87", "tax": "1031.5", "other_taxes": null, "total": "7478.37" }, { "number": "0", "cucop_code": "25101-0037", "description": "CD11B POLYCLONAL ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6371.03", "subtotal": "6371.03", "tax": "1019.36", "other_taxes": null, "total": "7390.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "MONOCLONAL ANTI-S100B ANTIBODY PRODUCED IN MOUSE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7859.1", "subtotal": "7859.1", "tax": "1257.46", "other_taxes": null, "total": "9116.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHOSPHO-ULK1 (SER317) ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6355.86", "subtotal": "6355.86", "tax": "1016.94", "other_taxes": null, "total": "7372.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "RECOMBINANT ANTI-BDNF ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6386.2", "subtotal": "6386.2", "tax": "1021.79", "other_taxes": null, "total": "7407.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "TNFA - ANTICUERPO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6583.39", "subtotal": "6583.39", "tax": "1053.34", "other_taxes": null, "total": "7636.73" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN BAMHI HF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1406.84", "subtotal": "1406.84", "tax": "225.09", "other_taxes": null, "total": "1631.93" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN ECORV HF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1682.68", "subtotal": "1682.68", "tax": "269.23", "other_taxes": null, "total": "1951.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN RATON SONDA FAM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10001.47", "subtotal": "10001.47", "tax": "1600.24", "other_taxes": null, "total": "11601.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN SLC38A3 EN RATON SONDA FAM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10001.47", "subtotal": "10001.47", "tax": "1600.24", "other_taxes": null, "total": "11601.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN C_1202883_20 MTHFR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6264.26", "subtotal": "6264.26", "tax": "1002.28", "other_taxes": null, "total": "7266.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN C_850486_20 MTHFR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6264.26", "subtotal": "6264.26", "tax": "1002.28", "other_taxes": null, "total": "7266.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN HUMANO SONDA FAM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10001.47", "subtotal": "10001.47", "tax": "1600.24", "other_taxes": null, "total": "11601.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMAN PARA LA DETECCION DE RNAM DEL GEN SLC38A1 SONDA FAM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10001.47", "subtotal": "10001.47", "tax": "1600.24", "other_taxes": null, "total": "11601.71" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENSAYO TAQMA RNASAP, SONDA VIC DYE/QSY, LIMITADO POR CEBADORES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5600.14", "subtotal": "11200.28", "tax": "1792.04", "other_taxes": null, "total": "12992.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HHA I", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1655.02", "subtotal": "3310.04", "tax": "529.61", "other_taxes": null, "total": "3839.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN MBOII", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1264.22", "subtotal": "1264.22", "tax": "202.28", "other_taxes": null, "total": "1466.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESP3I (BSMBI) (10 U/µL)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6969.5", "subtotal": "6969.5", "tax": "1115.12", "other_taxes": null, "total": "8084.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "GENESCAN 500 LIZ SIZE STANDARD FOR SIZING DNA FRAGMENTS IN THE 35-500 NUCLEOTIDES RANGE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9107", "subtotal": "36428", "tax": "5828.48", "other_taxes": null, "total": "42256.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1245.83", "subtotal": "7474.98", "tax": "1196", "other_taxes": null, "total": "8670.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE PERLAS MAGNÉTICAS PARA AISLAMIENTO DE ADN Y ARN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5971.06", "subtotal": "11942.12", "tax": "1910.74", "other_taxes": null, "total": "13852.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "MASTER MIX PARA 100 REACCIONES DE PCR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2335.42", "subtotal": "2335.42", "tax": "373.67", "other_taxes": null, "total": "2709.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3748.55", "subtotal": "3748.55", "tax": "599.77", "other_taxes": null, "total": "4348.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUICK-GDNA MINIPREP, 200 PREPS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9320.12", "subtotal": "18640.24", "tax": "2982.44", "other_taxes": null, "total": "21622.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "RNA CLEAN & CONCENTRATOR-5 (DNASE NOT INCLUDED)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11994.54", "subtotal": "11994.54", "tax": "1919.13", "other_taxes": null, "total": "13913.67" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2A; 6FAM GGG CCC CTC ACC ATG TCG 3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; SCA17F; 5´-FAM-GCC AGC GCA CTC ACC CTC-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; TBP-F; 5´-5¨-FAM-GACCCCACAGCCTATTCAGA-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; MJD52; 5´-VIC-CCA GTC ACT ACT TTG ATT CG-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER; JPH3F; 5´- FAM-GGTTCCCTGCACAGAAACCATC - 3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; ATN1F; 5´-FAM-CCCAGTCCACCGCCCACCCACCA -3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; SCA10TPF; 5´-6-FAM-CAG ATG GCA GAA TGA TAA ACT CAA-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHF; 5´-56FAM ATGAAG GCC TTC GAG TCC CTC AAG TCC TTC-3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHR; 5´GGC GGT GGC GGC TGT TGC TGC TGC TGC TGC - 3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 46 MER; SCA10TPR1; 5´-TACGCATCCCAGTTTGAGACGAGAATAGAATAGAATAGAATAGAAT-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO DE 20 MER; SCA7F; 5'-PET-TAG GAG CGG AAA GAA TGT CG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-R; 5'-ACAGAATTCGCCCCGGCCTGGTACACTGCCA-3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381.82", "subtotal": "1381.82", "tax": "221.09", "other_taxes": null, "total": "1602.91" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQ POLIMERASA DE ARRANQUE EN CALIENTE 5U/¿L, 500U", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2004.42", "subtotal": "2004.42", "tax": "320.71", "other_taxes": null, "total": "2325.13" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQ POLIMERASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1615.68", "subtotal": "1615.68", "tax": "258.51", "other_taxes": null, "total": "1874.19" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN GENOTYPING MASTER MIX 10 ML. CAT. 4371355", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "17371.75", "subtotal": "34743.5", "tax": "5558.96", "other_taxes": null, "total": "40302.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAQMAN RNASE P INSTRUMENT VERIFICATION PLATE, FAST 48-WELL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8859.38", "subtotal": "8859.38", "tax": "1417.5", "other_taxes": null, "total": "10276.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM, POWDER, HIGH GLUCOSE, 10 X 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1098.72", "subtotal": "5493.6", "tax": "878.98", "other_taxes": null, "total": "6372.58" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO NEUROBASAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1710.19", "subtotal": "1710.19", "tax": "273.63", "other_taxes": null, "total": "1983.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO OPTIMEM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10261.17", "subtotal": "10261.17", "tax": "1641.79", "other_taxes": null, "total": "11902.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESSENTIAL 8 MEDIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5222.53", "subtotal": "20890.12", "tax": "3342.42", "other_taxes": null, "total": "24232.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "CELL PERMEANT.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15745.54", "subtotal": "15745.54", "tax": "2519.29", "other_taxes": null, "total": "18264.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIPOFECTAMIN 30000", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15115.91", "subtotal": "15115.91", "tax": "2418.55", "other_taxes": null, "total": "17534.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "MATRIZ DE LA MEMBRANA BASAL DE FACTOR DE CRECIMIENTO REDUCIDO LISTA PARA USAR Y CUALIFICADA PARA HESC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1815.9", "subtotal": "1815.9", "tax": "290.54", "other_taxes": null, "total": "2106.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "MATRIGEL GROWTH FACTOR REDUCED (GFR) BASEMENT MEMBRANE MATRIX, LDEV-FREE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1815.9", "subtotal": "1815.9", "tax": "290.54", "other_taxes": null, "total": "2106.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPLEMENTO B27", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2887.1", "subtotal": "2887.1", "tax": "461.94", "other_taxes": null, "total": "3349.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPLEMENTO B-27 (50X) SIN VITAMINA A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2850.33", "subtotal": "2850.33", "tax": "456.05", "other_taxes": null, "total": "3306.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPLEMENTO N2 (100X)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2022.81", "subtotal": "2022.81", "tax": "323.65", "other_taxes": null, "total": "2346.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPSINA-EDTA (0.25% TRIPSINA, EDTA•4NA) (1X),", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "323.98", "subtotal": "647.96", "tax": "103.67", "other_taxes": null, "total": "751.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRYPLE EXPRESS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1857.31", "subtotal": "1857.31", "tax": "297.17", "other_taxes": null, "total": "2154.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYCLE SEQUENCING KIT (100 REACTIONS) WITH BUFFER TUBE 5X SEQ", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "26450.02", "subtotal": "26450.02", "tax": "4232", "other_taxes": null, "total": "30682.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYCLE SEQUENCING KIT, 24 REACTIONS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7808.53", "subtotal": "7808.53", "tax": "1249.36", "other_taxes": null, "total": "9057.89" }, { "number": "0", "cucop_code": "25101-0037", "description": "CONJUNTO DE TAMPONES DE TINCIÓN DE FACTOR DE TRANSCRIPCIÓN/FOXP3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3318.9", "subtotal": "9956.7", "tax": "1593.07", "other_taxes": null, "total": "11549.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "DAB SUBSTRATE KIT PEROXIDASE (HRP) WITH NICKEL, (3,3-DIAMINOBENZIDINE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3733.01", "subtotal": "3733.01", "tax": "597.28", "other_taxes": null, "total": "4330.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "EPITECT BISULFITE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2442.54", "subtotal": "2442.54", "tax": "390.81", "other_taxes": null, "total": "2833.35" }, { "number": "0", "cucop_code": "25101-0037", "description": "INSULIN MOUSE ELISA KIT 96 TEST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10849.62", "subtotal": "10849.62", "tax": "1735.94", "other_taxes": null, "total": "12585.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE ENSAYO DE PROTEÍNAS BCA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2905.5", "subtotal": "2905.5", "tax": "464.88", "other_taxes": null, "total": "3370.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "MITOCHONDRIAL MEMBRANE POTENTIAL KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7525.95", "subtotal": "7525.95", "tax": "1204.15", "other_taxes": null, "total": "8730.1" }, { "number": "0", "cucop_code": "25101-0037", "description": "POTENCIADOR DE LA QUIMIOLUMINISCENCIA (ECL) PARA WESTERN BLOT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1411.34", "subtotal": "1411.34", "tax": "225.81", "other_taxes": null, "total": "1637.15" }, { "number": "0", "cucop_code": "25901-0012", "description": "KIT DE CONVERSION DE DNA CON BISULFITO DE SODIO PARA EVALUAR METILACION MEDIANTE PCR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2442.54", "subtotal": "7327.62", "tax": "1172.42", "other_taxes": null, "total": "8500.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE DNA DE TEJIDO EMBEBIDO EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3453.24", "subtotal": "3453.24", "tax": "552.52", "other_taxes": null, "total": "4005.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE RNA DE TEJIDO EMBEBIDO EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8183.19", "subtotal": "8183.19", "tax": "1309.31", "other_taxes": null, "total": "9492.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZOL PARA EXTRACCIÓN DE RNA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5356.73", "subtotal": "5356.73", "tax": "857.08", "other_taxes": null, "total": "6213.81" } ] }, { "id": "C-2023-00151525", "internal_reference": "INNN-DG-DA-SRM-405-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "BECTON DICKINSON DE MEXICO SA DE CV", "normalized_name": "BECTON DICKINSON DE MEXICO", "rfc_type": null, "slug": "becton-dickinson-de-mexico" }, "contract_period": { "published_at": "2023-11-28T01:52:23.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "94990", "tax": "15198.4", "total": "110188.4", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0048", "description": "TUBO AL VACIO CON ANTICOAGULANTE CITRATO (TAPÓN AZUL) 2.7 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ALTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "401", "subtotal": "53734", "tax": "8597.44", "other_taxes": null, "total": "62331.44" }, { "number": "0", "cucop_code": "25501-0048", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE, CON GEL SEPARADOR, CON ACTIVADOR DE LA COAGULACIÓN Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 5 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "382", "subtotal": "41256", "tax": "6600.96", "other_taxes": null, "total": "47856.96" } ] }, { "id": "C-2023-00152106", "internal_reference": "INNN-DG-DA-SRM-406-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "BOVINE & BIOLOGY SA DE CV", "normalized_name": "BOVINE Y BIOLOGY", "rfc_type": null, "slug": "bovine-y-biology" }, "contract_period": { "published_at": "2023-11-28T01:28:57.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "264076", "tax": "42252.16", "total": "306328.16", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7499", "subtotal": "254966", "tax": "40794.56", "other_taxes": null, "total": "295760.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUERO FETAL BOVINO, INACTIVADO CON CALOR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9110", "subtotal": "9110", "tax": "1457.6", "other_taxes": null, "total": "10567.6" } ] }, { "id": "C-2023-00152112", "internal_reference": "INNN-DG-DA-SRM-407-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "BRENDA PAOLA CUELLAR RIVERA", "normalized_name": "BRENDA PAOLA CUELLAR RIVERA", "rfc_type": null }, "contract_period": { "published_at": "2023-11-28T01:28:05.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "911938.62", "tax": "145910.2", "total": "1057848.82", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25301-1053", "description": "GENTAMICINA 80MG/ 2ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "428.4", "subtotal": "85680", "tax": "13708.8", "other_taxes": null, "total": "99388.8" }, { "number": "0", "cucop_code": "25301-1103", "description": "HEPARINA 1000 UI/ML CAJA CON 1 FRASCO ÁMPULA DE 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "210", "subtotal": "9240", "tax": "1478.4", "other_taxes": null, "total": "10718.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "ISODINE ESPUMA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "579.6", "subtotal": "579.6", "tax": "92.74", "other_taxes": null, "total": "672.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESCARLATA DE BIEBRICH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "629.85", "subtotal": "629.85", "tax": "100.78", "other_taxes": null, "total": "730.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETÍLICO 96% PORRON DE 20L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1022.4", "subtotal": "22492.8", "tax": "3598.85", "other_taxes": null, "total": "26091.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3913.2", "subtotal": "3913.2", "tax": "626.11", "other_taxes": null, "total": "4539.31" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 22G X 1 \" ( 0.7 MM X 25 MM ) COLOR NEGRO REF. 301747", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "738", "subtotal": "8856", "tax": "1416.96", "other_taxes": null, "total": "10272.96" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 15 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 29 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "297.99", "subtotal": "893.97", "tax": "143.04", "other_taxes": null, "total": "1037.01" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 20 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 36 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282.1", "subtotal": "846.3", "tax": "135.41", "other_taxes": null, "total": "981.71" }, { "number": "0", "cucop_code": "25501-0086", "description": "ESTIMULADORES MONOPOLARES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "22377.6", "subtotal": "402796.8", "tax": "64447.49", "other_taxes": null, "total": "467244.29" }, { "number": "0", "cucop_code": "25501-0090", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO INTERACUSTIC. MOD. AT 235, MED. 7, 8, 9.5, 11, 12.5, 14, 16 MM. CAT. BET25", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6650.1", "subtotal": "6650.1", "tax": "1064.02", "other_taxes": null, "total": "7714.12" }, { "number": "0", "cucop_code": "25501-0086", "description": "KIT DE ELECTRODOS AUTOADHERIBLES, CON ALOE VERA Y GEL, PARA PACIENTES CON PROBLEMA DE DEGLUCION, REG 59000, COMPATIBLE CON EQUIPO VITAL SLIM PROPIEDAD DEL INNN CAJA CON 12 SOBRES CON 2 PIEZAS DCADA SOBRE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7200", "subtotal": "108000", "tax": "17280", "other_taxes": null, "total": "125280" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE PRESIÓN/FLUJO RESPIRATORIO MAS RONQUIDO CON CONECTOR EN LLAVE PARA EQUIPO PSG PROPIEDAD DEL INNN. NECESARIO MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "26136", "subtotal": "261360", "tax": "41817.6", "other_taxes": null, "total": "303177.6" } ] }, { "id": "C-2023-00152143", "internal_reference": "INNN-DG-DA-SRM-409-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "CIENTIFICA SENNA SA DE CV", "normalized_name": "CIENTIFICA SENNA", "rfc_type": null, "slug": "cientifica-senna" }, "contract_period": { "published_at": "2023-11-27T21:58:04.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "829693.9", "tax": "132751.02", "total": "962444.92", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0011", "description": "ACIDO CLORHÍDRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "217", "subtotal": "217", "tax": "34.72", "other_taxes": null, "total": "251.72" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO FOSFOMOLIBDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10485", "subtotal": "10485", "tax": "1677.6", "other_taxes": null, "total": "12162.6" }, { "number": "0", "cucop_code": "25101-0011", "description": "HIDROXIDO DE AMONIO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "336", "subtotal": "336", "tax": "53.76", "other_taxes": null, "total": "389.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ADENOSINE 5'-TRIPHOSPHATE MAGNESIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "955", "subtotal": "1910", "tax": "305.6", "other_taxes": null, "total": "2215.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA LIBRE DE NUCLEASAS NO TRATADA CON DEPC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3120", "subtotal": "9360", "tax": "1497.6", "other_taxes": null, "total": "10857.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "BROMURO DE ETIDIO P/BIOL. MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1204", "subtotal": "1204", "tax": "192.64", "other_taxes": null, "total": "1396.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOLIN CICALTEU PARA DETERMINACION DE PROTEINAS. FCO. 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3655", "subtotal": "3655", "tax": "584.8", "other_taxes": null, "total": "4239.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZMA HYDROCHLORIDE PARA BIOLOGÍA MOLECULAR,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBUMINA SÉRICA BOVINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4997", "subtotal": "14991", "tax": "2398.56", "other_taxes": null, "total": "17389.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBIÓTICO-ANTIMICÓTICO (10.000 UNIDADES/ML DE PENICILINA, 10.000 µG/ML DE ESTREPTOMICINA Y 25 µG/ML DE ANFOTERICINA B )", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "700", "subtotal": "700", "tax": "112", "other_taxes": null, "total": "812" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBIÓTICO-ANTIMICÓTICO (100X) FRASCO CON 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "630", "subtotal": "15750", "tax": "2520", "other_taxes": null, "total": "18270" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1355", "subtotal": "2710", "tax": "433.6", "other_taxes": null, "total": "3143.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DMEM/F12", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1460", "subtotal": "5840", "tax": "934.4", "other_taxes": null, "total": "6774.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTATHIONE REDUCED.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3275", "subtotal": "9825", "tax": "1572", "other_taxes": null, "total": "11397" }, { "number": "0", "cucop_code": "25101-0037", "description": "LINEA CELULAR DE GLIOBLASTOMA M059J", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29500", "subtotal": "29500", "tax": "4720", "other_taxes": null, "total": "34220" }, { "number": "0", "cucop_code": "25101-0037", "description": "LÌNEA CELULAR RG2", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "37485", "subtotal": "37485", "tax": "5997.6", "other_taxes": null, "total": "43482.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "SV12 CRL-8621™ CELL LINE - FETAL GLIAL CELLS FROM HUMAN BRAIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "37481", "subtotal": "37481", "tax": "5996.96", "other_taxes": null, "total": "43477.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPSINA-EDTA (0.05%) ROJO FENOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "900", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25101-0037", "description": "DODECILSULFATO DE SODIO (SDS) PARA ELECTROFORESIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4200", "subtotal": "21000", "tax": "3360", "other_taxes": null, "total": "24360" }, { "number": "0", "cucop_code": "25101-0037", "description": "DETERGENTE ALCALINO HYCLIN PLUS ALCALINO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "371", "subtotal": "3710", "tax": "593.6", "other_taxes": null, "total": "4303.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRITÓN X-100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "730", "subtotal": "1460", "tax": "233.6", "other_taxes": null, "total": "1693.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 100% NON-IONIC DETERGENT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "387", "subtotal": "387", "tax": "61.92", "other_taxes": null, "total": "448.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "100 µL MICROLITER SYRINGE MODEL 710 N, CEMENTED NEEDLE, 22S GAUGE, 2 IN, POINT STYLE 3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1645", "subtotal": "3290", "tax": "526.4", "other_taxes": null, "total": "3816.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "100-WELL MICROTUBE STORAGE BOX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "775", "subtotal": "775", "tax": "124", "other_taxes": null, "total": "899" }, { "number": "0", "cucop_code": "25501-0090", "description": "50ML TUBO PARA CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE 25 POR PAQUETE CAJA CON 500 NEST CAT.602052 NEST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1600", "subtotal": "6400", "tax": "1024", "other_taxes": null, "total": "7424" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA DE ALMACENAMIENTO PARA 100 MICROTUBOS DE 2 ML DE BASE PLANA PARA CONGELACIÓN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "152", "subtotal": "2128", "tax": "340.48", "other_taxes": null, "total": "2468.48" }, { "number": "0", "cucop_code": "25501-0098", "description": "CAJA DE PAPEL FILTRO . TAMAÑO DEL PORO 125 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "275", "subtotal": "275", "tax": "44", "other_taxes": null, "total": "319" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS CON INSERTO DE 12 MULTIPOZOS, PORO 3.0 µM PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3150", "subtotal": "3150", "tax": "504", "other_taxes": null, "total": "3654" }, { "number": "0", "cucop_code": "25501-0089", "description": "CAJAS DE COPPLIN DE VIDRIO PARA TINCIÓNCAPACIDAD DE 500 ML CON CANASTILLA METÁLICA, CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3800", "subtotal": "7600", "tax": "1216", "other_taxes": null, "total": "8816" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE POLIESTIRENO DE 24 POZOS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1260", "subtotal": "1260", "tax": "201.6", "other_taxes": null, "total": "1461.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE POLIESTIRENO DE 96 POZOS TRATADAS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2620", "subtotal": "10480", "tax": "1676.8", "other_taxes": null, "total": "12156.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS ESTÉRILES PARA CULTIVO CELULAR DE 100 X15 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2087", "subtotal": "2087", "tax": "333.92", "other_taxes": null, "total": "2420.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "CINTA TESTIGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70", "subtotal": "1680", "tax": "268.8", "other_taxes": null, "total": "1948.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "COLADOR CELULAR 40UM AZUL ESTERIL EMPAQUE INDIVIDUAL CAJA(S) CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1220", "subtotal": "2440", "tax": "390.4", "other_taxes": null, "total": "2830.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRIOCAJAS DE ALMACENAMIENTO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "775", "subtotal": "2325", "tax": "372", "other_taxes": null, "total": "2697" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRIOTUBO ESTERIL. 2 ML \"SELF STANDING\" (CON BASE PARA COLOCAR VERTICALMENTE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "330", "subtotal": "990", "tax": "158.4", "other_taxes": null, "total": "1148.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRIOTUBOS DE POLIPROPILENO, LIBRES DEPIRÓGENOS, RNASAS Y DNASAS ESTÉRILES DE 1.7 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1900", "subtotal": "9500", "tax": "1520", "other_taxes": null, "total": "11020" }, { "number": "0", "cucop_code": "25501-0090", "description": "CUBREOBJETOS 24 X 24", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "35", "subtotal": "525", "tax": "84", "other_taxes": null, "total": "609" }, { "number": "0", "cucop_code": "25501-0090", "description": "ESTUCHE BARRAS MAGNETICAS PARA AGITACIÓN DE DIFERENTES TAMAÑOS (16 BARRAS EN TOTAL)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2750", "subtotal": "2750", "tax": "440", "other_taxes": null, "total": "3190" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA MICROPIPETA ESTÉRILES CAPACIDAD 5-200 UL)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "6325", "tax": "1012", "other_taxes": null, "total": "7337" }, { "number": "0", "cucop_code": "25501-0090", "description": "FRASCO CON 100 GRAMOS BOVINE SERUM ALBUMIN LYOPHILISED PH ~7. \tHEAT SHOCK FRACTION, PROTEASE FREE, FATTY ACID FREE, ESSENTIALLY GLOBULIN FREE =98% FRASCO CON 100 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5350", "subtotal": "5350", "tax": "856", "other_taxes": null, "total": "6206" }, { "number": "0", "cucop_code": "25501-0089", "description": "FRASCO. VIDRIO TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "950", "subtotal": "950", "tax": "152", "other_taxes": null, "total": "1102" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 2 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5373", "subtotal": "10746", "tax": "1719.36", "other_taxes": null, "total": "12465.36" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6373", "subtotal": "12746", "tax": "2039.36", "other_taxes": null, "total": "14785.36" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 15 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4662", "subtotal": "4662", "tax": "745.92", "other_taxes": null, "total": "5407.92" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 1ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4702", "subtotal": "4702", "tax": "752.32", "other_taxes": null, "total": "5454.32" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 7ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3690", "subtotal": "3690", "tax": "590.4", "other_taxes": null, "total": "4280.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "INSERTOS DE CULTIVO CELULAR DE POLICARBONATO CON TAMAÑO DE PORO DE 8 MICRAS EN PLACA DE 12 POCILLOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2650", "subtotal": "2650", "tax": "424", "other_taxes": null, "total": "3074" }, { "number": "0", "cucop_code": "25501-0090", "description": "JARRA CUADRADA DE TINCIÓN PARA PORTAOBJETOS FABRICADO EN POLIPROPILENO, SUJETA A 10 LAMINILLAS, CONSECUTIVAS. DISEÑADO EN FORMA CUADRADA Y CUERPO CORTO PARA AHORRAR ESPACIO Y SOLUCIÓN DE TINCIÓN. CUANDO SE QUITA LA TAPA, LOS PORTAOBJETOS SE PUEDEN MANIPULAR SIN TOCAR LA SOLUCIÓN. LA TAPA DE ROSCA TIENE UN REBAJE DE BLOQUEO PARA SOSTENER LAS CORREDERAS. EL CUERPO Y LA TAPA TIENEN UNA LENGÜETA MOLDEADA PARA PERMITIR QUE SE CONECTEN ENTRE SÍ PARA SU TRANSPORTE. LAS MEDIDAS DE LA JARRA: 83 MM (ALTO) X 33 MM (ANCHO) X 3 MM (ALTO)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "210", "subtotal": "420", "tax": "67.2", "other_taxes": null, "total": "487.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "JUEGO DE BARRAS MAGNETICAS (10 PZAS.)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2230", "subtotal": "2230", "tax": "356.8", "other_taxes": null, "total": "2586.8" }, { "number": "0", "cucop_code": "25501-0089", "description": "MATRAZ AFORADO. VIDRIO. 2 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "330", "subtotal": "1650", "tax": "264", "other_taxes": null, "total": "1914" }, { "number": "0", "cucop_code": "25501-0089", "description": "MATRAZ AFORADO. VIDRIO. 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "408", "subtotal": "1632", "tax": "261.12", "other_taxes": null, "total": "1893.12" }, { "number": "0", "cucop_code": "25501-0089", "description": "MICROJERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACION DE 1 MICROLITRO, PUNTA BISELADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1100", "subtotal": "2200", "tax": "352", "other_taxes": null, "total": "2552" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO GRADO 1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO GRADO 3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO PAPEL FILTRO 589/3 DE 12.5 CMS. CJ. C/100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1015", "subtotal": "3045", "tax": "487.2", "other_taxes": null, "total": "3532.2" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO PAPEL FILTRO NUM. 1 DE 12.5 CMS. CJ. C/100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "900", "tax": "144", "other_taxes": null, "total": "1044" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETA DESECHABLE ESTÉRIL 10ML SUBDIVISIÓN O.5ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "872", "subtotal": "2616", "tax": "418.56", "other_taxes": null, "total": "3034.56" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETA DESECHABLE ESTÉRIL 5ML SUBDIVISIÓN O.5ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "880", "subtotal": "1760", "tax": "281.6", "other_taxes": null, "total": "2041.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETA SEROLOGICA DE POLIESTIRENO 5MLX0.01ML ESTERILES, LIBRE\nPIROGÉNOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1990", "subtotal": "15920", "tax": "2547.2", "other_taxes": null, "total": "18467.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETAS DE PLÁSTICO CON BULBO INCLUIDO DE 1 ML ESTÉRILES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1220", "subtotal": "2440", "tax": "390.4", "other_taxes": null, "total": "2830.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, TRANSPARENTES. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1342", "subtotal": "6710", "tax": "1073.6", "other_taxes": null, "total": "7783.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS DE CULTIVO ESTÉRILES DE 6 POZOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2609", "subtotal": "2609", "tax": "417.44", "other_taxes": null, "total": "3026.44" }, { "number": "0", "cucop_code": "25501-0090", "description": "PORTAOBJETOS DE CULTIVO CELULAR CON CÁMARA DE 8 POZOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10700", "subtotal": "10700", "tax": "1712", "other_taxes": null, "total": "12412" }, { "number": "0", "cucop_code": "25501-0089", "description": "PROBETA DE VIDRIO. 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220", "subtotal": "880", "tax": "140.8", "other_taxes": null, "total": "1020.8" }, { "number": "0", "cucop_code": "25501-0089", "description": "PROBETA DE VIDRIO. GRADUADA. 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100", "subtotal": "600", "tax": "96", "other_taxes": null, "total": "696" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS ESTERILES PARA PIPETA AUTOMATICA DE 10 MICROLITROS CAJA C/96 10 RACKS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "442.55", "subtotal": "7965.9", "tax": "1274.54", "other_taxes": null, "total": "9240.44" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS AMARILLAS 200 UL. NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "163", "subtotal": "6357", "tax": "1017.12", "other_taxes": null, "total": "7374.12" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS DESECHABLES PARA PIPETAS AUTOMATICAS VOLUMEN VARIABLE 1000 A 5000 MICROLITROS BOLSA C/1000", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "890", "subtotal": "2670", "tax": "427.2", "other_taxes": null, "total": "3097.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "RASTRILLOS DE CULTIVO (CELLTREAT CELL SCRAPER) DE 25 CENTÍMETROS DE LARGO DEL MANGO; ESTÉRILES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1575", "subtotal": "3150", "tax": "504", "other_taxes": null, "total": "3654" }, { "number": "0", "cucop_code": "25501-0090", "description": "SISTEMA DE FILTRACIÓN DE 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "1150", "tax": "184", "other_taxes": null, "total": "1334" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 40 MICRÓMETROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1300", "subtotal": "1300", "tax": "208", "other_taxes": null, "total": "1508" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO FILTRADOR,500ML,45MM,.22UM,ACETAT. VASO DE POLIESTIRENO CON MEMBRANA DE ACETATO DE CELULOSA (PORO DE 0.22 ¿M) PARA FILTRACIO´N AL VACIO´CAPACIDAD DE 500 ML, , CONEXIO´N PARA MANGUERA DE TOMA DE VACI´O.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1750", "subtotal": "1750", "tax": "280", "other_taxes": null, "total": "2030" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO P/CENTRIFUGA 50ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2698", "subtotal": "21584", "tax": "3453.44", "other_taxes": null, "total": "25037.44" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE 1.5 ML ESTÉRILES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "201", "subtotal": "402", "tax": "64.32", "other_taxes": null, "total": "466.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "UNIDAD DE FILTRACIÓN 500 ML ESTÉRIL 0.22 MICRAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1727", "subtotal": "1727", "tax": "276.32", "other_taxes": null, "total": "2003.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "UNIDADES DE FILTRACIÒN FLUJO RAPIDO PES0.22MM, 45MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1394", "subtotal": "1394", "tax": "223.04", "other_taxes": null, "total": "1617.04" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO 20 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "56", "subtotal": "672", "tax": "107.52", "other_taxes": null, "total": "779.52" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASOS DE KOPLIN DE VIDRIO PARA 8 LAMINILLAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "650", "subtotal": "6500", "tax": "1040", "other_taxes": null, "total": "7540" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA DE POLIPROPILENO CON TAPA, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "157", "subtotal": "1570", "tax": "251.2", "other_taxes": null, "total": "1821.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA DE PLÁSTICO PARA 80 VIALES DE 1.5 Y 2.0 ML., MICROTUBOS, TUBOS DE 25*32 MM. PAQUETE CON 5 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "80", "subtotal": "480", "tax": "76.8", "other_taxes": null, "total": "556.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA DE PLASTICO PARA 80 TUBOS TIPO CON TAPÓN PLANO 1.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "80", "subtotal": "320", "tax": "51.2", "other_taxes": null, "total": "371.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "MATRAZ DEWARD DELABS04950", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9045", "subtotal": "9045", "tax": "1447.2", "other_taxes": null, "total": "10492.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINIBOMBA OSMÓTICA (0.25µL/H)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16906", "subtotal": "33812", "tax": "5409.92", "other_taxes": null, "total": "39221.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINIBOMBA OSMÓTICA (0.5µL/H)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14375", "subtotal": "28750", "tax": "4600", "other_taxes": null, "total": "33350" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBUMIN, BOVINE, FATTY ACID-FREE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5175", "subtotal": "5175", "tax": "828", "other_taxes": null, "total": "6003" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALBUMINA SÉRICA BOVINA FRACCIÓN V, GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4900", "subtotal": "9800", "tax": "1568", "other_taxes": null, "total": "11368" }, { "number": "0", "cucop_code": "25101-0037", "description": "SACAROSA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2400", "subtotal": "2400", "tax": "384", "other_taxes": null, "total": "2784" }, { "number": "0", "cucop_code": "25101-0037", "description": "SACAROSA GRADO ACS, 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1030", "subtotal": "5150", "tax": "824", "other_taxes": null, "total": "5974" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE SODIO ACS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "245", "subtotal": "1225", "tax": "196", "other_taxes": null, "total": "1421" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE SODIO CRISTALES GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "546", "subtotal": "1092", "tax": "174.72", "other_taxes": null, "total": "1266.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1435", "subtotal": "1435", "tax": "229.6", "other_taxes": null, "total": "1664.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO FÉRRICO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1442", "subtotal": "1442", "tax": "230.72", "other_taxes": null, "total": "1672.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "XYLENOL ORANGE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1368", "subtotal": "1368", "tax": "218.88", "other_taxes": null, "total": "1586.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETATO DE PLOMO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "686", "subtotal": "2744", "tax": "439.04", "other_taxes": null, "total": "3183.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS FRASCO 500 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1107", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL DE ANILINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15020", "subtotal": "15020", "tax": "2403.2", "other_taxes": null, "total": "17423.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL DE BROMOFENOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1390", "subtotal": "2780", "tax": "444.8", "other_taxes": null, "total": "3224.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL DE BROMOFENOL DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "405", "subtotal": "405", "tax": "64.8", "other_taxes": null, "total": "469.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL DE TIAZOLIL BROMURO DE TETRAZOLIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1450", "subtotal": "1450", "tax": "232", "other_taxes": null, "total": "1682" }, { "number": "0", "cucop_code": "25101-0037", "description": "CRYSTAL VIOLET", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282", "subtotal": "564", "tax": "90.24", "other_taxes": null, "total": "654.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "EOSINA AMARILLENTA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "952", "subtotal": "1904", "tax": "304.64", "other_taxes": null, "total": "2208.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEMATOXILINA DE HARRIS LISTA PARA USAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "902", "subtotal": "1804", "tax": "288.64", "other_taxes": null, "total": "2092.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-PROPANOL, GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1100", "subtotal": "1100", "tax": "176", "other_taxes": null, "total": "1276" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2780", "subtotal": "11120", "tax": "1779.2", "other_taxes": null, "total": "12899.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA CON PUREZA DE 99%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "900", "subtotal": "900", "tax": "144", "other_taxes": null, "total": "1044" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO GRADO HPLC , FRASCO 4 LT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1102", "subtotal": "11020", "tax": "1763.2", "other_taxes": null, "total": "12783.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROFORMO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1935", "subtotal": "3870", "tax": "619.2", "other_taxes": null, "total": "4489.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL GRADO BIOLOGÍA MOLECULAR 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "970", "subtotal": "1940", "tax": "310.4", "other_taxes": null, "total": "2250.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOPROPANOL GRADO HPLC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2540", "subtotal": "5080", "tax": "812.8", "other_taxes": null, "total": "5892.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "TETRAHIDROFURANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3990", "subtotal": "3990", "tax": "638.4", "other_taxes": null, "total": "4628.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "XILENO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "819", "subtotal": "3276", "tax": "524.16", "other_taxes": null, "total": "3800.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA EN ENVASE DE PLÁSTICO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "263", "subtotal": "4208", "tax": "673.28", "other_taxes": null, "total": "4881.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO CLORHÍDRICO REACTIVO ANALÍTICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "217", "subtotal": "217", "tax": "34.72", "other_taxes": null, "total": "251.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLORANTE DE WRIGTH (MERK)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "476", "subtotal": "476", "tax": "76.16", "other_taxes": null, "total": "552.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "CRIOVIAL DE POLIPROPILENO DE 2 ML BASE PLANA PARA CONGELACION, CON TAPAROSCA Y GRADUADO, ESTERILES Y LIBRES DE PIROGENOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2499", "subtotal": "2499", "tax": "399.84", "other_taxes": null, "total": "2898.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "FIB – TEM 10 X 5 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DEL CONTENIDO DE FIBRINOGENO Y POLIMERIZACIÓN DE FIBRINA MEDIANTE TROMBOELASTOMETRÍA. COMPONENTES: CITOCALASINA D, CACL2 Y CONSERVANTES)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEMATOXILINA DE HARRIS LIBRE DE OXIDO DE MERCURIO ROJO, LISTA PARA USARSE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "902", "subtotal": "2706", "tax": "432.96", "other_taxes": null, "total": "3138.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO REACTIVO ANALÍTICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "345", "subtotal": "345", "tax": "55.2", "other_taxes": null, "total": "400.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100 PB EN ESCALERA DE 100 PB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2177", "subtotal": "2177", "tax": "348.32", "other_taxes": null, "total": "2525.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 50 PB EN ESCALERA DE 50 PB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2775", "subtotal": "2775", "tax": "444", "other_taxes": null, "total": "3219" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL GRADO HPLC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE PLATA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15700", "subtotal": "15700", "tax": "2512", "other_taxes": null, "total": "18212" }, { "number": "0", "cucop_code": "25101-0037", "description": "ROJO NUCLEAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "28000", "subtotal": "28000", "tax": "4480", "other_taxes": null, "total": "32480" }, { "number": "0", "cucop_code": "25501-0090", "description": "BULBO DE SUCCION DE GOMA PARA PIPETA DE VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "120", "subtotal": "240", "tax": "38.4", "other_taxes": null, "total": "278.4" }, { "number": "0", "cucop_code": "25501-0101", "description": "CAJA DE PLASTICO PARA 25 LAMINILLAS COLOR NEGRO PARA PORTA OBJETOS DE MEDIDA ESTANDAR 75 X 25 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0089", "description": "DENSIMETRO CON PROBETA DE CRISTAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "90000", "tax": "14400", "other_taxes": null, "total": "104400" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA PARA TUBO DE WINTROBE CON NIVEL DE BURBUJA Y TORNILLOS PARA AJUSTE DE NIVEL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5790", "subtotal": "5790", "tax": "926.4", "other_taxes": null, "total": "6716.4" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO CON MANO GRANDE DEPORCELANA 400 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "255", "subtotal": "1530", "tax": "244.8", "other_taxes": null, "total": "1774.8" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO WHATMAN NO. 1 CIRCULAR DE 185 MM DE DIÁMETRO CAJA C/100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "620", "subtotal": "620", "tax": "99.2", "other_taxes": null, "total": "719.2" }, { "number": "0", "cucop_code": "25501-0026", "description": "PIPETAS AUTOMATICAS DE VOLUMEN VARIABLE DE 10 A 1000 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1040", "subtotal": "1040", "tax": "166.4", "other_taxes": null, "total": "1206.4" }, { "number": "0", "cucop_code": "25501-0026", "description": "PIPETAS AUTOMATICAS VOLUMEN VARIABLE 10 A 200 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1050", "subtotal": "1050", "tax": "168", "other_taxes": null, "total": "1218" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETAS PASTEUR DE PLASTICO DE 1.5 ML REF. 200003.C", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "525", "subtotal": "3150", "tax": "504", "other_taxes": null, "total": "3654" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETAS DE PLASTICO 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "230", "subtotal": "41400", "tax": "6624", "other_taxes": null, "total": "48024" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "163", "subtotal": "978", "tax": "156.48", "other_taxes": null, "total": "1134.48" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 10 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "155", "subtotal": "2325", "tax": "372", "other_taxes": null, "total": "2697" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 12 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "165", "subtotal": "9900", "tax": "1584", "other_taxes": null, "total": "11484" } ] }, { "id": "C-2023-00152145", "internal_reference": "INNN-DG-DA-SRM-410-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "COMERCIAL BIOMEDICO JR SA DE CV", "normalized_name": "COMERCIAL BIOMEDICO JR", "rfc_type": null, "slug": "comercial-biomedico-jr" }, "contract_period": { "published_at": "2023-11-27T21:56:11.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "101600.82", "tax": "16256.13", "total": "117856.95", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "PORTAOBJETOS CORTE DIAMANTADO DE TAMAÑO 25X75 MM Y 0.8-1.1 MM GROSOR, BORDES PULIDOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "35", "subtotal": "2450", "tax": "392", "other_taxes": null, "total": "2842" }, { "number": "0", "cucop_code": "25501-0090", "description": "PORTAOBJETOS DE 1 A 1.2MM DE ESPESOR CON BORDES ESMERILADOS Y BANDA MATE PARA ETIQUETAR. TAMAÑO 25X75MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "48", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25101-0037", "description": "LECHE DESCREMADA EN POLVO BASE PARA USO EN MEDIO DE CULTIVO MICROBIOLÓGICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1964.21", "subtotal": "11785.26", "tax": "1885.64", "other_taxes": null, "total": "13670.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "DILUYENTE PARA INMUNOHISTOQUIMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "1150", "tax": "184", "other_taxes": null, "total": "1334" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAR MAC CONKEY MEDIO DE CULTIVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1112.5", "subtotal": "2225", "tax": "356", "other_taxes": null, "total": "2581" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HORMONA DE CRECIMIENTO (GH) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8330", "subtotal": "8330", "tax": "1332.8", "other_taxes": null, "total": "9662.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-RECEPTOR DE ESTROGENOS PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15998", "subtotal": "15998", "tax": "2559.68", "other_taxes": null, "total": "18557.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD34 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13592", "subtotal": "13592", "tax": "2174.72", "other_taxes": null, "total": "15766.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO VIMENTINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10495.28", "subtotal": "20990.56", "tax": "3358.49", "other_taxes": null, "total": "24349.05" }, { "number": "0", "cucop_code": "25501-0106", "description": "CUCHILLAS DESECHABLES DE BAJO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 8 X 0.25 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2500", "subtotal": "17500", "tax": "2800", "other_taxes": null, "total": "20300" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS ELECTROCARGADOS DE 75MM X 25MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "38", "subtotal": "380", "tax": "60.8", "other_taxes": null, "total": "440.8" } ] }, { "id": "C-2023-00153011", "internal_reference": "INNN-DG-DA-SRM-411-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "normalized_name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS", "rfc_type": null, "slug": "comercializadora-e-importadora-de-productos-quimicos" }, "contract_period": { "published_at": "2023-11-27T21:53:28.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "809208", "tax": "129473.28", "total": "938681.28", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ALEXA FLUOR 647 ANTI-HUMAN CD41", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8899", "subtotal": "8899", "tax": "1423.84", "other_taxes": null, "total": "10322.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI RATÓN F4/80 PE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3885", "subtotal": "3885", "tax": "621.6", "other_taxes": null, "total": "4506.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUEPO ANTI-NEUN (FOXO3)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10411", "subtotal": "10411", "tax": "1665.76", "other_taxes": null, "total": "12076.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-HIF-2 ALFA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8436", "subtotal": "8436", "tax": "1349.76", "other_taxes": null, "total": "9785.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL ANTI-RABBIT IGG, PRODUCIDO EN RATÓN.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2738", "subtotal": "2738", "tax": "438.08", "other_taxes": null, "total": "3176.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PROHIBITIN 2 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11944", "subtotal": "11944", "tax": "1911.04", "other_taxes": null, "total": "13855.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PURIFICADO ANTI-TUBULIN ¿3 (TUBB3)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4381", "subtotal": "4381", "tax": "700.96", "other_taxes": null, "total": "5081.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-GAPDH ANTIBODY, MOUSE MONOCLONAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5017", "subtotal": "5017", "tax": "802.72", "other_taxes": null, "total": "5819.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-HUMAN IGG PRODUCED IN GOAT .", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6190", "subtotal": "6190", "tax": "990.4", "other_taxes": null, "total": "7180.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-KATI (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11173", "subtotal": "11173", "tax": "1787.68", "other_taxes": null, "total": "12960.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-KMO (HUMAN, MOUSE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15570", "subtotal": "15570", "tax": "2491.2", "other_taxes": null, "total": "18061.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-KYAT3 (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13905", "subtotal": "13905", "tax": "2224.8", "other_taxes": null, "total": "16129.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-NR4A2 (N-TERMINAL) ANTIBODY PRODUCED IN RABBIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14450", "subtotal": "28900", "tax": "4624", "other_taxes": null, "total": "33524" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-NRF2 ANTIBODY PRODUCED IN RABBIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11173", "subtotal": "11173", "tax": "1787.68", "other_taxes": null, "total": "12960.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-RABBIT IGG, HRP-LINKED ANTIBODY, 100 UL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4155", "subtotal": "4155", "tax": "664.8", "other_taxes": null, "total": "4819.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC/CYANINE7 ANTI-HUMAN CD4 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3472", "subtotal": "3472", "tax": "555.52", "other_taxes": null, "total": "4027.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC/CYANINE7 ANTI-MOUSE CD3 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2893", "subtotal": "2893", "tax": "462.88", "other_taxes": null, "total": "3355.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BETA TUBULIN 3/ TUJ1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13638", "subtotal": "13638", "tax": "2182.08", "other_taxes": null, "total": "15820.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI HUMAN CD63 BRILLIANT VIOLET 711", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12288", "subtotal": "12288", "tax": "1966.08", "other_taxes": null, "total": "14254.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "BV605 ANTI-MOUSE CD185 125UL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6227", "subtotal": "6227", "tax": "996.32", "other_taxes": null, "total": "7223.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "CDKN1B/P27KIP1 RABBIT PAB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4285", "subtotal": "4285", "tax": "685.6", "other_taxes": null, "total": "4970.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "CX3CR1 ANTIBODY (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4798", "subtotal": "4798", "tax": "767.68", "other_taxes": null, "total": "5565.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "GCLM RABBIT PAB (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8815", "subtotal": "8815", "tax": "1410.4", "other_taxes": null, "total": "10225.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "HORSE ANTI-MOUSE IGG ANTIBODY (H+L), PEROXIDASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6172", "subtotal": "6172", "tax": "987.52", "other_taxes": null, "total": "7159.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "KMO ANTIBODY N-TERMINAL REGION (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11678", "subtotal": "11678", "tax": "1868.48", "other_taxes": null, "total": "13546.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO LAMP2 (D5C2P) RABBIT MAB", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10669", "subtotal": "10669", "tax": "1707.04", "other_taxes": null, "total": "12376.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN NEUROINFLAMMATION PANEL 1 (13-PLEX)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "48516", "subtotal": "97032", "tax": "15525.12", "other_taxes": null, "total": "112557.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUANOSINE 5'-TRIPHOSPHATE SODIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "19860", "subtotal": "39720", "tax": "6355.2", "other_taxes": null, "total": "46075.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "SONIC HEDGEHOG RECOMBINANTE HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10133", "subtotal": "10133", "tax": "1621.28", "other_taxes": null, "total": "11754.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "DMEM/F-12, POWDER, HIGH GLUCOSE, 10 X 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2570", "subtotal": "12850", "tax": "2056", "other_taxes": null, "total": "14906" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO KNOCKOUT(TM) D-MEM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1583", "subtotal": "1583", "tax": "253.28", "other_taxes": null, "total": "1836.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUO-4 PENTAPOTASSIUM SALT, CELL IMPERMEANT (500 ¿G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7221", "subtotal": "7221", "tax": "1155.36", "other_taxes": null, "total": "8376.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "HISTOPAQUE-1077", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5550", "subtotal": "5550", "tax": "888", "other_taxes": null, "total": "6438" }, { "number": "0", "cucop_code": "25101-0037", "description": "LINEA CELULAR DE GLIOBLASTOMA U87- MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "21984", "subtotal": "21984", "tax": "3517.44", "other_taxes": null, "total": "25501.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "DYEEX 2.0 SPIN (250)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "29103", "subtotal": "29103", "tax": "4656.48", "other_taxes": null, "total": "33759.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "EPIQUIK TISSUE CHROMATIN IMMUNOPRECIPITATION (CHIP) KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13377", "subtotal": "13377", "tax": "2140.32", "other_taxes": null, "total": "15517.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "HISTONE DEACETYLASE (HDAC) ANTIBODY SAMPLER KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16624", "subtotal": "16624", "tax": "2659.84", "other_taxes": null, "total": "19283.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "HUMAN TH1/TH2/TH17 CYTOKINE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33716", "subtotal": "67432", "tax": "10789.12", "other_taxes": null, "total": "78221.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "IN SITU CELL DEATH DETECTION KIT, FLUORESCEIN.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16662", "subtotal": "33324", "tax": "5331.84", "other_taxes": null, "total": "38655.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "OPTI-4CN SUBSTRATE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7065", "subtotal": "14130", "tax": "2260.8", "other_taxes": null, "total": "16390.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUINOLINIC ACID ELISA KIT:96 WELLS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "20872", "subtotal": "62616", "tax": "10018.56", "other_taxes": null, "total": "72634.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "SENESCENCE ¿-GALACTOSIDASE STAINING KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8763", "subtotal": "8763", "tax": "1402.08", "other_taxes": null, "total": "10165.08" }, { "number": "0", "cucop_code": "25501-0090", "description": "MP TETRA 4GEL/STAIN-FREE FASTC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33393", "subtotal": "33393", "tax": "5342.88", "other_taxes": null, "total": "38735.88" }, { "number": "0", "cucop_code": "25501-0090", "description": "STREPTAVIDIN MAGNETIC BEADS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31761", "subtotal": "31761", "tax": "5081.76", "other_taxes": null, "total": "36842.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "N,N-DIISOPROPYLETHYLAMINE (DIPEA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2805", "subtotal": "5610", "tax": "897.6", "other_taxes": null, "total": "6507.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "5-HYDROXYTRYPTAMINE CLORHIDRATO(SEROTONINA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3261", "subtotal": "3261", "tax": "521.76", "other_taxes": null, "total": "3782.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGE MODIFIED BSA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9894", "subtotal": "9894", "tax": "1583.04", "other_taxes": null, "total": "11477.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "AM251 (CB1 CANNABINOID RECEPTOR ANTAGONIST)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4741", "subtotal": "4741", "tax": "758.56", "other_taxes": null, "total": "5499.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ARACHIDONYL-2'-CHLOROETHYLAMIDE HYDRATE (ACEA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5819", "subtotal": "5819", "tax": "931.04", "other_taxes": null, "total": "6750.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOCYTIN 98% (TLC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3152", "subtotal": "3152", "tax": "504.32", "other_taxes": null, "total": "3656.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "BLOTTING-GRADE BLOCKER. 300 G, NONFAT DRY MILK FOR WESTERN BLOTTING APPLICATIONS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2082", "subtotal": "4164", "tax": "666.24", "other_taxes": null, "total": "4830.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "CACODILATO DE SODIO, TRIHIDRATADO,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "28627", "subtotal": "28627", "tax": "4580.32", "other_taxes": null, "total": "33207.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "CHIR 99021", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5632", "subtotal": "5632", "tax": "901.12", "other_taxes": null, "total": "6533.12" } ] }, { "id": "C-2023-00152124", "internal_reference": "INNN-DG-DA-SRM-412-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "COMPAÑIA VILAB SA DE CV", "normalized_name": "COMPANIA VILAB", "rfc_type": null, "slug": "compania-vilab" }, "contract_period": { "published_at": "2023-11-28T01:26:21.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "723116", "tax": "115698.56", "total": "838814.56", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "TIRAS DE 8 TUBOS DE .2 ML PARA PCR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "850", "subtotal": "850", "tax": "136", "other_taxes": null, "total": "986" }, { "number": "0", "cucop_code": "25501-0090", "description": "ACRÍLICO DENTAL AUTOCURABLE NO. 66 C", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "250", "subtotal": "1250", "tax": "200", "other_taxes": null, "total": "1450" }, { "number": "0", "cucop_code": "25501-0090", "description": "MONÓMERO PARA ACRÍLICO DENTAL AUTOCURABLE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "540", "subtotal": "2700", "tax": "432", "other_taxes": null, "total": "3132" }, { "number": "0", "cucop_code": "25501-0090", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 100 ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25501-0090", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 250 ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "120", "subtotal": "360", "tax": "57.6", "other_taxes": null, "total": "417.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "10 µL, MODEL 701 CEMENTED NEEDLE SPECIAL (SN) SYRINGE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3200", "subtotal": "3200", "tax": "512", "other_taxes": null, "total": "3712" }, { "number": "0", "cucop_code": "25501-0090", "description": "ANILLOS PARA INCLUSIÓN DE TEJIDOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0090", "description": "APLICADORES DE MADERA, 6\"X 1/12\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "215", "subtotal": "215", "tax": "34.4", "other_taxes": null, "total": "249.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "APLICADORES DE PLÁSTICO 15 CM CON ALGODÓN; PAQUETES CON 3 PIEZAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "380", "subtotal": "1520", "tax": "243.2", "other_taxes": null, "total": "1763.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "BENZAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "120", "subtotal": "120", "tax": "19.2", "other_taxes": null, "total": "139.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA DE POLIPROPILENO, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "160", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA PETRI DESECHABLE, PARA CULTIVO CELULAR DE POLIESTIRENO, ESTÉRIL; TAMAÑO DE 35X10 MILÍMETROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5800", "subtotal": "5800", "tax": "928", "other_taxes": null, "total": "6728" }, { "number": "0", "cucop_code": "25501-0090", "description": "CANULA DE POLIETILENO (PE10), DIÁMETRO INTERNO 0.28MM , DIÁMETRO EXTERNO .61MM. ROLLO DE 100 PIES (FT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12000", "subtotal": "24000", "tax": "3840", "other_taxes": null, "total": "27840" }, { "number": "0", "cucop_code": "25501-0090", "description": "CILINDRO DE METAL PARA GUARDAR Y ESTERILIZAR PIPETA PASTEUR, DE 20 CM LARGO X 20 CM DE DIÁMETRO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "800", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRONOMETRO 3 CANALES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "650", "subtotal": "650", "tax": "104", "other_taxes": null, "total": "754" }, { "number": "0", "cucop_code": "25501-0089", "description": "CUBREOBJETOS DE VIDRIO CIRCULAR 12MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1500", "subtotal": "9000", "tax": "1440", "other_taxes": null, "total": "10440" }, { "number": "0", "cucop_code": "25501-0090", "description": "CUVETTES DE CUARZO PARA ESPECTROFOTÓMETRO, 45MM ALTURA, 3.5ML DE CAPACIDAD.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1600", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS DE NYLON PIRINOLA, 0.22 UM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "4800", "tax": "768", "other_taxes": null, "total": "5568" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTROS DE NYLON PIRINOLA, 0.45 UM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2600", "subtotal": "5200", "tax": "832", "other_taxes": null, "total": "6032" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA PARA 96 MICROTUBOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25501-0090", "description": "HOJA DE BISTURÍ NUM. 15", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0090", "description": "HOJA DE BISTURÍ NUM. 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400", "subtotal": "2800", "tax": "448", "other_taxes": null, "total": "3248" }, { "number": "0", "cucop_code": "25501-0090", "description": "LÁPIZ PUNTA DIAMANTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "1500", "tax": "240", "other_taxes": null, "total": "1740" }, { "number": "0", "cucop_code": "25501-0090", "description": "MARCADOR PARA PORTAOBJETOS, \"PAP-PEN\", NORMAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1800", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25501-0089", "description": "MATRAZ AFORADO. VIDRIO. 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "580", "subtotal": "1740", "tax": "278.4", "other_taxes": null, "total": "2018.4" }, { "number": "0", "cucop_code": "25501-0089", "description": "MATRAZ AFORADO. VIDRIO. 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0089", "description": "MATRAZ VOLUMÉTRICO “A”. VIDRIO. TAPÓN. 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25501-0090", "description": "MECHERO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "250", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA DE DIÁLISIS SPECTRA/POR 3. MWCO 3.5 KDA DE 34 MILÍMETROS DE DIÁMETRO, 54 MILÍMETROS DE ANCHO Y 50 PIES DE LARGO DAIGGER X6026 ROLLO DE 50 PIES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10800", "subtotal": "10800", "tax": "1728", "other_taxes": null, "total": "12528" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROPIPETA DIGITAL DE 12 CANALES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8200", "subtotal": "8200", "tax": "1312", "other_taxes": null, "total": "9512" }, { "number": "0", "cucop_code": "25501-0090", "description": "NAVAJA PARA BISTURI NO.20 ACERO INOXIDABLE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0090", "description": "NAVAJAS DE AFEITAR DOBLE FILO, C/", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "50", "subtotal": "250", "tax": "40", "other_taxes": null, "total": "290" }, { "number": "0", "cucop_code": "25501-0090", "description": "NAVAJAS DE UN SOLO FILO. CAJA C/100 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "450", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL ALUMINIO, ROLLO DE 30.5 CM X 304.8 M", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "950", "subtotal": "4750", "tax": "760", "other_taxes": null, "total": "5510" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL PARAFILM 10 CM X 7.6 M (4PULGADAS X 125 PIES)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "780", "subtotal": "7020", "tax": "1123.2", "other_taxes": null, "total": "8143.2" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL PH DE 0.0 A 14.0 CJ. C/100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "600", "tax": "96", "other_taxes": null, "total": "696" }, { "number": "0", "cucop_code": "25501-0090", "description": "PELÍCULA ADHESIVA ÓPTICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "12000", "tax": "1920", "other_taxes": null, "total": "13920" }, { "number": "0", "cucop_code": "25501-0090", "description": "PINZA C/PUNTA FINA Y ASERRADA, DE ACER, INOX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25501-0090", "description": "PINZA EMS DE 110MM CON PUNTA DOBLADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0089", "description": "PROBETA DE VIDRIO. GRADUADA. 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "190", "subtotal": "1140", "tax": "182.4", "other_taxes": null, "total": "1322.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS DE 200 µL EN RACK.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "850", "subtotal": "850", "tax": "136", "other_taxes": null, "total": "986" }, { "number": "0", "cucop_code": "25501-0090", "description": "RACK DE POLIPROPILENO CON CAPACIDAD PARA 96 TUBO EPENDORF DE 1.5- 2.0 ML, DE UNA CARA Y DE LA PARTE INFERIOR PARA 96 TUBO DE .5 A 1.0 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0090", "description": "REJILLAS DE COBRE 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "900", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25501-0090", "description": "REJILLAS DE NIQUEL 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0090", "description": "ROLLO DE MANGUERA TUBO HOLY LATEX2040. DIAMETRO INTERIOR 6.2MM, EXTERIOR 10.6 MM, ESPESOR 2.2MM. 15 M", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "750", "subtotal": "750", "tax": "120", "other_taxes": null, "total": "870" }, { "number": "0", "cucop_code": "25501-0090", "description": "SPECTROFOTOMETER QUARTZ CELLS 3.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2600", "subtotal": "2600", "tax": "416", "other_taxes": null, "total": "3016" }, { "number": "0", "cucop_code": "25501-0090", "description": "TELA QUIRÚRGICA ADHESIVA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "78", "subtotal": "624", "tax": "99.84", "other_taxes": null, "total": "723.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO TIPO EPPENDORF CON TAPA COLOR AMBAR. BOLSA C/1000 PZAS. 1.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1200", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS (TIPO EPENDORF) AMBAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1500", "subtotal": "7500", "tax": "1200", "other_taxes": null, "total": "8700" }, { "number": "0", "cucop_code": "25501-0090", "description": "VASO DE PRECIPITADO DE POLIPROPILENO DE 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "50", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "540", "tax": "86.4", "other_taxes": null, "total": "626.4" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "60", "subtotal": "600", "tax": "96", "other_taxes": null, "total": "696" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADODE VIDRIO TEMPLADO DE 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "495", "tax": "79.2", "other_taxes": null, "total": "574.2" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO TEMPLADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "25", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO TEMPLADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "98", "subtotal": "588", "tax": "94.08", "other_taxes": null, "total": "682.08" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 1000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "150", "subtotal": "1350", "tax": "216", "other_taxes": null, "total": "1566" }, { "number": "0", "cucop_code": "25501-0089", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 2000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE PCR CON TAPÓN PLANO 1.5 ML TRANSPARENTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "650", "subtotal": "650", "tax": "104", "other_taxes": null, "total": "754" }, { "number": "0", "cucop_code": "25501-0090", "description": "CONTADOR DE CÉLULAS SANGUÍNEAS DE 5 LLAVES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6900", "subtotal": "6900", "tax": "1104", "other_taxes": null, "total": "8004" }, { "number": "0", "cucop_code": "25501-0090", "description": "CRONÓMETRO DE 3 CANALES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "600", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25501-0090", "description": "EMBUDO DE POLIPROPILENO DE 10 CM DIÁMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "225", "tax": "36", "other_taxes": null, "total": "261" }, { "number": "0", "cucop_code": "25501-0090", "description": "EMBUDO DE POLIPROPILENO DE 15 CM DIÁMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "90", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA MICROPIPETA DE 0.5 µL A 20 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "180", "subtotal": "360", "tax": "57.6", "other_taxes": null, "total": "417.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "TEMPORIZADOR DIGITAL CUENTA TRIPLE DE ABAJO/ARRIBA, PANTALLA LCD GRANDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIAL DE VIDRIO CON TAPA DE ROSCA PARA CENTELLEO DE 20 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE TRANSPARENTE. SECADO RAPIDO. POLVO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1800", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO. FCO. 100 GRS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "200", "tax": "32", "other_taxes": null, "total": "232" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. POLVO. FCO. 100 GRS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "650", "subtotal": "650", "tax": "104", "other_taxes": null, "total": "754" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE INCLUSIÓN PARA TEJIDO EN FRESCO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "380", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "RESINA LR WHITE GRADO MEDIO, PARA MICROSCOPIA ELECTRONICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10000", "subtotal": "10000", "tax": "1600", "other_taxes": null, "total": "11600" }, { "number": "0", "cucop_code": "25101-0037", "description": "TISSUE TECK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "380", "subtotal": "1520", "tax": "243.2", "other_taxes": null, "total": "1763.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "PAP PEN TED PELLA FOR IMMUNOSTAINING 2MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1800", "subtotal": "1800", "tax": "288", "other_taxes": null, "total": "2088" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLVENTE PARA ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-ACTH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1600", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR PAP PEN (PLUMA) PARA INMUNOHISTOQUÍMICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1800", "subtotal": "5400", "tax": "864", "other_taxes": null, "total": "6264" }, { "number": "0", "cucop_code": "25501-0089", "description": "AGITADORES DE VIDRIO 6.4MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "43", "subtotal": "129", "tax": "20.64", "other_taxes": null, "total": "149.64" }, { "number": "0", "cucop_code": "25501-0091", "description": "APLICADORES DE MADERA CON PUNTA DE ALGODÓN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "30000", "tax": "4800", "other_taxes": null, "total": "34800" }, { "number": "0", "cucop_code": "25501-0090", "description": "BASES PLASTICAS PARA LAS AGUJAS DE TOMA DE MUESTRA SANGUINEA AL VACIO (DE LA MISMA MARCA DE LAS AGUJAS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "50", "subtotal": "450", "tax": "72", "other_taxes": null, "total": "522" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 18 CM X 20 CM TIPO ZIPLOC CAJA C/25 BOLSAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "160", "subtotal": "4800", "tax": "768", "other_taxes": null, "total": "5568" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 27 CM X 28 CM TIPO ZIPLOC CAJA CON 25 BOLSAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220", "subtotal": "3300", "tax": "528", "other_taxes": null, "total": "3828" }, { "number": "0", "cucop_code": "25501-0031", "description": "BOLSAS DE PIPETAS DE TRANSFERENCIA DE 2 ML C/100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "180", "subtotal": "720", "tax": "115.2", "other_taxes": null, "total": "835.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "BULBOS PARA PIPETA PASTEUR PARA 2 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10", "subtotal": "150", "tax": "24", "other_taxes": null, "total": "174" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJA DE PETRI DESECHABLE ESTÉRIL DE 90 X 150 MM (MUESTRA FÍSICA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1500", "subtotal": "7500", "tax": "1200", "other_taxes": null, "total": "8700" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 100µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70", "subtotal": "210", "tax": "33.6", "other_taxes": null, "total": "243.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 1000µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "90", "subtotal": "450", "tax": "72", "other_taxes": null, "total": "522" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS PARA ALMACENAR MICROTUBOS Y CRIOTUBOS (CRIOVIALES) DE 2ML DE BASE PLANA PARA CONGELACIÓN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "150", "subtotal": "450", "tax": "72", "other_taxes": null, "total": "522" }, { "number": "0", "cucop_code": "25501-0092", "description": "CHAIRA DE 30 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "90", "subtotal": "90", "tax": "14.4", "other_taxes": null, "total": "104.4" }, { "number": "0", "cucop_code": "25501-0109", "description": "CUBRE HEMACIÍMETRO/CUBRE OBJETOS 22 X 22 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "28", "subtotal": "140", "tax": "22.4", "other_taxes": null, "total": "162.4" }, { "number": "0", "cucop_code": "25501-0106", "description": "CUCHILLAS DESECHABLES DE ALTO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 14 X 0.35 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4100", "subtotal": "28700", "tax": "4592", "other_taxes": null, "total": "33292" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS (ELECTRODO PARA NEUROESTIMILADOR DE 5CM X 5CM, CUADRADO, MODELO CF5050 COMPATIBLE CON EQUIPO VALU TRODE PROPIEDAD DEL INNN PAQUETE CON 4 PIEZAS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "4050", "tax": "648", "other_taxes": null, "total": "4698" }, { "number": "0", "cucop_code": "25501-0097", "description": "ESCOBILLON DE DE 60 CM DE LARGO CON CERDAS DE 18 CM X 5 CM DIÁMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "90", "subtotal": "90", "tax": "14.4", "other_taxes": null, "total": "104.4" }, { "number": "0", "cucop_code": "25501-0097", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 10 X 75 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "18", "subtotal": "18", "tax": "2.88", "other_taxes": null, "total": "20.88" }, { "number": "0", "cucop_code": "25501-0097", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 100 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "18", "subtotal": "18", "tax": "2.88", "other_taxes": null, "total": "20.88" }, { "number": "0", "cucop_code": "25501-0097", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 75 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "18", "subtotal": "18", "tax": "2.88", "other_taxes": null, "total": "20.88" }, { "number": "0", "cucop_code": "25501-0097", "description": "ESCOBILLONES PARA PROBETAS DE 2000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "66", "subtotal": "66", "tax": "10.56", "other_taxes": null, "total": "76.56" }, { "number": "0", "cucop_code": "25501-0101", "description": "ESTUCHE DE CARTON PLEGABLE PARA 1 LAMINILLA DE 1 X 3 PULGADAS, DE 4 X 9.5 CM Y 0.5 CM DE GROSOR UNA VEZ CERRADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "22", "subtotal": "2200", "tax": "352", "other_taxes": null, "total": "2552" }, { "number": "0", "cucop_code": "25501-0082", "description": "FILTROS 2097 P100 PARA 3M RESPIRADOR 6200", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2500", "subtotal": "25000", "tax": "4000", "other_taxes": null, "total": "29000" }, { "number": "0", "cucop_code": "25501-0018", "description": "FRASCO DE PLASTICO CON TAPA DE ROSCA (PARA MUESTRAS DE ORINA), NO ESTERIL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3.5", "subtotal": "5250", "tax": "840", "other_taxes": null, "total": "6090" }, { "number": "0", "cucop_code": "25501-0018", "description": "FRASCOS DE VIDRIO ÁMBAR TIPO JARABE DE 100 ML CON TAPÓN DE ROSCA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "18", "subtotal": "450", "tax": "72", "other_taxes": null, "total": "522" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLA MULTI-TUBOS. UNA CARA PARA 32 MICROTUBOS 0.5 ML, OTRA PARA MICROTUBOS 1.5 ML, OTRA PARA 12 TUBOS CÓNICOS 15 ML Y UNA PARA 4 TUBOS CÓNICOS 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "200", "tax": "32", "other_taxes": null, "total": "232" }, { "number": "0", "cucop_code": "25501-0090", "description": "GRADILLAS DE PLASTICO DE 25 CM. DE LARGO X 10.5 CM. DE ANCHO X 5.5 CM. DE ALTO, PARA 90 TUBOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "160", "subtotal": "480", "tax": "76.8", "other_taxes": null, "total": "556.8" }, { "number": "0", "cucop_code": "25501-0033", "description": "GUANTES DE HULE LATEX ROJOS TALLA MEDIANA N°8", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25501-0104", "description": "LÁPICES CON PUNTA DIAMANTE PARA ROTULAR PORTAOBJETOS RETRACTILES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 1000 ML, VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "550", "subtotal": "550", "tax": "88", "other_taxes": null, "total": "638" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ERLENMEYER DE 2 LT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25501-0103", "description": "PAPEL PARAFILM 10.16 CM X 38 MTS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "750", "subtotal": "18750", "tax": "3000", "other_taxes": null, "total": "21750" }, { "number": "0", "cucop_code": "25501-0103", "description": "PAPEL SEDA PARA LIMPIAR OBJETIVOS DE MICROSCOPIO DE 4 X 6 PULGADAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70", "subtotal": "210", "tax": "33.6", "other_taxes": null, "total": "243.6" }, { "number": "0", "cucop_code": "25501-0082", "description": "PIEZA FACIAL DE MEDIA CARA 3M MODELO 6100/07024 PARA FILTRO 3M MOD. 07024 PROPIEDAD DEL INNN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "680", "subtotal": "6800", "tax": "1088", "other_taxes": null, "total": "7888" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZA BAYONETA CHICA PARA ORL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZA BAYONETA GRANDE PARA ORL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "280", "subtotal": "1400", "tax": "224", "other_taxes": null, "total": "1624" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZA CAIMÁN DE OIDO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "15000", "tax": "2400", "other_taxes": null, "total": "17400" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS CON PUNTA GRUESA CON SIERRA DE 15 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220", "subtotal": "440", "tax": "70.4", "other_taxes": null, "total": "510.4" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS CURVAS FINAS DE 15 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "800", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS CURVAS GRUESAS DE 15 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS DE DISECCION SIN DIENTES DE 20 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100", "subtotal": "200", "tax": "32", "other_taxes": null, "total": "232" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS DE PUNTA FINA CON SIERRA DE 15 CM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1000", "subtotal": "2000", "tax": "320", "other_taxes": null, "total": "2320" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS KELLY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "250", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETAS PASTEUR DE VIDRIO DE 145 MM DE LARGO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "250", "subtotal": "250", "tax": "40", "other_taxes": null, "total": "290" }, { "number": "0", "cucop_code": "25501-0068", "description": "PISETA DE PLÁSTICO DE 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "150", "subtotal": "750", "tax": "120", "other_taxes": null, "total": "870" }, { "number": "0", "cucop_code": "25501-0068", "description": "PISETA DE PLÁSTICO DE 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "140", "subtotal": "700", "tax": "112", "other_taxes": null, "total": "812" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS CON PANTALLA ESMERILADA DE 75 MM X 25 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "4500", "tax": "720", "other_taxes": null, "total": "5220" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS PARA MICROCOSPIA, 25 X 75 MM CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FISICA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "35", "subtotal": "525", "tax": "84", "other_taxes": null, "total": "609" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS PARA MICROSCOPIA DE 25 X 75 MM, BORDES LISOS SIN ESMERILADO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "30", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTAOBJETOS PARA MICROSCOPIA, 25 X 75 MM, CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FÍSICA) CAJA CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "2700", "tax": "432", "other_taxes": null, "total": "3132" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETA DE VIDRIO 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "700", "subtotal": "700", "tax": "112", "other_taxes": null, "total": "812" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETA DE VIDRIO 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "350", "subtotal": "350", "tax": "56", "other_taxes": null, "total": "406" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETAS DE PLASTICO 1000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "350", "subtotal": "105000", "tax": "16800", "other_taxes": null, "total": "121800" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETAS DE PLASTICO 2000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "650", "subtotal": "195000", "tax": "31200", "other_taxes": null, "total": "226200" }, { "number": "0", "cucop_code": "25501-0090", "description": "SOPORTE DE CARRUSEL GIRATORIO PARA PIPETAS AUTOMATICAS 6 PLAZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4100", "subtotal": "8200", "tax": "1312", "other_taxes": null, "total": "9512" }, { "number": "0", "cucop_code": "25501-0096", "description": "25501-0096 DE VARILLA PARA LABORATORIO CON RANGO DE TEMPERATURA DE -10°C A 150°C", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "175", "subtotal": "175", "tax": "28", "other_taxes": null, "total": "203" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO DE ENSAYO VIDRIO SIN LABIO FONDO EN U, 13 X 100 MM, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "230", "subtotal": "3450", "tax": "552", "other_taxes": null, "total": "4002" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO DE POLIESTIRENO DE 5 ML TRANSPARENTE DE (13 X 75 MM) CON TAPON BOLSA C/1000", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2200", "subtotal": "33000", "tax": "5280", "other_taxes": null, "total": "38280" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADO VIDRIO DE 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "48", "subtotal": "48", "tax": "7.68", "other_taxes": null, "total": "55.68" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADO VIDRIO DE 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "60", "subtotal": "240", "tax": "38.4", "other_taxes": null, "total": "278.4" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADO. VIDRIO. 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "150", "subtotal": "150", "tax": "24", "other_taxes": null, "total": "174" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "36", "subtotal": "72", "tax": "11.52", "other_taxes": null, "total": "83.52" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "110", "subtotal": "110", "tax": "17.6", "other_taxes": null, "total": "127.6" } ] }, { "id": "C-2023-00153036", "internal_reference": "INNN-DG-DA-SRM-413-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "normalized_name": "CONTROL TECNICO Y REPRESENTACIONES", "rfc_type": null, "slug": "control-tecnico-y-representaciones" }, "contract_period": { "published_at": "2023-11-27T22:26:05.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "722931", "tax": "115668.96", "total": "838599.96", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "AHR ANTIBODY [RPT1]", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7832", "subtotal": "7832", "tax": "1253.12", "other_taxes": null, "total": "9085.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI CUERPO ANTI-A2B5", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10711", "subtotal": "10711", "tax": "1713.76", "other_taxes": null, "total": "12424.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-ERK1 (PT202/PY204) + ERK2 (PT185/PY187) ANTIBODY [EP197Y] (AB76299)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12293", "subtotal": "12293", "tax": "1966.88", "other_taxes": null, "total": "14259.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTI-ERK1 + ERK2 ANTIBODY [EPR17526]", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16675", "subtotal": "16675", "tax": "2668", "other_taxes": null, "total": "19343" }, { "number": "0", "cucop_code": "25101-0037", "description": "APC/CYANINE7 MOUSE IGG2B, ¿ ISOTYPE CTRL ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8250", "subtotal": "8250", "tax": "1320", "other_taxes": null, "total": "9570" }, { "number": "0", "cucop_code": "25101-0037", "description": "LAMIN B1 RABBIT MAB - NUCLEAR LOADING CONTROL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16310", "subtotal": "16310", "tax": "2609.6", "other_taxes": null, "total": "18919.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "RHODAMINE (TRITC)–CONJUGATED GOAT ANTI-RABBIT IGG(H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6207", "subtotal": "6207", "tax": "993.12", "other_taxes": null, "total": "7200.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "SARS/SARS-COV-2 SPIKE PROTEIN S2 MONOCLONAL ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14728", "subtotal": "14728", "tax": "2356.48", "other_taxes": null, "total": "17084.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SARS-COV-2 SPIKE PROTEIN S1 MONOCLONAL ANTIBODY (HL6)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "22031", "subtotal": "22031", "tax": "3524.96", "other_taxes": null, "total": "25555.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TREM2 POLYCLONAL ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12537", "subtotal": "12537", "tax": "2005.92", "other_taxes": null, "total": "14542.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "VDAC1 RABBIT MAB - MITOCHONDRIAL LOADING CONTROL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13024", "subtotal": "13024", "tax": "2083.84", "other_taxes": null, "total": "15107.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ADN POLIMERASA PLATINUM TAQ", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2233", "subtotal": "2233", "tax": "357.28", "other_taxes": null, "total": "2590.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAROSA GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4400", "subtotal": "8800", "tax": "1408", "other_taxes": null, "total": "10208" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMPLITAQ GOLD 360 MASTER MIX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6266", "subtotal": "62660", "tax": "10025.6", "other_taxes": null, "total": "72685.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIS ACRILAMIDA GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1900", "subtotal": "11400", "tax": "1824", "other_taxes": null, "total": "13224" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNA CLEAN & CONCENTRATOR-5 (50 PREPS) W / ZYMO-SPIN IC COLUMNS (CAPPED)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "20700", "tax": "3312", "other_taxes": null, "total": "24012" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNASA I GRADO BIOLOGÍA MOLECULAR 50MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1316", "subtotal": "1316", "tax": "210.56", "other_taxes": null, "total": "1526.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNASE I (RNASE-FREE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1316", "subtotal": "1316", "tax": "210.56", "other_taxes": null, "total": "1526.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN ECORI HF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "200", "subtotal": "200", "tax": "32", "other_taxes": null, "total": "232" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HINFI", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "675", "subtotal": "2025", "tax": "324", "other_taxes": null, "total": "2349" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN MBO I", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "383", "subtotal": "1149", "tax": "183.84", "other_taxes": null, "total": "1332.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESCALERAS DE PROTEÍNAS PRETEÑIDAS 10 A 25 KDA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "2982", "tax": "477.12", "other_taxes": null, "total": "3459.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTÁNDAR DE PESO MOLECULAR DUAL PARA PROTEÍNAS DE 2 A 250,000 DALTONES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1575", "subtotal": "3150", "tax": "504", "other_taxes": null, "total": "3654" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXONUCLEASE I (E. COLI)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "541", "subtotal": "541", "tax": "86.56", "other_taxes": null, "total": "627.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "GEL LOADING SOLUTION TYPE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "291", "subtotal": "291", "tax": "46.56", "other_taxes": null, "total": "337.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "GEL RED NUCELIC ACID", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "783", "subtotal": "783", "tax": "125.28", "other_taxes": null, "total": "908.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "11-250 KDA PRESTAINED PROTEIN LADDER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "1491", "tax": "238.56", "other_taxes": null, "total": "1729.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA PROTEÍNAS DE 10-250KDA, 500µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "1491", "tax": "238.56", "other_taxes": null, "total": "1729.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR; 10-250KDA WIDE RANGE BLUE/RED TW O COLOR,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "2982", "tax": "477.12", "other_taxes": null, "total": "3459.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADORES DE PESO MOLECULAR DE PROTEÍNAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4991", "subtotal": "4991", "tax": "798.56", "other_taxes": null, "total": "5789.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MAXIMA SYBR GREEN/ROX QPCR MASTER MIX 2X. MASTER MIX 200 REACTIONS. CAT K0221", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2200", "subtotal": "2200", "tax": "352", "other_taxes": null, "total": "2552" }, { "number": "0", "cucop_code": "25101-0037", "description": "HRM MASTER MIX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5400", "subtotal": "10800", "tax": "1728", "other_taxes": null, "total": "12528" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEZCLA MAESTRA UNIVERSAL DE PCR TAQMAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9166", "subtotal": "36664", "tax": "5866.24", "other_taxes": null, "total": "42530.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "NEBUILDER HIFI DNA ASSEMBLY MASTER MIX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4750", "subtotal": "9500", "tax": "1520", "other_taxes": null, "total": "11020" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGO (DT)12-18 PARA SINTESÍS DE CDNA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "3450", "tax": "552", "other_taxes": null, "total": "4002" }, { "number": "0", "cucop_code": "25101-0037", "description": "PESO MOLECULAR (MEZCLA DE NUEVE PROTEÍNAS TEÑIDAS DE AZUL, NARANJA Y VERDE (DE 10 KDA A 250 KDA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "4473", "tax": "715.68", "other_taxes": null, "total": "5188.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "ADN POLIMERASA PLATINUM TAQ", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2233", "subtotal": "6699", "tax": "1071.84", "other_taxes": null, "total": "7770.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALL BLUE PRESTAINED PROTEIN STANDARDS, VALUE PACK.. 2.5 ML (5 X 500 µL), MIXTURE OF TEN BLUE-STAINED RECOMBINANT PROTEINS (10–250 KD), INCLUDING THREE REFERENCE BANDS (25, 50, 75 KD), 250 APPLICATIONS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "1491", "tax": "238.56", "other_taxes": null, "total": "1729.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PROTEÍNAS PRECISION PLUS PROTEIN DUAL COLOR STANDARDS, 500 UL, 50 APLICACIONES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1491", "subtotal": "1491", "tax": "238.56", "other_taxes": null, "total": "1729.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEINASE K EN POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "741", "subtotal": "741", "tax": "118.56", "other_taxes": null, "total": "859.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEINASE K SOLUTION", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "741", "subtotal": "741", "tax": "118.56", "other_taxes": null, "total": "859.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIGH-FIDELITY DNA POLYMERASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9366", "subtotal": "9366", "tax": "1498.56", "other_taxes": null, "total": "10864.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE ÁCIDOS NUCLÉICOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "990", "subtotal": "990", "tax": "158.4", "other_taxes": null, "total": "1148.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE ÁCIDOS NUCLÉLICOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "990", "subtotal": "990", "tax": "158.4", "other_taxes": null, "total": "1148.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2B; 5´-CGG GCT TGC GGA CAT TGG- 3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1346", "subtotal": "1346", "tax": "215.36", "other_taxes": null, "total": "1561.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; JPH3R; 5´- AGATGCCACCGCATTCGG -3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1267", "subtotal": "1267", "tax": "202.72", "other_taxes": null, "total": "1469.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 19 MER, ABC2677R1 ; 5’-GTT TGA CTC ACC TTC CCA G-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1282", "subtotal": "1282", "tax": "205.12", "other_taxes": null, "total": "1487.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC1236R; 5’-CCT GAC TCA CCA CAC CAA TG-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC2677F; 5’-TGC AGG CTA TAG GTT CCA GG-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435F ; 5’-TGT TTT CAG CTG CTT GAT GG-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435R; 5’-AAG GCA TGT ATG TTG GCC TC-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, CYP3A4*1BF; 5´-TCC AGG CAT AGG TAA AGA TC-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, SCA7R; 5´-ACT TCA GGA CTG GGC AGA GG-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; C677T-R; 5'-AGG ACG GTG CGG TGA GAG TG-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPF; 5´- GATGCTGGTTCTCTTTGTGG -3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPR; 5´- CCCACTATCAGGAAGATGAG -3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; SCA17R; 5´- TTG ACT GCT GAA CGG CTG CA-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1298", "subtotal": "1298", "tax": "207.68", "other_taxes": null, "total": "1505.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; TBP-R; 5´- GGGACGTTGACTGCTGAAC -3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1282", "subtotal": "1282", "tax": "205.12", "other_taxes": null, "total": "1487.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A4*1BR; 5´-AAT CTA TTA AAT CGC CTC TCA-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1313", "subtotal": "1313", "tax": "210.08", "other_taxes": null, "total": "1523.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3F; 5'-CAT CAG TTA GTA GAC AGA TGA-3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1313", "subtotal": "1313", "tax": "210.08", "other_taxes": null, "total": "1523.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22 MER, ABC1236F; 5’-TAT CCT GTC TCT GTG AAT TGC C-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1328", "subtotal": "1328", "tax": "212.48", "other_taxes": null, "total": "1540.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER ; MJD255; 5'-TGG CCT TTC ACA TGG ATG TGA A-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1328", "subtotal": "1328", "tax": "212.48", "other_taxes": null, "total": "1540.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; A1298T-R; 5'-CAC TTT GTG ACC ATT CCG GTT TG-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1344", "subtotal": "1344", "tax": "215.04", "other_taxes": null, "total": "1559.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; C677T-F: 5'-TGA AGG AGA AGG TGT CTG CGG GA-3’", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1344", "subtotal": "1344", "tax": "215.04", "other_taxes": null, "total": "1559.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; A1298T-F; 5'-CTT TGG GGA GCT GAA GGA CTAC TAC-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1375", "subtotal": "1375", "tax": "220", "other_taxes": null, "total": "1595" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; ATN1R; 5´- TGCTCCAGGAGGAGGGGGCCCAGA -3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1375", "subtotal": "1375", "tax": "220", "other_taxes": null, "total": "1595" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 25 MER; TPR2 (TAIL); 5´-AGA ATA GAA TAG AAT AGA ATA GAA T-3´", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1375", "subtotal": "1375", "tax": "220", "other_taxes": null, "total": "1595" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-F; 5’-TAA GCT TGG CAC GGC TGT CCA AGG A-3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1375", "subtotal": "1375", "tax": "220", "other_taxes": null, "total": "1595" }, { "number": "0", "cucop_code": "25101-0037", "description": "SÍNTESIS  DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3R; 5'-GGT CCA AAC AGG GAA GAA ATA-3'", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1313", "subtotal": "1313", "tax": "210.08", "other_taxes": null, "total": "1523.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "T4 POLYNUCLEOTIDE KINASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "675", "subtotal": "675", "tax": "108", "other_taxes": null, "total": "783" }, { "number": "0", "cucop_code": "25101-0037", "description": "T7 DNA LIGASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "541", "subtotal": "541", "tax": "86.56", "other_taxes": null, "total": "627.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3633", "subtotal": "7266", "tax": "1162.56", "other_taxes": null, "total": "8428.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "WESTERN BLOTTING LUMINOL REAGENT IS A NON-RADIOACTIVE, LIGHT-EMITTING SYSTEM FOR DETECTING PROTEINS ON A WESTERN BLOT MEMBRANE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2483", "subtotal": "2483", "tax": "397.28", "other_taxes": null, "total": "2880.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN XHOI", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1425", "subtotal": "1425", "tax": "228", "other_taxes": null, "total": "1653" }, { "number": "0", "cucop_code": "25101-0037", "description": "GEL DNA RECOVERY KIT (50 PREP)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "1150", "tax": "184", "other_taxes": null, "total": "1334" }, { "number": "0", "cucop_code": "25101-0037", "description": "CASPASE 3 COLORIMETRIC ACTIVITY ASSAY KIT,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15100", "subtotal": "15100", "tax": "2416", "other_taxes": null, "total": "17516" }, { "number": "0", "cucop_code": "25101-0037", "description": "CASPASE 9 COLORIMETRIC ACTIVITY ASSAY KIT,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15100", "subtotal": "15100", "tax": "2416", "other_taxes": null, "total": "17516" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBODY LABELING KITS 594 NM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14971", "subtotal": "14971", "tax": "2395.36", "other_taxes": null, "total": "17366.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE DNA DE SANGRE COLUMNAS DE MEMBRANA DE SILICA MAXI SPIN CAPACIDAD 10ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4983", "subtotal": "4983", "tax": "797.28", "other_taxes": null, "total": "5780.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2483", "subtotal": "12415", "tax": "1986.4", "other_taxes": null, "total": "14401.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA HEXOQUINASA, 100 PRUEBAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15702", "subtotal": "31404", "tax": "5024.64", "other_taxes": null, "total": "36428.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "FS DNA LIBRARY PREP KIT FOR ILLUMINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2883", "subtotal": "2883", "tax": "461.28", "other_taxes": null, "total": "3344.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT PARA PCR DE 200 PRUEBAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2066", "subtotal": "2066", "tax": "330.56", "other_taxes": null, "total": "2396.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPERMEZCLA DE IQ-SYBR GREEN PARA 50 REACCIONES DE RT-PCR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1100", "subtotal": "1100", "tax": "176", "other_taxes": null, "total": "1276" }, { "number": "0", "cucop_code": "25101-0037", "description": "TOTAL RNA PURIFICATION PLUS KIT (50). 50 PREPS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3816", "subtotal": "3816", "tax": "610.56", "other_taxes": null, "total": "4426.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNA SEQUENCING CLEAN-UP KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1150", "subtotal": "5750", "tax": "920", "other_taxes": null, "total": "6670" }, { "number": "0", "cucop_code": "25101-0037", "description": "PLASMID MIDIPREP KIT, 50 PREPS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6650", "subtotal": "13300", "tax": "2128", "other_taxes": null, "total": "15428" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS UNIVERSALES PARA MICROPIPETA DE 0.1 A 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "460", "subtotal": "4600", "tax": "736", "other_taxes": null, "total": "5336" }, { "number": "0", "cucop_code": "25501-0090", "description": "FRASCO/CULTIVO DE POLIESTIRENO DE 12.5 CM2; VENT. FILTRO EN LA TAPA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3027", "subtotal": "3027", "tax": "484.32", "other_taxes": null, "total": "3511.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTE AL CALOR, CON BOCA ANCHA. DE 100 MLILITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "531", "subtotal": "1593", "tax": "254.88", "other_taxes": null, "total": "1847.88" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. PIREX DE 250MILILITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1007", "subtotal": "2014", "tax": "322.24", "other_taxes": null, "total": "2336.24" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. DE 500 MLILITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1188", "subtotal": "2376", "tax": "380.16", "other_taxes": null, "total": "2756.16" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE POLIESTIRENO DE 48 POZOS TRATADAS ESTÉRILES, LIBRES DE\nPIROGÉNOS PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2437", "subtotal": "2437", "tax": "389.92", "other_taxes": null, "total": "2826.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACA DE CULTIVO CELULAR CON TAPA DE POLIESTIRENO, DE 96 POZOS, TRATADO CON TC, FONDO REDONDO \"U\", ESTERIL. EMPACADAS INDIVIDUALMENTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1353", "subtotal": "2706", "tax": "432.96", "other_taxes": null, "total": "3138.96" }, { "number": "0", "cucop_code": "25501-0090", "description": "CAJAS DE POLIESTIRENO DE 6 POZOS ESTÈRILES, LIBRES DE PIROGÈNOS PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1358", "subtotal": "1358", "tax": "217.28", "other_taxes": null, "total": "1575.28" }, { "number": "0", "cucop_code": "25501-0090", "description": "CUCHILLAS DESECHABLES DE ACERO INOXIDABLE ALTO PERFIL ULTRAFINAS;", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381", "subtotal": "19334", "tax": "3093.44", "other_taxes": null, "total": "22427.44" }, { "number": "0", "cucop_code": "25501-0090", "description": "BOTELLA DE POLIESTIRENO DE 25MM CON FILTRO, PARA CULTIVO CELULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1513", "subtotal": "3026", "tax": "484.16", "other_taxes": null, "total": "3510.16" }, { "number": "0", "cucop_code": "25501-0089", "description": "FRASCO. VIDRIO. TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/5 PZAS. 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "607", "subtotal": "607", "tax": "97.12", "other_taxes": null, "total": "704.12" }, { "number": "0", "cucop_code": "25501-0089", "description": "FRASCO. VIDRIO. AUTOCLAVEABLE. TIPO SCHOTT. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1075", "subtotal": "1075", "tax": "172", "other_taxes": null, "total": "1247" }, { "number": "0", "cucop_code": "25501-0089", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1910", "subtotal": "3820", "tax": "611.2", "other_taxes": null, "total": "4431.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "223", "subtotal": "1784", "tax": "285.44", "other_taxes": null, "total": "2069.44" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETAS SEROLOGICAS DE 25 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, GARANTIZA UNA PRECISIÓN DE DISPENSACIÓN DE +/-1 %, CAJA CON 100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "735", "subtotal": "7350", "tax": "1176", "other_taxes": null, "total": "8526" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETEADORES ELÉCTRICOS. CAPACIDAD 0.1 A 100 ML CONTROLADOR DE PIPETA ELÉCTRICA, RELLENO AUTOMÁTICO DE PIPETAS MOTORIZADAS, PIPETA ELÉCTRICA, 0,1-100 ML, VELOCIDAD AJUSTABLE CON FILTRO, 115V.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1408", "subtotal": "4224", "tax": "675.84", "other_taxes": null, "total": "4899.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "PISETA DE PLÁSTICO. 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "133", "subtotal": "665", "tax": "106.4", "other_taxes": null, "total": "771.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, NEGRAS DE FONDO TRANSPARENTE. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2872", "subtotal": "5744", "tax": "919.04", "other_taxes": null, "total": "6663.04" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS PARA CULTIVO CELULAR CON 96 POZOS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "676", "subtotal": "1352", "tax": "216.32", "other_taxes": null, "total": "1568.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA PIPETAS ESTERIL CON FILTRO 1000 UL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1031", "subtotal": "4124", "tax": "659.84", "other_taxes": null, "total": "4783.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 100 MICRÓMETROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1247", "subtotal": "1247", "tax": "199.52", "other_taxes": null, "total": "1446.52" }, { "number": "0", "cucop_code": "25501-0090", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 70 MICRÓMETROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1247", "subtotal": "1247", "tax": "199.52", "other_taxes": null, "total": "1446.52" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO DE MICROCENTRIFUGA DE FONDO\nCONICO, TRANSPARENTE, TAPA A PRESION,DE POLIPROPILENO, 1.5 ML, RCF 30000 XG. AUTOCLAVABLES A 121 ° C A 15 PSI. DURANTE 20\nMINUTOS, Y SE ALMACENA A -80 ° C.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "700", "subtotal": "35000", "tax": "5600", "other_taxes": null, "total": "40600" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE POLIPROPILENO DE 5ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "528", "subtotal": "528", "tax": "84.48", "other_taxes": null, "total": "612.48" }, { "number": "0", "cucop_code": "25501-0090", "description": "NAVAJAS PARA MICROTOMO DE ALTO PERFIL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1381", "subtotal": "5524", "tax": "883.84", "other_taxes": null, "total": "6407.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "PICETA DE POLIETILENO 1L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "133", "subtotal": "532", "tax": "85.12", "other_taxes": null, "total": "617.12" }, { "number": "0", "cucop_code": "25501-0090", "description": "PLACAS DE 96 POZOS BLANCAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1006", "subtotal": "1006", "tax": "160.96", "other_taxes": null, "total": "1166.96" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA MICROPIPETA DE 1 µL A 200 µL BLANCAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "197", "subtotal": "394", "tax": "63.04", "other_taxes": null, "total": "457.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "N,N,N',N'-TETRAMETHYLETHYLENEDIAMINE (TEMED)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "783", "subtotal": "783", "tax": "125.28", "other_taxes": null, "total": "908.28" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, ESTERIL Y DESECHABLE DE 22G X 1.5 \" ( 0.7 X 38 MM ) COLOR NEGRO REF. 360211", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "203", "subtotal": "609", "tax": "97.44", "other_taxes": null, "total": "706.44" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJAS PARA TOMA DE MUESTRAS SANGRE AL VACÍO 21 G X 38 MM (VERDE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "203", "subtotal": "24360", "tax": "3897.6", "other_taxes": null, "total": "28257.6" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA PASTEUR CORTA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "96", "subtotal": "864", "tax": "138.24", "other_taxes": null, "total": "1002.24" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA PASTEUR LARGA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "141", "subtotal": "2538", "tax": "406.08", "other_taxes": null, "total": "2944.08" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA PIPETAS AUTOMÁTICAS VOLUMEN 1 A 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3193", "subtotal": "6386", "tax": "1021.76", "other_taxes": null, "total": "7407.76" }, { "number": "0", "cucop_code": "25501-0048", "description": "TUBO AL VACIO CON ANTICOAGULANTE EDTA (TAPÓN LILA) 4 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ANTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "186", "subtotal": "22878", "tax": "3660.48", "other_taxes": null, "total": "26538.48" }, { "number": "0", "cucop_code": "25501-0048", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ROJO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "202", "subtotal": "15756", "tax": "2520.96", "other_taxes": null, "total": "18276.96" } ] }, { "id": "C-2023-00152105", "internal_reference": "INNN-DG-DA-SRM-414-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "normalized_name": "CORPORATIVO FARMACEUTICO GEPHAM", "rfc_type": null, "slug": "corporativo-farmaceutico-gepham" }, "contract_period": { "published_at": "2023-11-28T01:29:47.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "525175.2", "tax": "84028.02", "total": "609203.22", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA EMG, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG50.PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8481.2", "subtotal": "271398.4", "tax": "43423.74", "other_taxes": null, "total": "314822.14" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMF37. SE REQUIERE MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8481.2", "subtotal": "59368.4", "tax": "9498.94", "other_taxes": null, "total": "68867.34" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG37. SE REQUIERE MUESTRA FÍSICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8481.2", "subtotal": "59368.4", "tax": "9498.94", "other_taxes": null, "total": "68867.34" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS DE ANILLO PARA NEUROCONDUCCIÓN SENSITIVA DESECHABLE. NECESARIO MUESTRA FÍSICA (ELECTRODO DE TIERRA CON TERMINACION EN ARGOLLA DE ACERO INOXIDABLE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2192", "subtotal": "10960", "tax": "1753.6", "other_taxes": null, "total": "12713.6" }, { "number": "0", "cucop_code": "25501-0086", "description": "ELECTRODOS DE TIERRA DESECHABLE PARA LA REALIZACIÓN DE ESTUDIOS NEUROFISIOLÓGICOS. NECESARIO MUESTRA FÍSICA UN PAR EN CADA PAQUETE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3288", "subtotal": "16440", "tax": "2630.4", "other_taxes": null, "total": "19070.4" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE RONQUIDO CON SEÑAL DE SALIDA NO MAYOR A 1000 MV PICO DIAMETRO MAYOR A 200 MV CON CONECTOR DIN DE 1.5 MM, (SENSOR PARA MEDICIÓN DE SUEÑO) NECESARIO MUESTRA FISICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10764", "subtotal": "107640", "tax": "17222.4", "other_taxes": null, "total": "124862.4" } ] }, { "id": "C-2023-00152102", "internal_reference": "INNN-DG-DA-SRM-415-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "DIAGNOCELL LABORATORIOS SA DE CV", "normalized_name": "DIAGNOCELL LABORATORIOS", "rfc_type": null, "slug": "diagnocell-laboratorios" }, "contract_period": { "published_at": "2023-11-28T01:30:49.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "302194.87", "tax": "48351.18", "total": "350546.05", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIO, BLOCK CON 100 HOJAS DE 10 X 15 CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "65.84", "subtotal": "131.68", "tax": "21.07", "other_taxes": null, "total": "152.75" }, { "number": "0", "cucop_code": "25501-0089", "description": "PROBETA DE VIDRIO. 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "118", "subtotal": "708", "tax": "113.28", "other_taxes": null, "total": "821.28" }, { "number": "0", "cucop_code": "25501-0089", "description": "PROBETA DE VIDRIO. GRADUADA. 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "135", "subtotal": "810", "tax": "129.6", "other_taxes": null, "total": "939.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "PICETA DE POLIETILENO 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "95", "subtotal": "380", "tax": "60.8", "other_taxes": null, "total": "440.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "PICETA DE POLIETILENO 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "110.66", "subtotal": "442.64", "tax": "70.82", "other_taxes": null, "total": "513.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "PARAFINA, PAQUETE DE 1 KG.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "409", "subtotal": "409", "tax": "65.44", "other_taxes": null, "total": "474.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDROXIDO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "183", "subtotal": "732", "tax": "117.12", "other_taxes": null, "total": "849.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE CALCIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "299", "subtotal": "299", "tax": "47.84", "other_taxes": null, "total": "346.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DIBÁSICO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "506", "subtotal": "1012", "tax": "161.92", "other_taxes": null, "total": "1173.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "EOSINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "580", "subtotal": "580", "tax": "92.8", "other_taxes": null, "total": "672.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ORANGE G (25 G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "183", "subtotal": "183", "tax": "29.28", "other_taxes": null, "total": "212.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-TSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "20631.74", "subtotal": "20631.74", "tax": "3301.08", "other_taxes": null, "total": "23932.82" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BETA CATENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "20901.64", "subtotal": "20901.64", "tax": "3344.26", "other_taxes": null, "total": "24245.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD20 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9086.36", "subtotal": "9086.36", "tax": "1453.82", "other_taxes": null, "total": "10540.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD30 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9266.29", "subtotal": "9266.29", "tax": "1482.61", "other_taxes": null, "total": "10748.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9086.36", "subtotal": "9086.36", "tax": "1453.82", "other_taxes": null, "total": "10540.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD68 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9086.36", "subtotal": "9086.36", "tax": "1453.82", "other_taxes": null, "total": "10540.18" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CK 5/6 COCKTAIL PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15893.64", "subtotal": "15893.64", "tax": "2542.98", "other_taxes": null, "total": "18436.62" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CK-LMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11455.42", "subtotal": "11455.42", "tax": "1832.87", "other_taxes": null, "total": "13288.29" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO EMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9266.29", "subtotal": "9266.29", "tax": "1482.61", "other_taxes": null, "total": "10748.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO FACTOR VIII PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8216.71", "subtotal": "8216.71", "tax": "1314.67", "other_taxes": null, "total": "9531.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO IDH1-R132H PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "40993.6", "subtotal": "81987.2", "tax": "13117.95", "other_taxes": null, "total": "95105.15" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO KI-67 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12475.01", "subtotal": "24950.02", "tax": "3992", "other_taxes": null, "total": "28942.02" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO OLIG2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "23180.72", "subtotal": "23180.72", "tax": "3708.92", "other_taxes": null, "total": "26889.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SINAPTOFISINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14934.02", "subtotal": "14934.02", "tax": "2389.44", "other_taxes": null, "total": "17323.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO TTF1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9266.29", "subtotal": "9266.29", "tax": "1482.61", "other_taxes": null, "total": "10748.9" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL DE CRESIL BRILLANTE AL 1%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3145.84", "subtotal": "3145.84", "tax": "503.33", "other_taxes": null, "total": "3649.17" }, { "number": "0", "cucop_code": "24101-0126", "description": "PARAFINA PARAPLAST, HISTOPLAST, MERCK O SAKURA, CON PUNTO DE FUSIÓN 56°-58°C, PRESENTACIÓN EN LENTEJAS PARA USO EN EQUIPO CENTRO DE INCLUSIÓN LEICA MODELO EG1160 PROPIEDAD DEL INNN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "409", "subtotal": "8180", "tax": "1308.8", "other_taxes": null, "total": "9488.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "XILOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2433.33", "subtotal": "7299.99", "tax": "1168", "other_taxes": null, "total": "8467.99" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "553.33", "subtotal": "553.33", "tax": "88.53", "other_taxes": null, "total": "641.86" }, { "number": "0", "cucop_code": "25501-0037", "description": "PROBETA DE VIDRIO 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "119.33", "subtotal": "119.33", "tax": "19.09", "other_taxes": null, "total": "138.42" } ] }, { "id": "C-2023-00152097", "internal_reference": "INNN-DG-DA-SRM-416-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUIDORA BIOGAMA SA DE CV", "normalized_name": "DISTRIBUIDORA BIOGAMA", "rfc_type": null, "slug": "distribuidora-biogama" }, "contract_period": { "published_at": "2023-11-28T01:34:14.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "18425", "tax": "2948", "total": "21373", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "FILTRO DE PIRINOLA (FILTRO PARA JERINGA) DE 28 MM Y 0.20 MICRAS MEMBRANA CFSA NO PIROGHENICOS ESTERIL, EMPAQUETADOS INDIVIDUALMENTE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1265", "subtotal": "1265", "tax": "202.4", "other_taxes": null, "total": "1467.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "FRASCO DE CULTIVO CELULAR DE POLIESTIRENO, 75 CM2, ESTÉRIL, TRATADOS P/CULTIVO Y FILTRO DE VENTILACIÓN EN LA TAPA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1090", "subtotal": "4360", "tax": "697.6", "other_taxes": null, "total": "5057.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO P/CENTRIFUGA 15ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1600", "subtotal": "12800", "tax": "2048", "other_taxes": null, "total": "14848" } ] }, { "id": "C-2023-00152095", "internal_reference": "INNN-DG-DA-SRM-417-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "EQUIVER SA DE CV", "normalized_name": "EQUIVER", "rfc_type": null, "slug": "equiver" }, "contract_period": { "published_at": "2023-11-28T01:35:07.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "77149.08", "tax": "12343.85", "total": "89492.93", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "1,4 DITIOTREITOL (DTT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1665.18", "subtotal": "1665.18", "tax": "266.43", "other_taxes": null, "total": "1931.61" }, { "number": "0", "cucop_code": "25101-0037", "description": "TEMED (50 ML) ULTRAPURO, GRADO BIOLOGIA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1085.76", "subtotal": "2171.52", "tax": "347.44", "other_taxes": null, "total": "2518.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "10X TRIS/GLYCINE/SDS. BIORAD. PKG OF 1, 1 L, 10X PREMIXED ELECTROPHORESIS BUFFER, CONTAINS 25 MM TRIS, 192 MM GLYCINE, 0.1% SDS, PH 8.3 FOLLOWING DILUTION TO 1X WITH WATER.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "574.74", "subtotal": "1149.48", "tax": "183.92", "other_taxes": null, "total": "1333.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "2X LAEMMLI SAMPLE BUFFER.30 ML, PREMIXED PROTEIN SAMPLE BUFFER FOR SDS-PAGE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "347.58", "subtotal": "347.58", "tax": "55.61", "other_taxes": null, "total": "403.19" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA DE NITROCELULOSA 0.4 UM\n30 CM X 3.5 M", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6449.04", "subtotal": "6449.04", "tax": "1031.85", "other_taxes": null, "total": "7480.89" }, { "number": "0", "cucop_code": "25501-0090", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7938", "subtotal": "47628", "tax": "7620.48", "other_taxes": null, "total": "55248.48" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN COMB, 10-WELL, 0.75 MM, 33 ¿L. PKG OF 5, COMBS FOR MINI-PROTEAN ELECTROPHORESIS CELL, USE WITH 0.75 MM GLASS PLATES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "740.7", "subtotal": "740.7", "tax": "118.51", "other_taxes": null, "total": "859.21" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN SHORT PLATES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "517.14", "subtotal": "1034.28", "tax": "165.48", "other_taxes": null, "total": "1199.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN SHORT PLATES. PKG OF 5, SHORT PLATE FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "517.14", "subtotal": "1034.28", "tax": "165.48", "other_taxes": null, "total": "1199.76" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN SPACER PLATES WITH 1.0 MM INTEGRATED SPACERS. PKG OF 5, SPACER PLATE WITH 1.0 MM INTEGRATED SPACER, FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1098.72", "subtotal": "1098.72", "tax": "175.8", "other_taxes": null, "total": "1274.52" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN CASTING FRAME", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "760.5", "subtotal": "760.5", "tax": "121.68", "other_taxes": null, "total": "882.18" }, { "number": "0", "cucop_code": "25501-0090", "description": "MINI-PROTEAN CASTING FRAME", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "760.5", "subtotal": "760.5", "tax": "121.68", "other_taxes": null, "total": "882.18" }, { "number": "0", "cucop_code": "25501-0090", "description": "SUPPORTED NITROCELLULOSE MEMBRANE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6449.04", "subtotal": "6449.04", "tax": "1031.85", "other_taxes": null, "total": "7480.89" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS DELGADOS MINI PROTEAN SHORT PLATES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "517.14", "subtotal": "1034.28", "tax": "165.48", "other_taxes": null, "total": "1199.76" }, { "number": "0", "cucop_code": "25501-0089", "description": "VIDRIOS ESPACIADOR DE 0.75 MM MINI PROTEAN SPACER PLATES WITH 0.75 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1335.78", "subtotal": "2671.56", "tax": "427.45", "other_taxes": null, "total": "3099.01" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMMONIUM PERSULFATE (APS). CATALYST.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "329.94", "subtotal": "989.82", "tax": "158.37", "other_taxes": null, "total": "1148.19" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN DE AZUL BRILLANTE DE COOMASSIE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1164.6", "subtotal": "1164.6", "tax": "186.34", "other_taxes": null, "total": "1350.94" } ] }, { "id": "C-2023-00152088", "internal_reference": "INNN-DG-DA-SRM-418-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "JRL SUPPLIERS S DE RL DE CV", "normalized_name": "JRL SUPPLIERS", "rfc_type": null, "slug": "jrl-suppliers" }, "contract_period": { "published_at": "2023-11-28T01:35:50.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "332807.72", "tax": "53249.24", "total": "386056.96", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "(TUBO AL VACIÓ CON ANTICOAGULANTE (EDTA, TAPÓN MORADO ) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. S", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "618", "subtotal": "6180", "tax": "988.8", "other_taxes": null, "total": "7168.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "15ML TUBO CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1500", "subtotal": "6000", "tax": "960", "other_taxes": null, "total": "6960" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONA EN ENVASE DE PLÁSTICO. PRESENTACION DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1178", "subtotal": "3534", "tax": "565.44", "other_taxes": null, "total": "4099.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38% PORRÓN 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5860", "subtotal": "5860", "tax": "937.6", "other_taxes": null, "total": "6797.6" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 21G X 1 \" ( 0.8 MM X 25 MM) COLOR VERDE REF. 301746", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "390.32", "subtotal": "44106.16", "tax": "7056.99", "other_taxes": null, "total": "51163.15" }, { "number": "0", "cucop_code": "25501-0090", "description": "BASE PARA TUBO TIPO VACUTAINER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "96.39", "subtotal": "5783.4", "tax": "925.34", "other_taxes": null, "total": "6708.74" }, { "number": "0", "cucop_code": "25501-0092", "description": "CAMARA DE FUSCH ROSENTHAL CUADRICULA DOBLE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8400", "subtotal": "50400", "tax": "8064", "other_taxes": null, "total": "58464" }, { "number": "0", "cucop_code": "25501-0105", "description": "EQUIPO ALADO ULTRA-TOUCH PARA TOMA DE MUESTRAS SANGUINEAS AL VACIO CON AGUJA NO. 23 G X .75 CON TUBO DE PLASTICO FLEXIBLE DE 7\"(AZUL CLARO) CON TECNOLOGIA DE PARED ULTRAFINA RIGTHGAUGE QUE PERMITE UTILIZAR CALIBRES MAS PEQUEÑOS PARA LOS ACCESOS VENOSOS DIFICILES Y CON DISEÑO PENTAPOINT DE 5 BISELES EL CUAL DISMINUYE LA FUERZA DE PENETRACIÓN DE LA AGUJA CON SISTEMA DE BOTÓN DE SEGURIDAD PARA LA RETRACCIÓN DE LA AGUJA (\"PUSH BUTTON\")", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1658.86", "subtotal": "19906.32", "tax": "3185.01", "other_taxes": null, "total": "23091.33" }, { "number": "0", "cucop_code": "25501-0090", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA CHICA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "101.46", "subtotal": "202.92", "tax": "32.47", "other_taxes": null, "total": "235.39" }, { "number": "0", "cucop_code": "25501-0090", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA MEDIANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "101.46", "subtotal": "202.92", "tax": "32.47", "other_taxes": null, "total": "235.39" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. PARTE M1024254", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4454.4", "subtotal": "44544", "tax": "7127.04", "other_taxes": null, "total": "51671.04" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. 3 PARTE M1024247", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7020", "subtotal": "42120", "tax": "6739.2", "other_taxes": null, "total": "48859.2" }, { "number": "0", "cucop_code": "25501-0094", "description": "SENSOR NEONATAL/ADULTO PARA LA MEDICIÓN DE SPHB, SPO2, SPMET. PARA USO EN EQUIPO MARCA MASIMO, MODELO RAINBOW (R1 25L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "34656", "subtotal": "103968", "tax": "16634.88", "other_taxes": null, "total": "120602.88" } ] }, { "id": "C-2023-00152079", "internal_reference": "INNN-DG-DA-SRM-419-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "MAYIMEX SA DE CV", "normalized_name": "MAYIMEX", "rfc_type": null, "slug": "mayimex" }, "contract_period": { "published_at": "2023-11-28T01:36:47.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "7600", "tax": "1216", "total": "8816", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "JUEGO DE 3 PIPETAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7600", "subtotal": "7600", "tax": "1216", "other_taxes": null, "total": "8816" } ] }, { "id": "C-2023-00152072", "internal_reference": "INNN-DG-DA-SRM-420-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "PEGO MEDICAL SA DE CV", "normalized_name": "PEGO MEDICAL", "rfc_type": null, "slug": "pego-medical" }, "contract_period": { "published_at": "2023-11-28T01:37:24.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "25344", "tax": "4055.04", "total": "29399.04", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "SUTURA CATGUT CRÓMICO 4-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1600", "subtotal": "8000", "tax": "1280", "other_taxes": null, "total": "9280" }, { "number": "0", "cucop_code": "25501-0090", "description": "SUTURA NYLON 4-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1792", "subtotal": "7168", "tax": "1146.88", "other_taxes": null, "total": "8314.88" }, { "number": "0", "cucop_code": "25501-0090", "description": "SUTURA QUIRÚRGICA SEDA PRETA/NEGRA TRENZADA CON AGUJA 4-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2112", "subtotal": "2112", "tax": "337.92", "other_taxes": null, "total": "2449.92" }, { "number": "0", "cucop_code": "25501-0090", "description": "SUTURA SEDA 4-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2016", "subtotal": "8064", "tax": "1290.24", "other_taxes": null, "total": "9354.24" } ] }, { "id": "C-2023-00152064", "internal_reference": "INNN-DG-DA-SRM-421-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "QUIMICA VALANER SA DE CV", "normalized_name": "QUIMICA VALANER", "rfc_type": null, "slug": "quimica-valaner" }, "contract_period": { "published_at": "2023-11-28T01:37:56.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "32013", "tax": "5122.08", "total": "37135.08", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "AMPK¿ ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8202", "subtotal": "8202", "tax": "1312.32", "other_taxes": null, "total": "9514.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN HPH I", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1900", "subtotal": "5700", "tax": "912", "other_taxes": null, "total": "6612" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DE RESTRICCIÓN PMEI", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2202", "subtotal": "2202", "tax": "352.32", "other_taxes": null, "total": "2554.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "T4 DNA LIGASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1872", "subtotal": "1872", "tax": "299.52", "other_taxes": null, "total": "2171.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "M-MLV TRANSCRIPTASA INVERSA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2174", "subtotal": "6522", "tax": "1043.52", "other_taxes": null, "total": "7565.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROTEINASA K EN SOLUCIÓN DE 20 MG / ML, VIAL DE 1.0 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2505", "subtotal": "7515", "tax": "1202.4", "other_taxes": null, "total": "8717.4" } ] }, { "id": "C-2023-00152060", "internal_reference": "INNN-DG-DA-SRM-422-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "normalized_name": "REACTIVOS Y MARCAS DE MEXICO", "rfc_type": null, "slug": "reactivos-y-marcas-de-mexico" }, "contract_period": { "published_at": "2023-11-28T01:39:15.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "426213.3", "tax": "68194.15", "total": "494407.45", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0011", "description": "2,-(4-HYDROXYPHENYLAZO) BENZOIC ACID PUREZA \t= 90 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "715.3", "subtotal": "715.3", "tax": "114.45", "other_taxes": null, "total": "829.75" }, { "number": "0", "cucop_code": "25101-0011", "description": "3-INDOLEPROPIONIC ACID ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "766.6", "subtotal": "766.6", "tax": "122.66", "other_taxes": null, "total": "889.26" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO BICINCONINICO (SOLUCIÓN) ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10330", "subtotal": "10330", "tax": "1652.8", "other_taxes": null, "total": "11982.8" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO NITRICO70%, ALTA PUREZA PURIFIED BY REDISTILLATION, =99.999% TRACE METALS BASIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3573.7", "subtotal": "10721.1", "tax": "1715.38", "other_taxes": null, "total": "12436.48" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO VALPROICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16749.7", "subtotal": "16749.7", "tax": "2679.95", "other_taxes": null, "total": "19429.65" }, { "number": "0", "cucop_code": "25101-0011", "description": "INDOLE-3-PYRUVIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14469.1", "subtotal": "14469.1", "tax": "2315.06", "other_taxes": null, "total": "16784.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACRILAMIDA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3135.4", "subtotal": "18812.4", "tax": "3009.98", "other_taxes": null, "total": "21822.38" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMERSHAM ECL RAINBO MARKER - FULL RANGE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3759.1", "subtotal": "7518.2", "tax": "1202.91", "other_taxes": null, "total": "8721.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "BETA-MERCAPTOETANOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "455.2", "subtotal": "455.2", "tax": "72.83", "other_taxes": null, "total": "528.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "CATALASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16426.6", "subtotal": "16426.6", "tax": "2628.26", "other_taxes": null, "total": "19054.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "CHITOSAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1856.5", "subtotal": "1856.5", "tax": "297.04", "other_taxes": null, "total": "2153.54" }, { "number": "0", "cucop_code": "25101-0037", "description": "DNTP MIX (10 MM EACH)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1344.4", "subtotal": "1344.4", "tax": "215.1", "other_taxes": null, "total": "1559.5" }, { "number": "0", "cucop_code": "25101-0037", "description": "HABA/AVIDIN REAGENT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1358.8", "subtotal": "1358.8", "tax": "217.41", "other_taxes": null, "total": "1576.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOCHALASIN B", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2160.7", "subtotal": "2160.7", "tax": "345.71", "other_taxes": null, "total": "2506.41" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 80", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "738.7", "subtotal": "738.7", "tax": "118.19", "other_taxes": null, "total": "856.89" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.22¿M DEL PORO. DIÁMETRO DE 47MM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1766.85", "subtotal": "8834.25", "tax": "1413.48", "other_taxes": null, "total": "10247.73" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA PARA FILTRACIÓN CON PORO DE 0.45 MICROMETROS, HVLP HIDROFÍLICAS DE ÉSTERES DE CELULOSA DE 47MM DE DIÁMETRO. PAQ. C/100 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1275.55", "subtotal": "1275.55", "tax": "204.09", "other_taxes": null, "total": "1479.64" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANA PARA FILTRACIÓN DE DISOLVENTES ORGANICOS (HIDROFÓBICA) TIPO HVLP 0.45 MM. CAJA C/100 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2133.2", "subtotal": "2133.2", "tax": "341.31", "other_taxes": null, "total": "2474.51" }, { "number": "0", "cucop_code": "25501-0090", "description": "MEMBRANAS DE FILTRADO HIDROFÓBICAS DE PVDF, 0.22 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2490.2", "subtotal": "2490.2", "tax": "398.43", "other_taxes": null, "total": "2888.63" }, { "number": "0", "cucop_code": "25501-0089", "description": "UNIDAD DE FILTRACIÓN POR VACÍO; UN EMBUDO DE VIDRIO Y UNA ABRAZADERA DE ALUMINIO. EL EMBUDO GRADUADO DE 300 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6615.25", "subtotal": "6615.25", "tax": "1058.44", "other_taxes": null, "total": "7673.69" }, { "number": "0", "cucop_code": "25501-0090", "description": "UNIDAD DE FILTRO DE JERINGA MILLEX-GS, 0,22 µM, DIÁMETRO 25 MM, CAJA CON 50 PZS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7769.55", "subtotal": "7769.55", "tax": "1243.13", "other_taxes": null, "total": "9012.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "(3-AMINOPROPYL) TRIETHOXYSILANE (APTES)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7662.4", "subtotal": "15324.8", "tax": "2451.97", "other_taxes": null, "total": "17776.77" }, { "number": "0", "cucop_code": "25101-0037", "description": "(3-AMINOPROPYL)TRIETHOXYSILANE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2221.9", "subtotal": "2221.9", "tax": "355.5", "other_taxes": null, "total": "2577.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "1,3-DIPHENYLISOBENZOFURAN (DPBF)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2822.2", "subtotal": "2822.2", "tax": "451.55", "other_taxes": null, "total": "3273.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-4 DINITROFENOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "661.3", "subtotal": "661.3", "tax": "105.81", "other_taxes": null, "total": "767.11" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-MERCAPTOETANOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1390.3", "subtotal": "1390.3", "tax": "222.45", "other_taxes": null, "total": "1612.75" }, { "number": "0", "cucop_code": "25101-0037", "description": "3-(TRIMETHOXYSILYL)PROPYL METHACRYLATE (SILANE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1502.8", "subtotal": "1502.8", "tax": "240.45", "other_taxes": null, "total": "1743.25" }, { "number": "0", "cucop_code": "25101-0037", "description": "5-IODOTUBERCIDIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15370", "subtotal": "30740", "tax": "4918.4", "other_taxes": null, "total": "35658.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "6-HYDROXYDOPAMINE HYDROBROMIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11277.7", "subtotal": "11277.7", "tax": "1804.43", "other_taxes": null, "total": "13082.13" }, { "number": "0", "cucop_code": "25101-0037", "description": "8-CYCLOPENTYL-1,3-DIPROPYLXANTHINE DPCPX", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2243.5", "subtotal": "2243.5", "tax": "358.96", "other_taxes": null, "total": "2602.46" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOCHALASIN D", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3706", "subtotal": "3706", "tax": "592.96", "other_taxes": null, "total": "4298.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "DAPT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3440.5", "subtotal": "3440.5", "tax": "550.48", "other_taxes": null, "total": "3990.98" }, { "number": "0", "cucop_code": "25101-0037", "description": "DL-2-AMINO-5-PHOSPHONOPENTANOIC ACID", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6583.3", "subtotal": "6583.3", "tax": "1053.33", "other_taxes": null, "total": "7636.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "DOPAMINE HYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1032.1", "subtotal": "1032.1", "tax": "165.14", "other_taxes": null, "total": "1197.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "DYETHYLPYROCARBONATE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7430.2", "subtotal": "7430.2", "tax": "1188.83", "other_taxes": null, "total": "8619.03" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUOROMOUNT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3241.6", "subtotal": "3241.6", "tax": "518.66", "other_taxes": null, "total": "3760.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUTATHIONE REDUCTASE FROM BAKER'S YEAST (S. CEREVISIAE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2931.1", "subtotal": "2931.1", "tax": "468.98", "other_taxes": null, "total": "3400.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "IMMOBILON CRESCENDO WESTERN HRP SUBSTRATE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7857.1", "subtotal": "7857.1", "tax": "1257.14", "other_taxes": null, "total": "9114.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISOPROPÓXIDO DE TITANIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1938.4", "subtotal": "3876.8", "tax": "620.29", "other_taxes": null, "total": "4497.09" }, { "number": "0", "cucop_code": "25101-0037", "description": "LACTOTRANSFERRINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4080.4", "subtotal": "4080.4", "tax": "652.86", "other_taxes": null, "total": "4733.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "LAMININ FROM ENGELBRETH-HOLM-SWARM MURINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4915.6", "subtotal": "4915.6", "tax": "786.5", "other_taxes": null, "total": "5702.1" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTAMINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "647.8", "subtotal": "647.8", "tax": "103.65", "other_taxes": null, "total": "751.45" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-GLUTATIÓN OXIDADO (GSSG)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4746.4", "subtotal": "9492.8", "tax": "1518.85", "other_taxes": null, "total": "11011.65" }, { "number": "0", "cucop_code": "25101-0037", "description": "LIPOPOLYSACCHARIDES FROM ESCHERICHIA COLI O111:B4", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9454.3", "subtotal": "9454.3", "tax": "1512.69", "other_taxes": null, "total": "10966.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "TARIQUIDAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11799.7", "subtotal": "23599.4", "tax": "3775.9", "other_taxes": null, "total": "27375.3" }, { "number": "0", "cucop_code": "25101-0037", "description": "TAURINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2104.9", "subtotal": "2104.9", "tax": "336.78", "other_taxes": null, "total": "2441.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "THIOUREA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1093.3", "subtotal": "1093.3", "tax": "174.93", "other_taxes": null, "total": "1268.23" }, { "number": "0", "cucop_code": "25101-0037", "description": "WIN 55,212-2", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10216.6", "subtotal": "20433.2", "tax": "3269.31", "other_taxes": null, "total": "23702.51" }, { "number": "0", "cucop_code": "25101-0037", "description": "XANTINA -FRASCO DE 25MG (XANTHINE =99%)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3674.5", "subtotal": "3674.5", "tax": "587.92", "other_taxes": null, "total": "4262.42" }, { "number": "0", "cucop_code": "25101-0037", "description": "XANTINE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2164.3", "subtotal": "2164.3", "tax": "346.29", "other_taxes": null, "total": "2510.59" }, { "number": "0", "cucop_code": "25101-0037", "description": "XANTINE OXIDASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3049.9", "subtotal": "3049.9", "tax": "487.98", "other_taxes": null, "total": "3537.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROQUINA SAL DIFOSFATADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3475.6", "subtotal": "6951.2", "tax": "1112.19", "other_taxes": null, "total": "8063.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3158.8", "subtotal": "3158.8", "tax": "505.41", "other_taxes": null, "total": "3664.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "PIRUVATO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1420.9", "subtotal": "1420.9", "tax": "227.34", "other_taxes": null, "total": "1648.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERSULFATO DE AMONIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "763.9", "subtotal": "4583.4", "tax": "733.34", "other_taxes": null, "total": "5316.74" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXADECYLTRIMETHYLAMMONIUM BROMIDE (CTAB)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7933.3", "subtotal": "7933.3", "tax": "1269.33", "other_taxes": null, "total": "9202.63" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-HIDROXISULFOSUCCINIMIDA (SULFO- NHS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3238", "subtotal": "3238", "tax": "518.08", "other_taxes": null, "total": "3756.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "2,6 DICLOROFENOLINDOFENOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4044", "subtotal": "4044", "tax": "647.04", "other_taxes": null, "total": "4691.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDROSULFITO DE SODIO (DT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1729.6", "subtotal": "1729.6", "tax": "276.74", "other_taxes": null, "total": "2006.34" }, { "number": "0", "cucop_code": "25101-0037", "description": "2,3,5-TRIPHENYLTETRAZOLIUM CHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2130.1", "subtotal": "2130.1", "tax": "340.82", "other_taxes": null, "total": "2470.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "2',7'-DICHLOROFLUORESCEIN, FRASCO DE 5 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2130.1", "subtotal": "4260.2", "tax": "681.63", "other_taxes": null, "total": "4941.83" }, { "number": "0", "cucop_code": "25101-0037", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS, FRASCO 250MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3158.8", "subtotal": "3158.8", "tax": "505.41", "other_taxes": null, "total": "3664.21" }, { "number": "0", "cucop_code": "25101-0037", "description": "DAPI", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1427.2", "subtotal": "1427.2", "tax": "228.35", "other_taxes": null, "total": "1655.55" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUORESCEIN ISOTHIOCYANATE (FITC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10295.8", "subtotal": "10295.8", "tax": "1647.33", "other_taxes": null, "total": "11943.13" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEMATOXILINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3065.2", "subtotal": "6130.4", "tax": "980.86", "other_taxes": null, "total": "7111.26" }, { "number": "0", "cucop_code": "25101-0037", "description": "O-FTALADEHÍDO = 98% , FRASCO 5 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14998.3", "subtotal": "29996.6", "tax": "4799.46", "other_taxes": null, "total": "34796.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "PONCEAU-S, SODIUM SALT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2879.8", "subtotal": "2879.8", "tax": "460.77", "other_taxes": null, "total": "3340.57" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROPIDIUM IODIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4729.3", "subtotal": "4729.3", "tax": "756.69", "other_taxes": null, "total": "5485.99" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE SCHIFF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "805.5", "subtotal": "1611", "tax": "257.76", "other_taxes": null, "total": "1868.76" } ] }, { "id": "C-2023-00151766", "internal_reference": "INNN-DG-DA-SRM-423-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "normalized_name": "SILVERA CIENCIA E INGENIERIA", "rfc_type": null, "slug": "silvera-ciencia-e-ingenieria" }, "contract_period": { "published_at": "2023-11-28T01:44:18.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1511144", "tax": "241783.04", "total": "1752927.04", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0011", "description": "3-INDOLEACETIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3420", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO HOMOVANÍLICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "524", "subtotal": "524", "tax": "83.84", "other_taxes": null, "total": "607.84" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO XANTURÉNICO ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1482", "subtotal": "1482", "tax": "237.12", "other_taxes": null, "total": "1719.12" }, { "number": "0", "cucop_code": "25101-0011", "description": "IRON(III) CHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "912", "subtotal": "912", "tax": "145.92", "other_taxes": null, "total": "1057.92" }, { "number": "0", "cucop_code": "25101-0011", "description": "TRIETILAMINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2227", "subtotal": "2227", "tax": "356.32", "other_taxes": null, "total": "2583.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "(+)-MK-801HYDROGEN MALEATE 25MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7729", "subtotal": "15458", "tax": "2473.28", "other_taxes": null, "total": "17931.28" }, { "number": "0", "cucop_code": "25301-3467", "description": "APOMORFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6080", "subtotal": "6080", "tax": "972.8", "other_taxes": null, "total": "7052.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "BENZONATATO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7524", "subtotal": "7524", "tax": "1203.84", "other_taxes": null, "total": "8727.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBAMAZEPINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1459", "subtotal": "1459", "tax": "233.44", "other_taxes": null, "total": "1692.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "CEFOPERAZONA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1254", "subtotal": "1254", "tax": "200.64", "other_taxes": null, "total": "1454.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "GABAPENTINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2736", "subtotal": "2736", "tax": "437.76", "other_taxes": null, "total": "3173.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "GENISTEÍNA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "570", "subtotal": "570", "tax": "91.2", "other_taxes": null, "total": "661.2" }, { "number": "0", "cucop_code": "25301-4394", "description": "LEVETIRACETAM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7729", "subtotal": "7729", "tax": "1236.64", "other_taxes": null, "total": "8965.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "LUMEFANTRINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2736", "subtotal": "2736", "tax": "437.76", "other_taxes": null, "total": "3173.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITAZOXANIDA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2736", "subtotal": "2736", "tax": "437.76", "other_taxes": null, "total": "3173.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "PENTILENTETRAZOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3002", "subtotal": "6004", "tax": "960.64", "other_taxes": null, "total": "6964.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "SAQUINAVIR, FRASCO DE 10 MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1801", "subtotal": "1801", "tax": "288.16", "other_taxes": null, "total": "2089.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "TEMOZOLOMIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5472", "subtotal": "10944", "tax": "1751.04", "other_taxes": null, "total": "12695.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ACTIN (C-2)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ANTI RABBIT ACOPLADO A ALEXA 488", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3493", "subtotal": "3493", "tax": "558.88", "other_taxes": null, "total": "4051.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "AMINOBUTYRIC ACID MONOCLONAL ANTIBODY (5A9) 25 ¿G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2599", "subtotal": "2599", "tax": "415.84", "other_taxes": null, "total": "3014.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTCUERPO: MAP LC3¿/B (G-4).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI - TIROSINA HIDROXILASA RABBIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI GALECTINA3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-BCL-2 (C-2) ANTICUERPO MONOCLONAL IGG1 (KAPPA LIGHT CHAIN) BCL-2 ANTIBODY.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUEPO ANTI-CONNEXIN 43 (D-7)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI ACTINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI ALFA ACTINA HUMANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "13862", "tax": "2217.92", "other_taxes": null, "total": "16079.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI TNF ALFA DE HUMANO, RATON, RATA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI FACTOR VON WILLEBRAND /VWF", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-CASPASA 3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-FGF-2", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-OCCLUDIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-TIROSINA HIDROXILASA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-VEGFA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-ZO-1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO BCL-2 ANTIBODY (1N2), N-TERM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CASPASE 3 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CASPASE 9 ANTIBODY (N2C3)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CAVEOLIN-3", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO DYSTROPHIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO INTEGRINA BETA1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MONOCLONAL DE RATON ANTI-VDAC1 CLONA (B-6) ISOTIPO IGG1 (CADENA LIGERA KAPPA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO OPA1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PROHIBITIN ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-CONEJO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "6932", "tax": "1109.12", "other_taxes": null, "total": "8041.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-HUMANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3845", "subtotal": "7690", "tax": "1230.4", "other_taxes": null, "total": "8920.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ¿-SARCOGLYCAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ¿-SARCOGLYCAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO G-SARCOGLYCAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ¿-SARCOGLYCAN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO: ATG7 ANTIBODY (B-9).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO: ANTI-BAX.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO: ANTI-CYCLIN D3 (18B6-10).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO: WAF1/CIP1/CDKN1A P21.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATRX ANTIBODY (D-5), MOUSE MONOCLONAL IGG2A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "BAX ANTIBODY (B9), MOUSE MONOCLONAL IGG2B", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTIBODY CASPASE-3 ANTIBODY (E-8), MOUSE MONOCLONAL IGG2A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI CASPASA-8, MONOCLONAL DE RATÓN IGG1 (KAPPA LIGHT CHAIN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD8 (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO C-FMS/CSF-1R ACOPLADOA ALEXA FLUOR 594", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7843", "subtotal": "15686", "tax": "2509.76", "other_taxes": null, "total": "18195.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "CMYC ANTIBODY (HUMAN, MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CYCLIN D1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "CYTOCHROME C ANTIBODY (7H8), MOUSE MONOCLONAL IGG2B.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "E-CALDHERIN ANTIBODY (G-10) IS A GOAT, MOUSE MONOCLONAL IGG1 (KAPPA LIGHT CHAIN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ERBB2/HER2 ACOPLADO A ALEXAFLUOR 680", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7843", "subtotal": "15686", "tax": "2509.76", "other_taxes": null, "total": "18195.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUORESCEIN (FITC)-AFFINIPUR RABBIT ANTI-GOAT IGG (H+L).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2653", "subtotal": "2653", "tax": "424.48", "other_taxes": null, "total": "3077.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUORESCEIN (FITC)-AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2653", "subtotal": "2653", "tax": "424.48", "other_taxes": null, "total": "3077.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUR-2 ANTICUERPO MONOCLONAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT ANTI-RABBIT IGG ANTIBODY (H+L), PEROXIDASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "3466", "tax": "554.56", "other_taxes": null, "total": "4020.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "HDAC1 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "HRP ANTI-RABBIT IGG ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "6932", "tax": "1109.12", "other_taxes": null, "total": "8041.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "HSP90ALPHA/BETAANTICUERPO(F-8)PE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7547", "subtotal": "15094", "tax": "2415.04", "other_taxes": null, "total": "17509.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO IBA1A ACOPLADO A LEXAFLUOR 680", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7843", "subtotal": "15686", "tax": "2509.76", "other_taxes": null, "total": "18195.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "IGG ANTI RATÓN HRP DE CABRA 2 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "3466", "tax": "554.56", "other_taxes": null, "total": "4020.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO INTEGRIN¿M/CD11B ACOPLADO A ALEXAFLUOR 488 (MOUSE, RAT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7843", "subtotal": "15686", "tax": "2509.76", "other_taxes": null, "total": "18195.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO LAMP1 ACOPLADO A ALEXAFLUOR 405", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7843", "subtotal": "15686", "tax": "2509.76", "other_taxes": null, "total": "18195.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MAB ANTI ACTINA DE RATÓN IGG1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MAB ANTI C-SRC DE RATÓN IGG2A 200 ¿G/ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOUSE-ANTI GFAP/PE PRIMARY ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7547", "subtotal": "7547", "tax": "1207.52", "other_taxes": null, "total": "8754.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "NAVL1 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO NCAM/CD56", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "NMDA RECEPTOR NR2C SUBUNIT POLYCLONAL ANTIBODY 10 ¿G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7971", "subtotal": "7971", "tax": "1275.36", "other_taxes": null, "total": "9246.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "NRF1 ANTICUERPO (H-4)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "OCCLUDIN ANTIBODY (E-5), MOUSE MONOCLONAL IGG2B (KAPPA LIGHT CHAIN)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "PAQUETEDECORONAVIRUS(FIPV3-70):M-IGGFCBP-HRP100 ¿G AB; 10 ¿G BP", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7798", "subtotal": "15596", "tax": "2495.36", "other_taxes": null, "total": "18091.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASE-AFFINIPURE 1.50M GOAT ANTI-RABBIT IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "3466", "tax": "554.56", "other_taxes": null, "total": "4020.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-GOAT IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3845", "subtotal": "3845", "tax": "615.2", "other_taxes": null, "total": "4460.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-HUMAN IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3845", "subtotal": "3845", "tax": "615.2", "other_taxes": null, "total": "4460.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "RHODAMINE RED-X-AFFINIPURE GOAT ANTI-MOUSE IGG (H+L)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2653", "subtotal": "2653", "tax": "424.48", "other_taxes": null, "total": "3077.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "ß-CATENIN ANTIBODY (E-5) IS A MOUSE MONOCLONAL IGG1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TL1A (HUMAN) MONOCLONAL ANTIBODY (L4G9), 100 ¿G,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9595", "subtotal": "19190", "tax": "3070.4", "other_taxes": null, "total": "22260.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "VGLUT 1 ANTIBODY", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "WNT-2 ANTICUERPO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "COMPLETE, MINI PROTEASE INHIBITOR COCKTAIL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3876", "subtotal": "15504", "tax": "2480.64", "other_taxes": null, "total": "17984.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOL DE LISIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "479", "subtotal": "479", "tax": "76.64", "other_taxes": null, "total": "555.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS (HIDROXYMETHYL)-AMINOMETHANE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1322", "subtotal": "1322", "tax": "211.52", "other_taxes": null, "total": "1533.52" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS BASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "752", "subtotal": "2256", "tax": "360.96", "other_taxes": null, "total": "2616.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS-HCI, GRADO REACTIVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1368", "subtotal": "1368", "tax": "218.88", "other_taxes": null, "total": "1586.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIZMA-BASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1322", "subtotal": "3966", "tax": "634.56", "other_taxes": null, "total": "4600.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE REFERENCIA STD PARA PH 4 FRASCO 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "935", "subtotal": "1870", "tax": "299.2", "other_taxes": null, "total": "2169.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE REFERENCIA STD PARA PH 7 FRASCO 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "935", "subtotal": "1870", "tax": "299.2", "other_taxes": null, "total": "2169.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN BUFFER PH 10 PARA CALIBRACIÓN DE POTENCIÓMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "935", "subtotal": "1870", "tax": "299.2", "other_taxes": null, "total": "2169.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACTINOMYCIN D", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2364", "subtotal": "2364", "tax": "378.24", "other_taxes": null, "total": "2742.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIMETIL SULFOXIDO GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "684", "subtotal": "2736", "tax": "437.76", "other_taxes": null, "total": "3173.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIMETILSULFOXIDO (DMSO)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5244", "subtotal": "10488", "tax": "1678.08", "other_taxes": null, "total": "12166.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "DUBELCCOD'S MODIFIED EAGLE'S MEDIUM-HIGH GLUCOSE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "807", "subtotal": "3228", "tax": "516.48", "other_taxes": null, "total": "3744.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "FLUORESCEIN DIACETATO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1345", "subtotal": "2690", "tax": "430.4", "other_taxes": null, "total": "3120.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOAT SERUM.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1733", "subtotal": "1733", "tax": "277.28", "other_taxes": null, "total": "2010.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN TRIPSINA EDTA AL 2.5 % (10X)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "730", "subtotal": "730", "tax": "116.8", "other_taxes": null, "total": "846.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "BAPTA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1778", "subtotal": "1778", "tax": "284.48", "other_taxes": null, "total": "2062.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "274", "subtotal": "548", "tax": "87.68", "other_taxes": null, "total": "635.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20, 100% NONIONIC DETERGENT. BIORAD. 100 ML, ENZYME IMMUNOASSAY GRADE POLYSORBATE SURFACTANT (DETERGENT)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "274", "subtotal": "274", "tax": "43.84", "other_taxes": null, "total": "317.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE SÍNTESIS DE CDNA PARA 50 REACCIONES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5805", "subtotal": "5805", "tax": "928.8", "other_taxes": null, "total": "6733.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "NAD/NADH ASSAY KIT (COLORIMETRIC)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "17024", "subtotal": "17024", "tax": "2723.84", "other_taxes": null, "total": "19747.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "TGFBI (BIGH3) HUMAN ELISA KIT 96 TEST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2158", "subtotal": "2158", "tax": "345.28", "other_taxes": null, "total": "2503.28" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO DE 0.2 ML PARA PCR CON TAPA PLANA).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "527", "subtotal": "5270", "tax": "843.2", "other_taxes": null, "total": "6113.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA MICROPIPETA DE 10 UL BOLSA CON 1000 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "219", "subtotal": "3066", "tax": "490.56", "other_taxes": null, "total": "3556.56" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO 0.2 A 10 UL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "990", "subtotal": "1980", "tax": "316.8", "other_taxes": null, "total": "2296.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO DE 20- 200 UL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "990", "subtotal": "2970", "tax": "475.2", "other_taxes": null, "total": "3445.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "PUNTAS AZULES 1000 UL, NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS. RESISTENTA A LA ESTERILIZACIÓN EN AUTOCLAVE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220", "subtotal": "5720", "tax": "915.2", "other_taxes": null, "total": "6635.2" }, { "number": "0", "cucop_code": "25501-0090", "description": "MICROTUBOS 0.5 ML, 1000/BLS CLAROS. DE POLIPROPILENO. AUTOCLAVABLES A 121 °C A 15 PSI. DURANTE 20 MINUTOS, Y SE ALMACENA A -80 °C.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "330", "subtotal": "990", "tax": "158.4", "other_taxes": null, "total": "1148.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 0.6 ML. BOLSA C/1000 PZAS (TIPO EPENDORF)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "330", "subtotal": "2640", "tax": "422.4", "other_taxes": null, "total": "3062.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS CON TAPA (TIPO EPENDORF)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "418", "subtotal": "3344", "tax": "535.04", "other_taxes": null, "total": "3879.04" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBOS DE PCR CON TAPÓN PLANO 100 µL TRANSPARENTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "527", "subtotal": "527", "tax": "84.32", "other_taxes": null, "total": "611.32" }, { "number": "0", "cucop_code": "25501-0090", "description": "ADHESIVE MICRO SLIDES, 72/P 692.00 34,600.00", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "517", "subtotal": "25850", "tax": "4136", "other_taxes": null, "total": "29986" }, { "number": "0", "cucop_code": "25101-0037", "description": "CNQX C127-50MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10625", "subtotal": "21250", "tax": "3400", "other_taxes": null, "total": "24650" }, { "number": "0", "cucop_code": "25101-0037", "description": "SR-95531 S106-50MG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11172", "subtotal": "22344", "tax": "3575.04", "other_taxes": null, "total": "25919.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "2-CHLORO-N6-CYCLOPENTYLADENOSINE CCPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3078", "subtotal": "6156", "tax": "984.96", "other_taxes": null, "total": "7140.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "3,4-DIHYDROXYPHENYLACETIC ACID, DOPAC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "684", "subtotal": "684", "tax": "109.44", "other_taxes": null, "total": "793.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "3-HYDROXY-DL-KYNURENINE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10739", "subtotal": "10739", "tax": "1718.24", "other_taxes": null, "total": "12457.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "AM251, CB1 RECEPTOR ANTAGONIST / INVERSE AGONIST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3078", "subtotal": "3078", "tax": "492.48", "other_taxes": null, "total": "3570.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "AM630 (CB2 ANTAGONIST)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2432", "subtotal": "4864", "tax": "778.24", "other_taxes": null, "total": "5642.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "AM630, CB2 RECEPTOR ANTAGONIST", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2432", "subtotal": "2432", "tax": "389.12", "other_taxes": null, "total": "2821.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANANDAMIDA (ANANDAMIDE-AEA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1550", "subtotal": "4650", "tax": "744", "other_taxes": null, "total": "5394" }, { "number": "0", "cucop_code": "25101-0037", "description": "ARACHIDONYLETHANOLAMIDE (ANADAMIDA, AEA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4583", "subtotal": "4583", "tax": "733.28", "other_taxes": null, "total": "5316.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "BLOTTO, NON-FAT DRY MILK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "821", "subtotal": "821", "tax": "131.36", "other_taxes": null, "total": "952.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIALIL TRISULFURO (DI-2-PROPENYL TRISULFIDE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8755", "subtotal": "8755", "tax": "1400.8", "other_taxes": null, "total": "10155.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "FCCP", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2751", "subtotal": "2751", "tax": "440.16", "other_taxes": null, "total": "3191.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "GOLD (III) CHLORIDE TRIHYDRATE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14592", "subtotal": "14592", "tax": "2334.72", "other_taxes": null, "total": "16926.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "MONOACYLGLYCEROL LIPASE (MAGL) INHIBITOR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1824", "subtotal": "1824", "tax": "291.84", "other_taxes": null, "total": "2115.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-CISTEINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2326", "subtotal": "4652", "tax": "744.32", "other_taxes": null, "total": "5396.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-CISTEÍNA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2326", "subtotal": "2326", "tax": "372.16", "other_taxes": null, "total": "2698.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-ETHYLMALEIMIDE CRYSTALLINE, =98% FRASCO 25 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5510", "subtotal": "5510", "tax": "881.6", "other_taxes": null, "total": "6391.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGOMICINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6840", "subtotal": "6840", "tax": "1094.4", "other_taxes": null, "total": "7934.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "PENTAACETATO DE DIETILENTRIAMINA 3820", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3466", "subtotal": "3466", "tax": "554.56", "other_taxes": null, "total": "4020.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "PIRIDOXAL 5 FOSFATO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1254", "subtotal": "1254", "tax": "200.64", "other_taxes": null, "total": "1454.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "SB 431542", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4674", "subtotal": "4674", "tax": "747.84", "other_taxes": null, "total": "5421.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "STREPTOZOCIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2371", "subtotal": "7113", "tax": "1138.08", "other_taxes": null, "total": "8251.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "Y-27632 DIHYDROCHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5130", "subtotal": "5130", "tax": "820.8", "other_taxes": null, "total": "5950.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZM 241385", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9014", "subtotal": "27042", "tax": "4326.72", "other_taxes": null, "total": "31368.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "MTT (BROMURO DE 3-(4,5-DIMETILTIAZOL-2-IL)-2,5-DIFENILTETRAZOLIO)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2371", "subtotal": "21339", "tax": "3414.24", "other_taxes": null, "total": "24753.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBONATO DE POTASIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "912", "subtotal": "2736", "tax": "437.76", "other_taxes": null, "total": "3173.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "GUANOSINE 5’-TRIPHOSPHATE SODIUM SAL HYDRATE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1414", "subtotal": "1414", "tax": "226.24", "other_taxes": null, "total": "1640.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-GLUCOSA 6 PHOSPHATE SODIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1277", "subtotal": "1277", "tax": "204.32", "other_taxes": null, "total": "1481.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO MONOBÁSICO DE POTASIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "456", "subtotal": "1368", "tax": "218.88", "other_taxes": null, "total": "1586.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANNEXINV-FITC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15963", "subtotal": "15963", "tax": "2554.08", "other_taxes": null, "total": "18517.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL BRILLANTE DE COOMASIE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1619", "subtotal": "1619", "tax": "259.04", "other_taxes": null, "total": "1878.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "BRU (5-BROMO.2`-DEOXYURIDINE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1505", "subtotal": "1505", "tax": "240.8", "other_taxes": null, "total": "1745.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "ER-TRACKER GREEN (BODIPY FL GLIBENCLAMIDE), FOR LIVE-CELL IMAGING", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6433", "subtotal": "6433", "tax": "1029.28", "other_taxes": null, "total": "7462.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "SYTO 9 STAIN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9011", "subtotal": "27033", "tax": "4325.28", "other_taxes": null, "total": "31358.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "TINCIÓN DE PONCEUS (PONCEUS STAIN). FCO. 500 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1801", "subtotal": "1801", "tax": "288.16", "other_taxes": null, "total": "2089.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-FSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10436", "subtotal": "10436", "tax": "1669.76", "other_taxes": null, "total": "12105.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-LH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10095", "subtotal": "10095", "tax": "1615.2", "other_taxes": null, "total": "11710.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-PROLACTINA (PRL) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13320", "subtotal": "13320", "tax": "2131.2", "other_taxes": null, "total": "15451.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO ANTI-RECEPTOR DE PROGESTERONA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "16650", "subtotal": "16650", "tax": "2664", "other_taxes": null, "total": "19314" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11406", "subtotal": "11406", "tax": "1824.96", "other_taxes": null, "total": "13230.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD35 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14631", "subtotal": "14631", "tax": "2340.96", "other_taxes": null, "total": "16971.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD38 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "19141", "subtotal": "19141", "tax": "3062.56", "other_taxes": null, "total": "22203.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD56 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "23467", "subtotal": "23467", "tax": "3754.72", "other_taxes": null, "total": "27221.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD57 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14421", "subtotal": "14421", "tax": "2307.36", "other_taxes": null, "total": "16728.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CD8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12717", "subtotal": "12717", "tax": "2034.72", "other_taxes": null, "total": "14751.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CK AE1/AE3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "20058", "subtotal": "20058", "tax": "3209.28", "other_taxes": null, "total": "23267.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CK-HMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11406", "subtotal": "11406", "tax": "1824.96", "other_taxes": null, "total": "13230.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CLAUDINA 5 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8259", "subtotal": "8259", "tax": "1321.44", "other_taxes": null, "total": "9580.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO CMV PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10881", "subtotal": "10881", "tax": "1740.96", "other_taxes": null, "total": "12621.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO E-CADERINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12192", "subtotal": "12192", "tax": "1950.72", "other_taxes": null, "total": "14142.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO HMB45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO INI-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO INSM1 CLONA A-8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO KAPPA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10095", "subtotal": "10095", "tax": "1615.2", "other_taxes": null, "total": "11710.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO LAMBDA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8784", "subtotal": "8784", "tax": "1405.44", "other_taxes": null, "total": "10189.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO LISOZIMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "10095", "subtotal": "10095", "tax": "1615.2", "other_taxes": null, "total": "11710.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO MIOGENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15601", "subtotal": "15601", "tax": "2496.16", "other_taxes": null, "total": "18097.16" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO NEUN FOX3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "17567", "subtotal": "17567", "tax": "2810.72", "other_taxes": null, "total": "20377.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO NSE PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15732", "subtotal": "15732", "tax": "2517.12", "other_taxes": null, "total": "18249.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO P53 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15339", "subtotal": "15339", "tax": "2454.24", "other_taxes": null, "total": "17793.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO P65 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PLAP PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6931", "subtotal": "6931", "tax": "1108.96", "other_taxes": null, "total": "8039.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO PS100 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "14631", "subtotal": "14631", "tax": "2340.96", "other_taxes": null, "total": "16971.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "15339", "subtotal": "15339", "tax": "2454.24", "other_taxes": null, "total": "17793.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO STAT6 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "17436", "subtotal": "17436", "tax": "2789.76", "other_taxes": null, "total": "20225.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANTICUERPO SV40 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "26089", "subtotal": "26089", "tax": "4174.24", "other_taxes": null, "total": "30263.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE REFERENCIA STD PARA PH 4 SIN COLOR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "935", "subtotal": "935", "tax": "149.6", "other_taxes": null, "total": "1084.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE REFERENCIA STD PARA PH 7 SIN COLOR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "935", "subtotal": "935", "tax": "149.6", "other_taxes": null, "total": "1084.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE EXTRACCIÓN DE DNA, RNA Y PROTEÍNAS A PARTIR DE TEJIDO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2705", "subtotal": "2705", "tax": "432.8", "other_taxes": null, "total": "3137.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO ACTIN F PARA PCR CON SECUENCIA AGGGAGTATATAGGTTGGGGAAGTT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1330", "subtotal": "1330", "tax": "212.8", "other_taxes": null, "total": "1542.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO ACTIN R PARA PCR CON SECUENCIA AACACACAATAACAAACACAAATTCAC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1436", "subtotal": "1436", "tax": "229.76", "other_taxes": null, "total": "1665.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO GADPH FW 5'-GAAGGTCGGAGTCAACGGATTT-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1170", "subtotal": "1170", "tax": "187.2", "other_taxes": null, "total": "1357.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO GADPH RV 5'-CTGGAAGATGGTGATGGGATT-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1117", "subtotal": "1117", "tax": "178.72", "other_taxes": null, "total": "1295.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO GB FW 5´-ACTGGAACTTTACTCGCAGAAAGA-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1277", "subtotal": "1277", "tax": "204.32", "other_taxes": null, "total": "1481.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO GB RV 3'-CTCCACGTACTTTACCCGCTG-5' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1117", "subtotal": "1117", "tax": "178.72", "other_taxes": null, "total": "1295.72" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO IE-1-A FW 5'-GAAGGCTGAGTTCTTGGTAA-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO IE-1-B RV 3'-AGCTGCATGATGTGAGCAAG-5' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO IE-1-C RV 3'-TGAGGATAAGCGGGAGATGT-5' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO IE-1-D FW 5'-CTGAGGCAAGTTCTGCAATG-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO LMP-1 FW 5'-CCAGACAGCAGCCAATTGTC-3' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO LMP-1 RV 3'-GGTAGAAGACCCCCTCTTAC-5' 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E1F PARA PCR CON SECUENCIA GCGCTCTCTTGCTTTTCTCA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E1R PARA PCR CON SECUENCIA GACACTCACCAAGTCGCAAA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E2F PARA PCR CON SECUENCIA TGGAGCTGTCTGGTTGTGAG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E2R PARA PCR CON SECUENCIA TGGAAAACATGCCGTTATCA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E5F PARA PCR CON SECUENCIA CCGTGAAG-GAATGGCTTCTG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO MGMGT E5R PARA PCR CON SECUENCIA TAGCTCCCGCTCCCTTG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "904", "subtotal": "904", "tax": "144.64", "other_taxes": null, "total": "1048.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO P1METHF PARA PCR CON SECUENCIA TTTCGACGTTCGTAGGTTTTCGC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1224", "subtotal": "1224", "tax": "195.84", "other_taxes": null, "total": "1419.84" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO P1UNMETHF PARA PCR CON SECUENCIA TTTGTGTTTTGATGTTTGTAGGTTTTTGT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1543", "subtotal": "1543", "tax": "246.88", "other_taxes": null, "total": "1789.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA CTCGAAACTACCACCGTCCCGA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1170", "subtotal": "1170", "tax": "187.2", "other_taxes": null, "total": "1357.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA GCACTCTTCCGAAAACGAAACG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1170", "subtotal": "1170", "tax": "187.2", "other_taxes": null, "total": "1357.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO P2UNMETHR PARA PCR CON SECUENCIA AACTCCACACTCTTCCAAAAACAAAACA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1490", "subtotal": "1490", "tax": "238.4", "other_taxes": null, "total": "1728.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 3´-CAACTTCATCCACGTTCACC-5´ 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 5´-GAAGAGCCAAGGACAGGTAC-3´ 200 NANOMOLES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1064", "subtotal": "1064", "tax": "170.24", "other_taxes": null, "total": "1234.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "PCR MASTER MIX KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11068", "subtotal": "11068", "tax": "1770.88", "other_taxes": null, "total": "12838.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLI-L-LISINA EN SOLUCIÓN", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3352", "subtotal": "10056", "tax": "1608.96", "other_taxes": null, "total": "11664.96" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROTUBO DE 1.5 ML TRANSPARENTE (TUBO TIPO EPENDORF) CAJA C/500", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "176", "subtotal": "176", "tax": "28.16", "other_taxes": null, "total": "204.16" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROTUBOS DE POLIPROPILENO CÓNICOS DE 1.5 ML DE TAPA PLANA PARA MICROCENTRÍFUGA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "176", "subtotal": "528", "tax": "84.48", "other_taxes": null, "total": "612.48" }, { "number": "0", "cucop_code": "25501-0089", "description": "MICROTUBOS PARA PCR DE 0.2 ML DE TAPA PLANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "527", "subtotal": "1054", "tax": "168.64", "other_taxes": null, "total": "1222.64" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS AZULES PARA PIPETA AUTOMATICA VOLUMEN 1000 µL (MICROLITROS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220", "subtotal": "1980", "tax": "316.8", "other_taxes": null, "total": "2296.8" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA DE 0.5 A 10 µL (BLANCAS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "219", "subtotal": "657", "tax": "105.12", "other_taxes": null, "total": "762.12" } ] }, { "id": "C-2023-00151608", "internal_reference": "INNN-DG-DA-SRM-424-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "SOLUCIONES MEDICAS DIGITALES URBA SA DE CV", "normalized_name": "SOLUCIONES MEDICAS DIGITALES URBA", "rfc_type": null, "slug": "soluciones-medicas-digitales-urba" }, "contract_period": { "published_at": "2023-11-28T01:45:20.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1952.64", "tax": "312.42", "total": "2265.06", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "AGAR DE MUELLER HINTON MEDIO DE CULTIVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1952.64", "subtotal": "1952.64", "tax": "312.42", "other_taxes": null, "total": "2265.06" } ] }, { "id": "C-2023-00151588", "internal_reference": "INNN-DG-DA-SRM-425-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "TECNOLOGIA MEDICA DIART SA DE CV", "normalized_name": "TECNOLOGIA MEDICA DIART", "rfc_type": null, "slug": "tecnologia-medica-diart" }, "contract_period": { "published_at": "2023-11-27T21:51:27.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "17325", "tax": "2772", "total": "20097", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0090", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO MEDIANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "105", "subtotal": "15750", "tax": "2520", "other_taxes": null, "total": "18270" }, { "number": "0", "cucop_code": "25501-0090", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTROS TAMAÑO CHICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "105", "subtotal": "1575", "tax": "252", "other_taxes": null, "total": "1827" } ] }, { "id": "C-2023-00151548", "internal_reference": "INNN-DG-DA-SRM-426-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "status": "PUBLICADO", "contractor": { "name": "TECROM SA DE CV", "normalized_name": "TECROM", "rfc_type": null, "slug": "tecrom" }, "contract_period": { "published_at": "2023-11-28T01:51:41.000Z", "starts_at": "2023-11-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "744806.9", "tax": "119169.11", "total": "863976.01", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO ACÉTICO GLACIAL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "342", "subtotal": "684", "tax": "109.44", "other_taxes": null, "total": "793.44" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO ASCÓRBICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1585", "subtotal": "1585", "tax": "253.6", "other_taxes": null, "total": "1838.6" }, { "number": "0", "cucop_code": "25101-0011", "description": "ACIDO CÍTRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "256", "subtotal": "256", "tax": "40.96", "other_taxes": null, "total": "296.96" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO FOSFOTUNGSTICOP ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3159", "subtotal": "3159", "tax": "505.44", "other_taxes": null, "total": "3664.44" }, { "number": "0", "cucop_code": "25101-0011", "description": "ÁCIDO NITRICO 70% GRADO REACTIVO,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "539", "subtotal": "539", "tax": "86.24", "other_taxes": null, "total": "625.24" }, { "number": "0", "cucop_code": "25101-0011", "description": "ACIDO PERYÓDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1125", "subtotal": "1125", "tax": "180", "other_taxes": null, "total": "1305" }, { "number": "0", "cucop_code": "25101-0063", "description": "AGUA BIDESTILADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "221", "subtotal": "11934", "tax": "1909.44", "other_taxes": null, "total": "13843.44" }, { "number": "0", "cucop_code": "25101-0062", "description": "AGUA DESIONIZADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "219.5", "subtotal": "21950", "tax": "3512", "other_taxes": null, "total": "25462" }, { "number": "0", "cucop_code": "25101-0037", "description": "LACOSAMIDA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "36258", "subtotal": "36258", "tax": "5801.28", "other_taxes": null, "total": "42059.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-ASCORBIC ACID", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1562", "subtotal": "1562", "tax": "249.92", "other_taxes": null, "total": "1811.92" }, { "number": "0", "cucop_code": "25101-0037", "description": "DETERGENTE ALCALINO CONCENTRADO (EXTRAN). FRASCO. 4 L.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "391", "subtotal": "1955", "tax": "312.8", "other_taxes": null, "total": "2267.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "DETERGENTE DESINFECTANTE NEUTRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "258", "subtotal": "516", "tax": "82.56", "other_taxes": null, "total": "598.56" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRAN NEUTRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "243", "subtotal": "2430", "tax": "388.8", "other_taxes": null, "total": "2818.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE DE TUBERIA Y UNIONES PARA CROMATOGRAFIA COMPATIBLE CON AGILENT Y PERKIN ELMER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12589", "subtotal": "12589", "tax": "2014.24", "other_taxes": null, "total": "14603.24" }, { "number": "0", "cucop_code": "25501-0090", "description": "COLUMNA, AGILENT, ZORBAX ECLIPSE XDB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12896", "subtotal": "25792", "tax": "4126.72", "other_taxes": null, "total": "29918.72" }, { "number": "0", "cucop_code": "25501-0090", "description": "COLUMNA, AGILENT, ZORBAX SB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "9987", "subtotal": "19974", "tax": "3195.84", "other_taxes": null, "total": "23169.84" }, { "number": "0", "cucop_code": "25501-0090", "description": "CONECTOR PARA TUBERÍA PEEK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1285", "subtotal": "1285", "tax": "205.6", "other_taxes": null, "total": "1490.6" }, { "number": "0", "cucop_code": "25501-0090", "description": "ECLIPSE PLUS C18, COLUMNA ANALÍTIA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12999", "subtotal": "25998", "tax": "4159.68", "other_taxes": null, "total": "30157.68" }, { "number": "0", "cucop_code": "25501-0090", "description": "PIPETAS SEROLOGICAS DE 10 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, CAJA CON 200,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1905", "subtotal": "15240", "tax": "2438.4", "other_taxes": null, "total": "17678.4" }, { "number": "0", "cucop_code": "25501-0090", "description": "TUBERÍA PEEK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1105", "subtotal": "1105", "tax": "176.8", "other_taxes": null, "total": "1281.8" }, { "number": "0", "cucop_code": "25501-0090", "description": "UNIDADES DE FILTRADO (FILTRO PIRINOLA) HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 13 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3698", "subtotal": "7396", "tax": "1183.36", "other_taxes": null, "total": "8579.36" }, { "number": "0", "cucop_code": "25501-0090", "description": "FILTRO DE JERINGA DIÁMETRO: 25 MM, TAMAÑO DEL PORO: 0,45 UM,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2979", "subtotal": "2979", "tax": "476.64", "other_taxes": null, "total": "3455.64" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLUCOSA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "296", "subtotal": "296", "tax": "47.36", "other_taxes": null, "total": "343.36" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICARBONATO DE SODIO GRADO ACS FRASCO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "261", "subtotal": "1044", "tax": "167.04", "other_taxes": null, "total": "1211.04" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO TRICLOROACÉTICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1709", "subtotal": "5127", "tax": "820.32", "other_taxes": null, "total": "5947.32" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBONATO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1559", "subtotal": "3118", "tax": "498.88", "other_taxes": null, "total": "3616.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETATO DE ZINC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1688.6", "subtotal": "16886", "tax": "2701.76", "other_taxes": null, "total": "19587.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE SODIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "459", "subtotal": "459", "tax": "73.44", "other_taxes": null, "total": "532.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO FERROSO AMONIACAL GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "568", "subtotal": "568", "tax": "90.88", "other_taxes": null, "total": "658.88" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERSULFATO DE AMONIO GRADO REACTIVO ACS =99.0%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "279", "subtotal": "558", "tax": "89.28", "other_taxes": null, "total": "647.28" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO NAH2PO4. H2O GRADO ACS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "299", "subtotal": "598", "tax": "95.68", "other_taxes": null, "total": "693.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "AZUL TRIPANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "510", "subtotal": "510", "tax": "81.6", "other_taxes": null, "total": "591.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "309", "subtotal": "1236", "tax": "197.76", "other_taxes": null, "total": "1433.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETILICO ABSOLUTO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "211", "subtotal": "1688", "tax": "270.08", "other_taxes": null, "total": "1958.08" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL ABSOLUTO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "585.4", "subtotal": "585.4", "tax": "93.66", "other_taxes": null, "total": "679.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÉTER ETÍLICO ANHIDRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2247.5", "subtotal": "4495", "tax": "719.2", "other_taxes": null, "total": "5214.2" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL GRADO HPLC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339", "subtotal": "3390", "tax": "542.4", "other_taxes": null, "total": "3932.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL GRADO HPLC. FCO. 4 L.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339", "subtotal": "4407", "tax": "705.12", "other_taxes": null, "total": "5112.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "139", "subtotal": "278", "tax": "44.48", "other_taxes": null, "total": "322.48" }, { "number": "0", "cucop_code": "25101-0037", "description": "XILOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3100.2", "subtotal": "24801.6", "tax": "3968.26", "other_taxes": null, "total": "28769.86" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO ACETICO (JT BAKER)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "489", "subtotal": "489", "tax": "78.24", "other_taxes": null, "total": "567.24" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO NITRICO 68-70% CONCENTRACION.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "469", "subtotal": "469", "tax": "75.04", "other_taxes": null, "total": "544.04" }, { "number": "0", "cucop_code": "25101-0063", "description": "AGUA BIDESTILADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "217", "subtotal": "2387", "tax": "381.92", "other_taxes": null, "total": "2768.92" }, { "number": "0", "cucop_code": "25101-0062", "description": "AGUA DESIONIZADA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "231", "subtotal": "231", "tax": "36.96", "other_taxes": null, "total": "267.96" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEXTROSA EN POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "298", "subtotal": "298", "tax": "47.68", "other_taxes": null, "total": "345.68" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEXTROSOL SOLUCION GLUCOSADA 75 G EN 250 ML. SE SUGIERE HYCEL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3206.4", "subtotal": "461721.6", "tax": "73875.46", "other_taxes": null, "total": "535597.06" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL ABSOLUTO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2873.1", "subtotal": "8619.3", "tax": "1379.09", "other_taxes": null, "total": "9998.39" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETANOL AL 96%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1170", "subtotal": "3510", "tax": "561.6", "other_taxes": null, "total": "4071.6" }, { "number": "0", "cucop_code": "25101-0037", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "186", "subtotal": "186", "tax": "29.76", "other_taxes": null, "total": "215.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "TINCION EA50 PARA PAPANICOLAOU LISTA PARA USARSE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "315", "subtotal": "315", "tax": "50.4", "other_taxes": null, "total": "365.4" }, { "number": "0", "cucop_code": "25101-0037", "description": "TINCION OG-6 PARA PAPANICOLAOU LISTA PARA USARSE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "225", "subtotal": "225", "tax": "36", "other_taxes": null, "total": "261" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "CONVOCATORIA", "filename": "CONVOCATORIA SUSTANCIAS VF 1 VERSION FINAL.docx", "availability": "available", "size_bytes": "903764", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2025-12-04T08:02:17.060Z", "updated_at": "2025-12-04T08:02:17.061Z" }, { "id": null, "annex_number": 2, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "ANEXO SUSTANCIAS REACTIVOS Y MAT LABORATORIO.docx", "availability": "available", "size_bytes": "368220", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2025-12-04T08:02:14.203Z", "updated_at": "2025-12-04T08:02:14.204Z" }, { "id": null, "annex_number": 3, "document_type": null, "description": "MODELO DE CONTRATO", "filename": "MODELO DE CONTRATO.docx", "availability": "available", "size_bytes": "52097", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2025-12-04T08:02:15.505Z", "updated_at": "2025-12-04T08:02:15.506Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "ACTA JUNTA DE ACLARACIONES", "filename": "Junta de aclaraciones I-8 Sustancias quimicas.pdf", "availability": "available", "size_bytes": "9956627", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:02:25.265Z", "updated_at": "2025-12-04T08:02:25.267Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FECHA Y HORA DE APERTURA DE PROPOSICIONES", "filename": "AVISO DE DIFERIMIENTO DE APERTURA DE PROPUESTAS Y ACTO DE FALLO SUSTANCIAS QUIMICAS.pdf", "availability": "available", "size_bytes": "499728", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:02:26.502Z", "updated_at": "2025-12-04T08:02:26.503Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "ACTA DE APERTURA DE PROPOSICIONES", "filename": "ACTA APERTURA DE PROPUESTAS SUSTANCIAS QUÍMICAS.pdf", "availability": "available", "size_bytes": "12103516", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:02:39.946Z", "updated_at": "2025-12-04T08:02:39.947Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "DIFERIMIENTO FALLO SUSTANCIAS.pdf", "availability": "available", "size_bytes": "510592", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:02:44.873Z", "updated_at": "2025-12-04T08:02:44.874Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "DIFERIMIENTO FALLO SUSTANCIAS 2.pdf", "availability": "available", "size_bytes": "899774", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:02:47.857Z", "updated_at": "2025-12-04T08:02:47.859Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "ACTA DIFERIMIENTO SUSTANCIAS 3.pdf", "availability": "available", "size_bytes": "890863", "mime_type": "application/pdf", "sha256": "b705f5986881d0f34bb245aade77587eb8446e6ff276dd5478870f90dd3aa966", "uploaded_at": "2025-12-04T08:02:50.473Z", "updated_at": "2026-08-06T03:24:07.450Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "ACTA DIFERIMIENTO SUSTANCIAS 3.pdf", "availability": "available", "size_bytes": "890863", "mime_type": "application/pdf", "sha256": "b705f5986881d0f34bb245aade77587eb8446e6ff276dd5478870f90dd3aa966", "uploaded_at": "2025-12-04T08:02:56.304Z", "updated_at": "2026-08-06T03:24:07.450Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "ACTA DE FALLO", "filename": "ACTA FALLO SUSTANCIAS VF.pdf", "availability": "available", "size_bytes": "7926854", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:03:06.090Z", "updated_at": "2025-12-04T08:03:06.091Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "ANEXOS ACTA DE FALLO", "filename": "ANEXOS SUSTANCIAS.pdf", "availability": "available", "size_bytes": "20214780", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:03:27.005Z", "updated_at": "2025-12-04T08:03:27.006Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "ANEXOS ACTA DE FALLO", "filename": "ANEXO 3.pdf", "availability": "available", "size_bytes": "17799050", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-04T08:03:35.045Z", "updated_at": "2025-12-04T08:03:35.046Z" }, { "id": null, "annex_number": 16, "document_type": null, "description": "ANEXOS ACTA DE FALLO", "filename": "Acta rectificación de fallo Sustancias.pdf", "availability": "available", "size_bytes": "2172814", "mime_type": "application/pdf", "sha256": "07c9086487f91e23478920d79624a9405ee63657e564e351729008d02de159aa", "uploaded_at": "2025-12-04T08:03:42.354Z", "updated_at": "2026-08-06T03:24:07.684Z" }, { "id": null, "annex_number": 17, "document_type": null, "description": "ACTA DE RECTIFICACION DE FALLO", "filename": "Acta rectificación de fallo Sustancias.pdf", "availability": "available", "size_bytes": "2172814", "mime_type": "application/pdf", "sha256": "07c9086487f91e23478920d79624a9405ee63657e564e351729008d02de159aa", "uploaded_at": "2025-12-04T08:03:44.648Z", "updated_at": "2026-08-06T03:24:07.684Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "la-51-gyn-051gyn052-t-39-2026", "nombre_procedimiento": "ADQUISICIÓN MATERIAL Y ACCESORIOS MÉDICOS MENORES DE REPOSICIÓN", "dependencia": "INSTITUTO DE SEGURIDAD Y SERVICIOS SOCIALES DE LOS TRABAJADORES DEL ESTADO", "siglas": "ISSSTE", "score": 0.06821632791854737 }, { "numero_procedimiento": "la-12-nck-012nck001-i-13-2026", "nombre_procedimiento": "INSUMOS DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO PARA LAS ÁREAS ADS. DM", "dependencia": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "siglas": "INNN", "score": 0.08833512927100406 }, { "numero_procedimiento": "la-08-b00-008b00001-i-187-2025", "nombre_procedimiento": "ADQUISICIÓN PRODUCTOS QUÍMICOS, MATERIALES Y SUMINISTROS DE LABORATORIO", "dependencia": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "siglas": "SENASICA", "score": 0.09166025022741509 }, { "numero_procedimiento": "la-12-nde-012nde001-i-174-2023", "nombre_procedimiento": "SUSTANCIAS QUÍMICAS, REACTIVOS ANALÍTICOS, MATERIALES DE CURACIÓN Y LABORATORIO.", "dependencia": "INPER", "siglas": "INPER", "score": 0.09172603761333298 }, { "numero_procedimiento": "la-76-t71-917038987-t-2-2024", "nombre_procedimiento": "30072024002", "dependencia": "HNM", "siglas": "HNM", "score": 0.09180647134780884 }, { "numero_procedimiento": "la-12-nck-012nck001-i-45-2026", "nombre_procedimiento": "SEGUNDO PROCEDIMIENTO PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DI", "dependencia": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "siglas": "INNN", "score": 0.09181820799003626 } ] }