{ "html_url": "https://licitia.com.mx/licitacion/la-12-ndy-012ndy002-n-46-2023", "canonical": "https://licitia.com.mx/licitacion/la-12-ndy-012ndy002-n-46-2023", "id": "bd401a86e0e74982ae89feac087f6f32", "procedure_number": "LA-12-NDY-012NDY002-N-46-2023", "file_number": "E-2023-00071904", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "description": { "short": "No existen bienes alternativos o sustitutos, Único Oferente, Derechos exclusivos (patentes, licencias, derechos de autor u otros derechos exclusivos), o por obras de arte.", "detailed": "ADQUISICIÓN DE MATERIALES ACCESORIOS Y SUMINISTROS MÉDICOS Y LABORATORIO" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO PARCIAL", "moved_at": null }, "buyer": { "agency": "INSP", "acronym": "INSP", "branch": "12 - SALUD", "buying_unit": "DEPARTAMENTO DE ABASTECIMIENTO", "requesting_unit": "unidad requiriente data", "requesting_group": "DEPARTAMENTO DE ABASTECIMIENTO", "entity": "INSTITUTO NACIONAL DE SALUD PÚBLICA", "slug": "insp", "unit_slug": "departamento-de-abastecimiento-012ndy002" }, "classification": { "procedure_type": "LICITACIÓN PÚBLICA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2023, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "1", "exception_basis": "Art. 41 fr. I", "internal_control_number": "DA-EXINSP-025", "supply_source_number": null }, "schedule": { "published_at": "2023-08-22T15:22:35.000Z", "clarification_meeting_at": "2023-08-25T16:00:00.000Z", "clarification_questions_deadline_at": "2023-08-24T16:00:00.000Z", "clarification_responses_deadline_at": null, "bid_opening_at": "2023-09-01T22:00:00.000Z", "award_at": "2023-09-11T17:00:00.000Z", "estimated_contract_at": "2023-09-12T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25401-7660", "specific_item_code": "25401", "cucop_description": "080.830.3234 REACTIVOS QUIMICOS ACETONA. ACS. FRASCO CON 1000 ML. TA.", "description": "ACETONA. GALÓN\nGALON 4LTS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25401-6722", "specific_item_code": "25401", "cucop_description": "080.783.1573 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECIFICAS. ACIDO ACETICO AL 5%. FRASCO CON 500 ML. TA.", "description": "ÁCIDO ACÉTICOL, SOLUCIÓN AL 5% MÁXIMO V/V\nÁCIDO ACÉTICO 5%: BOTELLA CON 500 ML", "requested_quantity": "25", "minimum_quantity": "25", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "AGAR ENTÉRICO HEKTOEN PARA EL AISLAMIENTO Y DIFERENCIACIÓN DE BACTERIAS ENTÉRICAS GRAM NEGATIVAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25901-0018", "specific_item_code": "25901", "cucop_description": "AGAR MACCONKEY", "description": "AGAR MAC CONKEY MEDIOS DE CULTIVO BACTERIANO MCCONKEY PARA CULTIVOS BACTERIANOS", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25901-0019", "specific_item_code": "25901", "cucop_description": "AGAR MANITOL SALADO", "description": "AGAR MUELLER HINTON MEDIOS DE CULTIVO BACTERIANO MULLER HINTON PARA CULTIVOS BACTERIANOS. AJUSTADO CON CATIONES", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "AGAR MUELLER HINTON MEDIOS DE CULTIVO BACTERIANO MULLER HINTON PARA CULTIVOS BACTERIANOS. NO AJUSTADO CON CATIONES", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "AGAR SOYA TRIPTICASA (TSA) MEDIO NUTRITIVO GENERAL PARA EL CRECIMIENTO Y AISLAMIENTO DE BACTERIAS AERÓBICAS Y ANAERÓBICAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "AGAROSA GRADO BIOLOGIA MOLECULAR POLÍMERO DE SUBUNIDADES DE AGAROBIOSA (L- Y D-GALACTOSA). SE EXPLOTA PARA LA SEPARACIÓN DE ÁCIDOS NUCLEICOS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25401-7828", "specific_item_code": "25401", "cucop_description": "080.831.0163 REACTIVOS QUIMICOS AGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "description": "AGAROSA PARA ELECTROFORESIS\nAGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25101-0062", "specific_item_code": "25101", "cucop_description": "AGUA DESIONIZADA", "description": "AGUA DESTILADA, FRASCO CON 1 L\nAGUA DESTILADA, FRASCO CON 1 L", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25401-0020", "specific_item_code": "25401", "cucop_description": "AGUJA PARA BIOPSIA", "description": "AGUJA DE VACUTAINER\nAGUJA DE VACUTAINER ECLIPSE VERDES", "requested_quantity": "300", "minimum_quantity": "300", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25401-0014", "specific_item_code": "25401", "cucop_description": "AGUJA DENTAL", "description": "AGUJAS DENTALES TIPO CARPULE, CALIBRE 27G LARGA\nAGUJA DENTALES TIPO CARPULE, CALIBRE 27G LARGA, CAJA CON 100 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25401-0015", "specific_item_code": "25401", "cucop_description": "AGUJA HIPODERMICA", "description": "AGUJAS HIPODÉRMICAS PARA TOMA MÚLTIPLE CALIBRE 21.\nAGUJAS HIPODÉRMICAS PARA TOMA MÚLTIPLE CALIBRE 21 COLOR VERDE 21G X 1.5 \" (0.8 X 38 MM). PRESICIÓN GLIDE CAJA CON 100", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25401-0600", "specific_item_code": "25401", "cucop_description": "ALCOHOL", "description": "ALCOHOL 90%: BOTELLA CON 1000 ML\nALCOHOL 90%: BOTELLA CON 1000 ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25401-4561", "specific_item_code": "25401", "cucop_description": "060.066.1052 ANTISEPTICOS. SOLUCION CON GLUCONATO DE CLORHEXIDINA AL 2% P/V EN ALCOHOL ISOPROPILICO AL 70%. CON TINTA NARANJA O ROSA O INCOLORO. CONTIENE: 3 ML ESTERIL Y DESECHABLE ENVASE", "description": "ALCOHOL AL 70%. PRESENTACIÓN DE 1 GALÓN\nALCOHOL ETILICO AL 70%. PRESENTACIÓN DE 1 GALÓN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "GALON", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25401-0600", "specific_item_code": "25401", "cucop_description": "ALCOHOL", "description": "ALCOHOL ETÍLICO AL 96%\nALCOHOL ETÍLICO AL 96% V/V, CONTENEDOR DE 20 L. PARA USO EN LABORATORIO Y LA INDUSTRIA EN GENERAL, LÍQUIDO INCOLORO, SOLUBLE EN AGUA A 20ºC.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25401-0600", "specific_item_code": "25401", "cucop_description": "ALCOHOL", "description": "ALCOHOL ETILICO DEL 96°\nALCOHOL ETILICO DEL 96° PRESENTACIÓN DE 1 LT", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25401-7538", "specific_item_code": "25401", "cucop_description": "080.829.4342 REACTIVOS QUIMICOS ALCOHOL ETILICO CON 96 ° GL. TECNICO. ENVASE CON 18 LITROS. TA.", "description": "ALCOHOL ETÍLICO DEL 96°\nALCOHOL ETILICO CON 96 ° GL. TÉCNICO. ENVASE CON 18 LITROS. TA.", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25401-7493", "specific_item_code": "25401", "cucop_description": "080.829.3575 REACTIVOS QUIMICOS. ALCOHOL ETILICO DE 96 °G.L. TECNICO. FRASCO CON 1000 ML. TA.", "description": "ALCOHOL ETÍLICO DEL 96°\nALCOHOL ETÍLICO DEL 96°", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25101-0004", "specific_item_code": "25101", "cucop_description": "ALCOHOLES AROMATICOS Y FENOLES (COMPUESTOS AROMATICOS)", "description": "ALCOHOL ETILICO DESNATURALIZADO.\nALCOHOL ETILICO DESNATURALIZADO DE 96 GRADOS, GARRAFÓN DE 20 LITROS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25401-7723", "specific_item_code": "25401", "cucop_description": "080.830.4661 REACTIVOS QUIMICOS. ALCOHOL ISOPROPILICO. RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ALCOHOL ISOPROPILICO\nALCOHOL ISOPROPILICO. RA. ACS. FRASCO CON 1000 ML. TA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25401-0505", "specific_item_code": "25401", "cucop_description": "TORUNDA ALGODON", "description": "ALGODÓN (BOLSA GRANDE DE TORUNDAS), DE 500 GR\nTORUNDA BOLITA DE ALGODÓN NO ESTERILIZADO 100% ALGODÓN 500G, MATERIAL DE CURACIÓN", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AMARILLAS CAP. 1 A 200 MICROLITOS\nPUNTAS PARA MICROPIPETAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25301-3534", "specific_item_code": "25301", "cucop_description": "010.000.6279.00 AZITROMICINA", "description": "AZITROMICINA\nAZITROMICINA SAL. POTENCIA: =98%.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25401-0161", "specific_item_code": "25401", "cucop_description": "CURITAS", "description": "BANDAS ADHESIVAS REDONDAS.\nBANDAS ADHESIVAS REDONDAS CON APÓSITO ESPONJOSO, (REDONDOS), 2.2 CM X 2.2 CM, CURAS REDODONDO IMPERMEABLES.", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25401-0051", "specific_item_code": "25401", "cucop_description": "BICARBONATO DE SODIO (POLVO)", "description": "BICARBONATO DE SODIO SOLUCIÓN FRASCO 10 ML\nBICARBONATO DE SODIO SOLUCIÓN: FRASCO 10 ML", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25401-4573", "specific_item_code": "25401", "cucop_description": "060.125.3230 BOLSAS. PARA USO GENERAL DE POLIETILENO. BIODEGRADABLE. CALIBRE ENTRE 150-200. PARA LA RECOLECCION Y DESECHOS DE RESIDUOS NO RPBI. MEDIDAS: 60 X 80 CM. ENVASE CON 100 PIEZAS.", "description": "BOLSAS DE POLIETILENO COLOR ROJO PARA RPBI CON MEDIDAS DE 60 X 80 CENTÍMETROS.\nBOLSAS DE POLIETILENO COLOR ROJO PARA RPBI CON MEDIDAS DE 60 X 80 CENTÍMETROS, PARA LA RECOLECCIÓN DE RESIDUOS BIOLÓGICO INFECCIOSO.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25401-7837", "specific_item_code": "25401", "cucop_description": "080.831.3241 REACTIVOS QUIMICOS BROMURO DE ETIDIO (BROMURO DE 7-DIAMINO-10-ETIL-9-FENIL-FENENTRIDINIO). GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 G. TA.", "description": "BROMURO DE ETIDIO\nBROMURO DE ETIDIO (BROMURO DE 7-DIAMINO-10-ETIL-9-FENIL-FENENTRIDINIO). GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 G. TA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25501-0130", "specific_item_code": "25501", "cucop_description": "BULBO DE LATEX", "description": "BULBO DE LATEX PARA PIPETA PASTEUR DE 2ML 52X13X6 MN\nBULBO DE LATEX PARA PIPETA PASTEUR DE 2ML 52X13X6 MN", "requested_quantity": "209", "minimum_quantity": "209", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "CAJAS DE CARTON PARA ALMACENAR MUESTRAS\nCAJA DE CARTÓN PLASTIFICADO, PARA ALMACENAMIENTO, COLOR BLANCO, PARA USO EN ULTRACONGELADOR (-80°), CON DIVISIONES DE 7X7 ESPACIOS, DIMENSIONES: 13X13X8 CM, PARA ALMACENAR CRIOTUBOS DE 7 ML", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "CAJAS DE CARTON PARA ALMACENAR MUESTRAS\nCAJA DE CARTÓN PLASTIFICADO, PARA ALMACENAMIENTO, COLOR BLANCO, PARA USO EN ULTRACONGELADOR (-80°), DE 9X9 ESPACIOS, DIMENSIONES: 13X13X5 CM, CRIOTUBOS DE 2 ML", "requested_quantity": "250", "minimum_quantity": "250", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25501-0091", "specific_item_code": "25501", "cucop_description": "MATERIAL DE MADERA PARA USO EN LABORATORIO DE MEDICION", "description": "CAJON DE MADERA PARA MEDICIÓN DE RODILLA.\nCAJON DE MADERA DE TRIPLAY O MADERA COMPRIMIDA PARA MEDICIÓN DE RODILLA , CON UNA ALTURA DE (10 CM ), ANCHO (10 CM) Y LARGO DE (25CM), CAJA CON 5 BISAGRAS PARA PODER DOBLAR.", "requested_quantity": "22", "minimum_quantity": "22", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "CALDO SOYA TRIPTICASA (TSB)\nMEDIO NUTRITIVO GENERAL PARA EL CRECIMIENTO Y AISLAMIENTO DE BACTERIAS AERÓBICAS Y ANAERÓBICAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25401-7475", "specific_item_code": "25401", "cucop_description": "080.829.2346 MEDIOS DE CULTIVO CALDOS. CALDO UREA PARA DIFERENCIAR E IDENTIFICAR ENTEROBACTERIAS. FRASCO CON 450 G. TA.", "description": "CALDO UREA PARA DIFERENCIAR E IDENTIFICAR ENTEROBACTERIAS. FRASCO CON 450 G. TA.\nCALDO UREA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25401-7573", "specific_item_code": "25401", "cucop_description": "080.830.0289 REACTIVOS QUIMICOS. CARBON VEGETAL O CARBON ACTIVADO. FRASCO CON 250 G. TA.", "description": "CARBÓN VEGETAL O CARBÓN ACTIVADO\nCARBÓN VEGETAL O CARBÓN ACTIVADO. FRASCO CON 250 G. TA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "CASSET DE DIÁLISIS\nSLIDE-A-LYZER™ G3 DIALYSIS CASSETTES, 10K MWCO.10 CASSETTES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25301-0454", "specific_item_code": "25301", "cucop_description": "010.000.1935.00 CEFOTAXIMA SOLUCION INYECTABLE 1 G/4 ML FRASCO AMPULA Y 4 ML DE DILUYENTE", "description": "CEFOTAXIMA/ÁCIDO CLAVULANICO 30/10 ¿G\nDISCOS DE 6 MM PREPARADOS MEDIANTE IMPREGNACIÓN DE PAPEL ABSORBENTE DE ALTA CALIDAD CON CANTIDADES PRECISAS DE ANTIBIÓTICOS U OTROS AGENTES QUIMIOTERAPÉUTICOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25301-0459", "specific_item_code": "25301", "cucop_description": "010.000.4254.00 CEFTAZIDIMA SOLUCION INYECTABLE 1 G/3 ML FRASCO AMPULA Y 3 ML DE DILUYENTE", "description": "CEFTAZIDIMA/ÁCIDO CLAVULANICO 30/10 ¿G\nDISCOS DE 6 MM PREPARADOS MEDIANTE IMPREGNACIÓN DE PAPEL ABSORBENTE DE ALTA CALIDAD CON CANTIDADES PRECISAS DE ANTIBIÓTICOS U OTROS AGENTES QUIMIOTERAPÉUTICOS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25401-0120", "specific_item_code": "25401", "cucop_description": "CINTA TESTIGO PARA ESTERILIZACION", "description": "CINTA TESTIGO\nCINTA ADHESIVA TESTIGO PARA ESTÉRILIZAR EN VAPOR. DIMENSIONES 19MM X 50 M.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "CLOROFORM GRADO BIOLOGÍA MOLECULAR\nTHERMOSCIENTIFIC, CODIGO 15408689", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25401-7372", "specific_item_code": "25401", "cucop_description": "080.829.0589 REACTIVOS QUIMICOS CLOROFORMO. RA. ACS. FRASCO CON 2500 ML.", "description": "CLOROFORMO\nCLOROFORMO. RA. ACS. FRASCO CON 2500 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25101-0061", "specific_item_code": "25101", "cucop_description": "CLORURO DE POTASIO", "description": "CLORURO DE POTASIO\nCLORURO DE POTASIO CAT. P3911-1KG", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25301-0571", "specific_item_code": "25301", "cucop_description": "010.000.3634.00 CLORURO DE SODIO AL 0.9% SOLUCION INYECTABLE NACL 900 MG / 100 ML ENVASE CON 100 ML Y ADAPTADOR PARA VIAL", "description": "CLORURO DE SODIO\nCLORURO DE SODIO CAT. S9888", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "CRIOVIALES SAFESEAL MICROTUBE 2ML\nCRIOVIALES SAFESEAL MICROTUBE 2ML , PP (BOLSAS DE 250)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "CRISTAL VIOLETA\nCRISTAL VIOLETA CON UNA SOLUBILIDAD EN AGUA DE 1 MG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25401-0599", "specific_item_code": "25401", "cucop_description": "TIRAS REACTIVAS", "description": "MICROCUBETA PARA LA DETERMINACIÓN DE HEMOGLOBINA\nMICROCUBETA PARA LA DETERMINACIÓN DE HEMOGLOBINA TOTAL, VIAL CON 50 MICROCUBETAS COMPATIBLES CON EL ANALIZADOR HB 201.", "requested_quantity": "85", "minimum_quantity": "85", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25401-0149", "specific_item_code": "25401", "cucop_description": "CUBRE BOCA", "description": "CUBREBOCAS KN95\nCUBREBOCAS KN95, CON PUENTE NASAL METÁLICO Y FLEXIBLE EXTERIOR, DISEÑO MULTICAPA FINO Y LIGERO. ALTA CAPACIDAD DE FILTRADO .", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25401-0149", "specific_item_code": "25401", "cucop_description": "CUBRE BOCA", "description": "CUBREBOCAS TRIPLE CAPA\nCUBREBOCAS TRIPLE CAPA, PLISADO CON AJUSTE NASAL, 50 PIEZAS", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "DE 4 PULGADAS X 125 FT 10CMX38MT\nPARAFILM. ROLLO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "DEPC\nEL DIETILO PIROCARBONATO (DEPC) MODIFICA LOS RESIDUOS DE HISTIDINA DE LAS PROTEÍNAS Y PROVOCA LA INACTIVACIÓN DE MUCHAS ENZIMAS. EN BIOLOGÍA MOLECULAR SE UTILIZA PRINCIPALMENTE COMO UN INHIBIDOR FUERTE, PERO NO ABSOLUTO, DE LA ACTIVIDAD DE LA RNASA.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25401-7865", "specific_item_code": "25401", "cucop_description": "080.832.0147 REACTIVOS QUIMICOS DEXTRAN PESO MOLECULAR APROXIMADO DE 500000. GRADO INDUSTRIAL. 2 FRASCO CON 500 G. TA.", "description": "DEXTRAN PESO MOLECULAR\nDEXTRAN PESO MOLECULAR APROXIMADO DE 500000. GRADO INDUSTRIAL. 2 FRASCO CON 500 G. TA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "DIETYL MALEATE. (DEM) DIETIL MALEATO.\nPM 172.18, ESTÁNDAR ANALÍTICO =90% PUREZA.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "DIMETIL SULFOXIDO\nDIMETHYL SULFOXIDE FOR MOLECULAR BIOLOGY 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25401-4613", "specific_item_code": "25401", "cucop_description": "060.833.0254 SOLUCIONES. SALINA BALANCEADA NORMAL PARA IRRIGACION OFTALMICA. ENVASE CON 500 ML.", "description": "DISOLUCIÓN AMORTIGUADORA O TAMPÓN PH 2 500ML\nDISOLUCIÓN AMORTIGUADORA O TAMPÓN PH 2 CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL. BOTELLA DE 500 ML. CADUCIDAD MÍNIMA DE 12 MESES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "DISPENSADOR PARA DOS BOTELLAS 5-50ML\nDISPENSADOR PARA 2 BOTELLAS 5-50 ML. RESISTENTE A ÁCIDOS. ADAPTADORES: GL 32, GL 38, S 40. CATÁLOGO: EP4966000053", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25401-7929", "specific_item_code": "25401", "cucop_description": "080.832.4149 SUSTANCIA BIOLOGICAS DNA POLIMERASA DE THERMUS AQUATICUS. (TAQ-POLIMERASA) RECOMBINANTE. GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 UNIDADES/MICROLITRO. C (-20 °C 0 °C).", "description": "DNA POLYMERASE\nDNA POLYMERASE DNA POLIMERASA DE THERMUS AQUATICUS. (TAQ-POLIMERASA) RECOMBINANTE. GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 UNIDADES/MICROLITRO. C (-20 °C 0 °C).", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA PREP, (M) TAGMENTATION\nDNA PREP, (M) TAGMENTATION (96 SAMPLES) CAT. 20060059\nKIT CON 3 CAJAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA/RNA UD INDEXES SET A, TAGMENTATION\nDNA/RNA UD INDEXES SET A, TAGMENTATION (96 INDEXES, 96 SAMPLES) CAT. 20027213 \nCAJA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DNA/RNA UD INDEXES SET B, TAGMENTATION\nDNA/RNA UD INDEXES SET B, TAGMENTATION (96 INDEXES, 96 SAMPLES) CAT. 20027214\nCAJA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "DNTP MIX 10MM EACH 2.0ML\nCONJUNTO DE DNTP (100 MM)100 MM (DE CADA UNO) DE DATP, DCTP, DGTP Y DTTP.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "DNTP MIX 10MM EACH 2.0ML\nCONJUNTO DE DNTP (100 MM)100 MM (DE CADA UNO) DE DATP, DCTP, DGTP Y DTTP.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "DTNB 5-5 DITIO-BIS, 2 ACIDO NITROBENZOICO. 99% PUREZA FRASCO 10 GR\nFRASCO CON 10 GR. 99 % PUREZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25401-4592", "specific_item_code": "25401", "cucop_description": "060.435.0017 GEL. GEL ORAL PARA ENJUAGUE BUCAL COMPUESTO A BASE DE HIALURONATO DE SODIO AL 0.1% Y POLIVINILPIRROLIDONA AL 9.0%. COADYUVANTE EN EL TRATAMIENTO DE LESIONES DE LA CAVIDAD BUCOFARINGEA. SOBRE CON 15 ML.", "description": "ENJUAGUE BUCAL\nENJUAGUE BUCAL SCOPE DE 1.5 L", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ENZIMA\nDNASA 1, 1000U (1U/UL) THERMOSCIENTIFIC", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ENZIMA DE RESTRICCIÓN SFII 1000 UNIDADES\nENZIMA DE RESTRICCIÓN SFII 1000 UNIDADES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25401-7599", "specific_item_code": "25401", "cucop_description": "080.830.0941 REACTIVOS QUIMICOS EOSINA AMARILLA Y. QP. FRASCO CON 10 G. TA.", "description": "EOSINA AMARILLENTA FRASCO 25 G COLORANTE\nEOSINA AMARILLENTA FRASCO 25 G COLORANTE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ESTANDAR ANALÍTICO =90% PUREZA. PM 338.44. FRASCO DE 100 ML\nPIPERONYL BUTOXIDE. (PBO) BUTOXIDO DE PIPERONILO.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ESTANDARES PARA NANOPARTICULAS N8151035\nESTÁNDARES. PARA NANOPARTÍCULAS N 8151035", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "ESTANDARES PARA NANOPARTICULAS N8151036\nESTÁNDARES. PARA NANOPARTÍCULAS N 8151036", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ETANOL\nETHYL ALCOHOL, PURE 190 PROOF FOR MOLECULAR BIOLOGY ( ETANOL ULTRAPURO O GRADO MOLECULAR)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25401-7721", "specific_item_code": "25401", "cucop_description": "080.830.4646 REACTIVOS QUIMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ETANOL 96% FRASCO CON 1 L\nETANOL 96% FRASCO CON 1 L", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25101-0051", "specific_item_code": "25101", "cucop_description": "ETHER", "description": "ETER\nETER ETÍLICO ANHIDRO REACTIVO PRESENTACIÓN DE 1 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25401-0549", "specific_item_code": "25401", "cucop_description": "ADHESIVOS MEDICOS", "description": "ETIQUETAS DE VINILO AUTOLAMINABLE CON NÚCLEO DE 3\"\nETIQUETAS ENVOLVENTES AUTOLAMINABLES DE VINILO PARA IMPRESORAS CON NÚCLEO DE 3\" - 2.625\" X 1 CAT. THT-131-427-3", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "EXTRACTO DE LEVADURA\nINGREDIENTE PARA MEDIO DE CULTIVO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FENILEFRINA 10%\nFENILEFRINA 10%, SOLUCIÓN OFTÁLMICA ESTÉRIL, FRASCO GOTERO DE 5 ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25401-0364", "specific_item_code": "25401", "cucop_description": "PINZA DE SUJECION DESECHABLE", "description": "FORCEPS DENTADO EN FORMA DE COLIBRI DE 0.1 MM\nFORCEPS DENTADO EN FORMA DE COLIBRI DE 0.1 MM", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "FOSFATO DE POTASIO MONOBÁSICO.\nFRASCO 500 GRS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "FOSFATO DE POTASIO. DIBASICO., ANHIDRO, GRANULAR, A.C.S.\nFRASCO DE 500G,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "FOSFATO DE SODIO MONOBASICO. FRASCO -500 GRAMOS\nFRACO CON 500 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25401-0230", "specific_item_code": "25401", "cucop_description": "GASA ESTERILIZADA", "description": "GASA DE ALGODÓN\nGASA DE ALGODÓN 100%, ESTÉRIL, DIMENSIONES: 10 X 10 CM. PAQUETE CON 100 GASAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25401-0230", "specific_item_code": "25401", "cucop_description": "GASA ESTERILIZADA", "description": "GASA DE ALGODÓN, NO ESTÉRIL, 7.5 X 5 CM.\nGASA DE ALGODÓN, NO ESTÉRIL 7.5 X 5 CM, CAJA CON 200 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25501-0078", "specific_item_code": "25501", "cucop_description": "GEL REFRIGERANTE", "description": "GEL REFRIGERANTE TAMAÑO MEDIA CARTA\nGEL REFRIGERANTE 100 GRAMOS, CADA BOLSA MIDE\nLARGO 13 CM X ANCHO 11 CM.", "requested_quantity": "105", "minimum_quantity": "105", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25101-0052", "specific_item_code": "25101", "cucop_description": "GLICERINA", "description": "GLICEROL\nGLICEROL GRADO REACTIVO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO CHICO 100\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO CHICO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO (G)\nGUANTE PARA EXPLORACIÓN, LIBRE DE LÁTEX Y POLVO LUBRICANTE, NO ESTÉRIL, DE NITRILO SINTÉTICO, ACABADO TEXTURIZADO EN YEMA DE LOS DEDOS PARA UN MEJOR AGARRE, LIBRE DE PROTEÍNAS PROVENINETES DE LATEX, AMBIDIESTRO, COLOR AZUL Y TALLA GRANDE", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO GRANDES\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO GRANDE", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO PARA EXPLORACIÓN, TALLA CHICA\nGUANTES DE NITRILO PARA EXPLORACIÓN, TEXTURIZADOS, NO ESTÉRILES, SIN POLVO, TALLA CHICA.", "requested_quantity": "23", "minimum_quantity": "23", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO PARA EXPLORACIÓN, TALLA MEDIANA\nGUANTES DE NITRILO PARA EXPLORACIÓN, TEXTURIZADOS, NO ESTÉRILES, SIN POLVO, TALLA MEDIANA.", "requested_quantity": "33", "minimum_quantity": "33", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DE NITRILO T.MEDIANO LIBRES POL\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO MEDINO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO CHICO.\nGUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO CHICO, LUBRICADO CON POLVO ABSORBENTE", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO MEDIANO.\nGUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO MEDIANO, LUBRICADO CON POLVO ABSORBENTE", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25401-0242", "specific_item_code": "25401", "cucop_description": "GUANTE PARA CIRUJANO", "description": "GUANTES PARA EXPLORACIÓN\nGUANTES PARA EXPLORACIÓN", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25401-6100", "specific_item_code": "25401", "cucop_description": "080.229.2995 REACTIVOS QUIMICOS HEMATOXILINA DE HARRIS. COLORANTE PREPARADO DE ORIGEN NATURAL SIN OXIDO DE MERCURIO. FRASCO DE 1000 ML. TA.", "description": "HEMATOXILINA DE HARRIS. FRASCO 500 ML\nHEMATOXILINA DE HARRIS. FRASCO 500 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25901-0009", "specific_item_code": "25901", "cucop_description": "HIPOCLORITO", "description": "HIPOCLORITO G\nGARRAFA DE 20LTS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25401-0040", "specific_item_code": "25401", "cucop_description": "APLICADOR DE MADERA (SIN ALGODON)", "description": "HISOPO DE PLÁSTICO CON DACRÓN\nHISOPO CON DRACÓN, PUNTO DE RUPTURA 2.5 CM, ESTERIL EMPAQUE INDIVIDUAL, PARA TOMA DE MUESTRA ANAL, 6\" (15CM), ASA DE PLÁSTICO, PAQUETE CON 100 PZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "INFUNCION DE HIGADO\nLIVER INFUSION BROTH F", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "INHIBIDOR\nRIBOLOCKTM RNASE INHIBITOR, THERMOSCIENTIFIC 40U /UL INHIBIDOR DE RNASAS 2500 UNITS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "INHIBIDOR DE RNASAS\nPOLIPÉPTIDO DE 51KDA QUE SE COMPLEJA ESTABLEMENTE CON ALTA AFINIDAD A RNASAS, BLOQUEANDO SU ACTIVIDAD. RECOMENDADO PARA SER UTILIZADO EN PURIFICACIONES DE ARN, SÍNTESIS DE ADNC Y TRANSCRIPCIÓN IN VITRO.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ISOPROPANOL\n2-PROPONOL, ISOPROPANOL PURO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25401-0290", "specific_item_code": "25401", "cucop_description": "JABON QUIRURGICO", "description": "JABÓN QUIRURGICO DE 3.8 LITROS\nJABÓN QUIRURGICO DE 3.8 LITROS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25401-0294", "specific_item_code": "25401", "cucop_description": "JERINGA", "description": "JERINGA 1 ML C/AGUJA MONTADA\nJERINGA 1 ML C/AGUJA MONTADA CAJA C/100", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25401-0294", "specific_item_code": "25401", "cucop_description": "JERINGA", "description": "JERINGA CON AGUJA (3 ML)\nJERINGAS ESTERILES DE PLÁSTICO CON AGUJA Y PIVOTE TIPO LUER-LOCK CON ESCALA GRADUADA A 3 ML PAQUETE CON 100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25901-0012", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA LIQUIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE LEAD CARE CON 48 PRUEBAS.\nKIT DE LEAD CARE CON 48 PRUEBAS PARA ANALIZAR PLOMO EN SANGRE", "requested_quantity": "34", "minimum_quantity": "34", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE PURIFICACION DE RNA\nKIT DE EXTRACCION DE RNA TOTAL BACTERIANO , ESTE KIT YA ESTA PROBADO Y ESTANDARIZADO PARA LA EXTRACCION DE RNA DE CEPAS BACTERIANAS DEL GENERO KLEBSIELLA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE PURIFICACIÓN RNA\nTOTAL RNA PURIF ICATION", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT DE PURIFICAIÓN DE PCR\nPCR CLEAN-UP MINI KIT (50 PREPS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "KIT PARA CLONAR PLASMIDOS\nKIT TOPO™ TA CLONING™ PARA SUBCLONACIÓN, SIN CÉLULAS COMPETENTES, 10 RXNS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25401-6297", "specific_item_code": "25401", "cucop_description": "080.574.0032 LANCETAS LANCETA DE RETRACCION AUTOMATICA Y PERMANENTE. INCISION DE 1.8 A 2.0 MM INTEGRADA A UN DISPARADOR DE PLASTICO; CON DISPOSITIVO PLASTICO REMOVIBLE QUE ASEGURE LA ESTERILIDAD. ESTERIL Y DESECHABLE. CAJA CON 100 Y SUS MULTIPLOS.", "description": "LANCETA DE ALTO FLUJO.\nLANCETA DE ALTO FLUJO , PROFUNDIDAD DE 1.6, SUPER LAMINA DE APROX DE 1.50 MM DE LARGURA.", "requested_quantity": "13", "minimum_quantity": "13", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "L-GLUTATIÓN REDUCIDO\n98 POR CIENTO.FRASCO 5 GRAMOS. =90% PUREZA. PM 307.32", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "LISOZIMA\nENZIMA EN POLVO CON 250 MG", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25401-6174", "specific_item_code": "25401", "cucop_description": "080.382.0109 ESCOBILLONES DE CERDAS PARA LAVAR TUBOS DE ENSAYE Y FRASCOS CON LONGITUD DE 12.5 CM Y LONGITUD TOTAL 27.5 CM. DIAMETRO. 5.0 CM.", "description": "LONGITUD TOTAL 40CM. D ECRDAS 16CM\nESCOBILLÓN DE CERDAS PARA FRASCOS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADOR\nACCURULLER 100BP DNA LADDERS 50?G / 500?L (>150 LOADINGS)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25501-0067", "specific_item_code": "25501", "cucop_description": "MARCADOR DE PESO MOLECULAR", "description": "MARCADOR DE PESO MOLECULAR\n100 PARES DE BASES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADOR DE PESO MOLECULAR\nMARCADOR DE PESO MOLECULAR PRETEÑIDO PARA PROTEÍNAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADOR DE PESO MOLECULAR DNA LADDER.\nMARCADOR DE 11 FRAGMENTOS, DESDE 100PB HASTA 1,000PB, CON INCREMENTOS DE 100PB, Y UNA BANDA ADICIONAL DE 1,500PB. PRESENTA UNA BANDA DE ALTA INTENSIDAD A 500PB. NO ESTÁ DISEÑADO PARA ANÁLISIS CUANTITATIVOS. INCLUYE: MARCADOR DE 100PB DNA LADDER Y 'BUFFER DE CARGA BLUE/ORANGE 6X. PRESENTACIÓN: 250 ¿L.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MARCADOR DE PESO MOLECULAR PARA PFGE\nPAQUETE CON 2 JERINGAS. RANGOS 48.5-1,018 KB. EMBEBIDO EN AGAROSA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MEDIOS DE CULTIVO BACTERIANO LB\nMEDIO DE CULTIVO LURIA BERRTANI EN POLVO PARA MEDIOS DE CULTIVO LÍQUUIDOS DE 1 KG", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "MEDIOS DE CULTIVO BACTERIANO LB CON AGAR\nMEDIO DE CULTIVO LURIA BERRTANI EN POLVO CON AGAR PARA MEDIOS DE CULTIVO SOLIDOS DE 500 G", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25401-7038", "specific_item_code": "25401", "cucop_description": "080.784.8148 PRUEBA RAPIDA PARA DETECTAR RUPTURA PREMATURA DE MEMBRANAS FETALES 1 KIT CONTIENE: 1 TIRA REACTIVA (DISPOSITIVO DE FLUJO LATERAL \"\"TIRA REACTIVA ) CON ANTICUERPOS MONOCLONALES. 1 VIAL PLASTICO CON SOLUCION DISOLVENTE. LA SOLUCION DISOLVENTE CONTIENE: A) NACL AL 09% B) TRITON X100 AL 001% C) NAN3 AL 005% 1 TORUNDA VAGINAL ESTERIL 1 INSTRUCTIVO KIT PARA 25 PRUEBAS", "description": "MEMBRANAS DE BIOPORE\nMEMBRANAS DE BIOPORE (MILIPORE PICM012550 PORO 0.4 MICRAS). PAQUETE CON 100 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25101-0004", "specific_item_code": "25101", "cucop_description": "ALCOHOLES AROMATICOS Y FENOLES (COMPUESTOS AROMATICOS)", "description": "METANOL\nABSOLUTO(99%)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETAS\nMICROPIPETAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "MICROTAINER (TUBOS CON K2 EDTA DE 500 MICROLITROS)\nTUBO MICROTAINER PARA COLECCIÓN DE SANGRE CAPILAR CON EDTA, COLOR LILA: CÓDIGO 365974; 250-500 ¿L, CLAVE SS: 080.909.5599 CAJA C/200 PZAS. MATERIAL: DE PLÁSTICO CON RECUBRIMIENTO CON EDTA K2 COMO ADITIVO.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MISEQ REAGENT\nMISEQ REAGENT KIT V2 (300-CYCLES) CAT. MS-102-2002\nKIT CON 2 CAJAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MISEQ REAGENT KIT\nMISEQ REAGENT KIT V3 (150-CYCLE) CAT. MS-102-3001\nKIT CON 2 CAJAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NEXTSEQ 500/550 HIGH OUTPUT\nNEXTSEQ 500/550 HIGH OUTPUT KIT V2.5 (300 CYCLES) CAT. 20024908\nKIT CON 3 CAJAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "126", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "OLIGO\nOLIGO(DT)18 PRIMER", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "127", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL DE PRUEBA DE PH\nPAPEL DE PRUEBA DE PH HYDRION® INSTA-CHECK® L 0-13", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "128", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO PARA PRUEBAS SEROLÓGICAS CON 5 SPOTS.\nPAPEL FILTRO PARA PRUEBAS SEROLÓGICAS CON 5 SPOTS.TARJETA DE CINCO SPOTS CONSTITUIDA POR PAPEL ABSORBENTE CON UNA SUPERFICIE UNIFORME PARA LA TOMA DE MUESTRAS DE SANGRE, VIDA ÚTIL DE 3 A 5 AÑOS .", "requested_quantity": "49", "minimum_quantity": "49", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "129", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "PARAFILM M\nPAPEL PARAFILM, 5 CM DE ANCHO POR 76 METROS DE LARGO.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "130", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "PEPTONA DE CASEÍNA (TRIPTONA)\nINGREDIENTE PARA MEDIO DE CULTIVO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "131", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "PEROXIDO DE HIDROGENO\nPERÓXIDO DE HIDRÓGENO AL 30% DE 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "132", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "PERSULFATO DE AMONIO\nAPS PERSULFATO DE AMONIO. GRADO BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHIX CONTROL V3\nPHIX CONTROL V3 CAT. FC-110-3001\nCAJA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "134", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS ROMA SIN DIENTES\nPINZAS ROMA. SIN DIENTES EL MATERIAL PUEDE SER DE POLIOXIMETILENO, PLÁSTICO, RECUBIERTAS CON TEFLÓN, LONGITUD 15 MM", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "135", "cucop_code": "25401-6569", "specific_item_code": "25401", "cucop_description": "080.709.0311 PIPETAS. DESECHABLE DE POLIESTIRENO DE 1 ML. GRADUADA 1/100 ESTERIL CON ENVOLTURA INDIVIDUAL. CAJA CON 500 PIEZAS.", "description": "PIPETAS MICROCAPILARES\nPIPETAS MICROCAPILARES, BRAND TM MICROPIPETA INTRAMARK™ DESECHABLE, MARCAS DE 10 UL (ETIQUETA NARANJA) PAQUETE DE 1000 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "136", "cucop_code": "25401-6571", "specific_item_code": "25401", "cucop_description": "080.709.0337 PIPETAS. DESECHABLE DE POLIESTIRENO DE 5 ML. GRADUADA 1/10 ESTERIL CON ENVOLTURA INDIVIDUAL. CAJA CON 200 PIEZAS.", "description": "PIPETAS TRANSFERENCIA\nPIPETAS TRANSFERENCIA 5 ML DE CAPACIDAD", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "137", "cucop_code": "25501-0068", "specific_item_code": "25501", "cucop_description": "PISETA", "description": "PISETA INTEGRAL\nPISETA INTEGRAL DE CAPACIDAD DE 500 ML. BOCA ANCHA. MATERIAL DE FABRICACIÓN: LDPE.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "138", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "POLIMERASA\nINVITROGEN™ ADN POLIMERASA DE ALTA FIDELIDAD PLATINUM TAQ, 100 RXNS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "139", "cucop_code": "25401-0522", "specific_item_code": "25401", "cucop_description": "TUBO PARA ASPIRADOR DE HULE LATEX", "description": "PORTATUBO AUTOMATICO REUTILIZABLE\nPORTATUBOS AUTOMATICO REUTILIZABLE (100 PIEZAS POR CAJA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "140", "cucop_code": "25401-0522", "specific_item_code": "25401", "cucop_description": "TUBO PARA ASPIRADOR DE HULE LATEX", "description": "PORTATUBO UNIVERSAL (HOLDER) DE\nPLÁSTICO.\nPORTAAGUJAS DE AJUSTE UNIVERSAL DE POLIPROPILENO, MUESTRAS MÚLTIPLES, PARA TUBOS VACUTAINER, 1 MM. COLOR AMARILLO", "requested_quantity": "500", "minimum_quantity": "500", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "141", "cucop_code": "25301-1023", "specific_item_code": "25301", "cucop_description": "010.000.3617.00 FOSFATO DE POTASIO SOLUCION INYECTABLE POTASIO DIBASICO 1.550 G/10 ML, POTASIO MONOFASICO 0.300 G/ 10 ML 50 AMPOLLETAS CON 10 ML", "description": "POTASSIUM PHOSPHATE MONOBASIC\nPOTASSIUM PHOSPHATE MONOBASIC CAT. 795488", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "142", "cucop_code": "25401-0493", "specific_item_code": "25401", "cucop_description": "TIRAS DE FLUORESCEINA (USO OFTALMOLOGICO)", "description": "PROPARACÍANA CLORHIDRATO AL 0.5%, FRASCO 10 ML\nPROPARACÍANA CLORHIDRATO AL 0.5%, FRASCO GOTERO DE 10 ML, SOLUCIÓN OFTÁLMICA ESTÉRIL", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "143", "cucop_code": "25101-0021", "specific_item_code": "25101", "cucop_description": "GLUCIDOS, LIPIDOS, AMINOACIDOS-PROTEINAS (COMPUESTOS AROMATICOS)", "description": "PROTEIN ASSAY. DYE REAGENT CONCENTRATE. \nPOR PROTOCOLO SE REQUIERE MARCA BIO-RAD\nFRASCO DE 450 ML. CAT. #500-0006", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "144", "cucop_code": "25401-6976", "specific_item_code": "25401", "cucop_description": "080.784.3396 SUSTANCIA BIOLOGICAS PROTEINASA K CON ACTIVIDAD ESPECIFICA DE 10 A 20 U/MG. GRADO BIOLOGIA MOLECULAR. FRASCO CON 100 MG. C (0 °C).", "description": "PROTEINASA K\nPROTEINASA K (ENGYODONTIUM ALBUM) LIOFILIZADA PARA BIOLOGÍA MOLECULAR, FRASCO DE 100 MG. ACTIVIDAD =40 U/. CON CERTIFICADO DE ANÁLISIS Y CADUCIDAD MÍNIMA DE 12 MESES A PARTIR DE LA ENTREGA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "145", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "PROTEINASA K\nPOLVO LIOFILIZADO, =30 UNIDADES/MG PROTEÍNA, GRADO BIOLOGÍA MOLECULAR", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "146", "cucop_code": "25401-6682", "specific_item_code": "25401", "cucop_description": "080.735.1374 PIPETAS PUNTA CON FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MINIMO 960 PIEZAS.", "description": "PUNTA CON FILTRO PARA PIPETA\nPUNTA CON FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 960 PIEZAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "147", "cucop_code": "25401-6680", "specific_item_code": "25401", "cucop_description": "080.735.0228 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 1000 µL. BOLSA CON 1000.", "description": "PUNTAS AZULES\nPUNTAS AZULES DE 1000 UL LIBRE DE DNASA Y RNASA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "148", "cucop_code": "25401-6679", "specific_item_code": "25401", "cucop_description": "080.735.0210 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 200 µL. BOLSA CON 1000.", "description": "PUNTAS DE PP AMARILLAS\nPUNTAS DE PP AMARILLAS DE 200UL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "149", "cucop_code": "25401-6680", "specific_item_code": "25401", "cucop_description": "080.735.0228 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 1000 µL. BOLSA CON 1000.", "description": "PUNTAS PARA PIPETA 100¿L\nPUNTA PARA PIPETA 100¿L (BOLSAS DE 1000 PIEZAS)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "150", "cucop_code": "25401-6678", "specific_item_code": "25401", "cucop_description": "080.735.0202 PUNTAS DE PLASTICO. DESECHABLES PARA PIPETAS DE: 100 µL. BOLSA CON 1000.", "description": "PUNTAS PARA PIPETA 1000¿L\nPUNTA PARA PIPETA 1000¿L (BOLSA DE 1000 PIEZAS)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "151", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "REACTIVO PARA REACIÓN DE PCR TIEMPO REAL\nIQ SYBER GREEN. IQ SYBER GREENSUPERMIX 2 X 1.5 ML., COMPATIBLE CON EL EQUIPOCFX96 MARCA BIORAD.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "152", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "REACTIVO TRIZOL\nREACTIVO PARA EL AISLAMIENTO DE ARN TOTAL DE ALTA CALIDAD O EL AISLAMIENTO SIMULTÁNEO DE ARN, ADN Y PROTEÍNAS A PARTIR DE UNA VARIEDAD DE MUESTRAS BIOLÓGICAS. EL REACTIVO TRIZOL MANTIENE LA INTEGRIDAD DEL ARN GRACIAS A LA INHIBICIÓN ALTAMENTE EFICAZ DE LA ACTIVIDAD DE ARNASA, AL TIEMPO QUE DESTRUYE LAS CÉLULAS Y DISUELVE LOS COMPONENTES CELULARES DURANTE LA HOMOGENEIZACIÓN DE MUESTRAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "153", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "REACTIVOS COMPLEMENTARIOS DE LA PCR\nDNTP MIX, 10MM EACH, A SOLUTION CONTAINS 10MM DATP, 10MM DCTP, 10MM DGTP, AND 10MM DTTP", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "154", "cucop_code": "25501-0072", "specific_item_code": "25501", "cucop_description": "RECIPIENTE", "description": "RECIPIENTES ESTÉRILES CON TAPA DE ROSCA\nRECIPIENTES ESTÉRILES CON TAPA DE ROSCA, CAPACIDAD DE 20 ML", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "155", "cucop_code": "25401-5690", "specific_item_code": "25401", "cucop_description": "080.074.0144 SUSTANCIAS BIOLOGICAS ANTIGENOS SUEROS. ANTISUEROS PREPARADOS EN CONEJO Y CONJUGADOS CON FLUORESCEINA: DESOXIRRIBONUCLEASA TIPO 1 (DNAASA). OBTENIDO DEL PANCREAS. CRISTALES LIOFILIZADOS. PARA DETERMINACIONES BIOQUIMICAS. FRASCO CON 20 MG. RTC.", "description": "RIBONUCLEASA LIOFILIZADA DE PÁNCREAS DE BOVINO TIPO I-A\nRIBONUCLEASA LIOFILIZADA DE PÁNCREAS DE BOVINO TIPO I-A. ACTIVIDAD =60 U/MG. ADNASAS NO DETECTADAS. FRASCO DE 100 MG. CON CERTIFICADO DE ANÁLISIS Y CADUCIDAD MÍNIMA DE 12 MESES A PARTIR DE LA ENTREGA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "156", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "RNASEZAP\nAGENTE PURIFICADOR QUE SE UTILIZA PARA ELIMINAR LA CONTAMINACIÓN POR RNASA DE LA CRISTALERÍA, LAS SUPERFICIES DE PLÁSTICO, LOS RECIPIENTES DE REACCIÓN, LAS ENCIMERAS Y LAS PIPETAS. TAMBIÉN SE UTILIZA PARA LA ELIMINACIÓN EFICAZ DE LOS RESIDUOS DE RNASA DE LOS TUBOS DE MICROCENTRÍFUGA SIN INHIBIR LAS REACCIONES ENZIMÁTICAS POSTERIORES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "157", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ROJO CONGO\nROJO CONGO CON UNA SOLUBILIDAD EN AGUA DE 1 MG/ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "158", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "S,S,S,-TRIBUTYLPHOSPHOROTRITHIOATE. (DEF)\nESTÁNDAR ANALÍTICO =90% PUREZA. PM 648.71 FRASCO DE 100 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "159", "cucop_code": "25401-0612", "specific_item_code": "25401", "cucop_description": "SABANA TERMICA", "description": "SABANAS DESECHABLES\nSABANAS DESECHABLES 1.20X1.80", "requested_quantity": "30", "minimum_quantity": "30", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "160", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "SEPTA DE 9MM DE BTO DE BAJO SANGRADO\nSEPTA DE 9MM DE BTO DE BAJO SANGRADO PARA INYECTOR SPLIT-SPLITLESS COMPATIBLE CON CROMATÓGRAFO DE GASES SCION 436-GC. PAQUETE DE 50 PIEZAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "161", "cucop_code": "25401-7612", "specific_item_code": "25401", "cucop_description": "080.830.1238 REACTIVOS QUIMICOS FOSFATO DE SODIO. 12 H2O. RA. CRISTALES. FRASCO CON 500 G. TA.", "description": "SODIUM PHOSPHATE DIBASIC\nSODIUM PHOSPHATE DIBASIC CAT. 795410", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "162", "cucop_code": "25301-3738", "specific_item_code": "25301", "cucop_description": "010.000.6338.00 - CISTEAMINA. COLIRIO, CLORHIDRATO DE CISTEAMINA EQUIVALENTE A 3.8 MG CISTEAMINA, CLORURO DE BENZALCONIO (0.2MG/ML) CAJA CON FRASCO AMPULA CON 5 ML DE SOLUCION (3.8 MG/ML) E INSTRUCTIVO ANEXO", "description": "SOLUCIÓN DE ALMACENAMIENTO DE ELECTRODO CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL\nSOLUCIÓN DE ALMACENAMIENTO DE ELECTRODO CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL. BOTELLA DE 500 ML. CADUCIDAD MÍNIMA DE 12 MESES.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "163", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "SOLUCIÓN PARA TEÑIR PROTEINAS EN MEMBRANA\nROJO DE PONCEAU S STAINING SOLUTION 1000 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "164", "cucop_code": "25401-4613", "specific_item_code": "25401", "cucop_description": "060.833.0254 SOLUCIONES. SALINA BALANCEADA NORMAL PARA IRRIGACION OFTALMICA. ENVASE CON 500 ML.", "description": "SOLUCIÓN SALINA 0.9\nSOLUCIÓN SALINA 0.9% UNIDOSIS DE 10ML CADA UNA. CAJA CON 100 AMPOLLETAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "165", "cucop_code": "25401-4613", "specific_item_code": "25401", "cucop_description": "060.833.0254 SOLUCIONES. SALINA BALANCEADA NORMAL PARA IRRIGACION OFTALMICA. ENVASE CON 500 ML.", "description": "SOLUCIÓN SALINA 0.9\nSOLUCIÓN SALINA 0.9%, BOTELLA DE 250 ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "166", "cucop_code": "25401-4613", "specific_item_code": "25401", "cucop_description": "060.833.0254 SOLUCIONES. SALINA BALANCEADA NORMAL PARA IRRIGACION OFTALMICA. ENVASE CON 500 ML.", "description": "SOLUCIÓN SALINA 0.9\nSOLUCIÓN SALINA 0.9 BOTELLA 1 L", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "167", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA 305423-S (TGACACAAATGATTTTCATACAAAAGTCGAGA)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 305423-S (TGACACAAATGATTTTCATACAAAAGTCGAGA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "168", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA 356043-S (CTCTAGAGATCCGTCAACATGGTGGAGCAC)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 356043-S (CTCTAGAGATCCGTCAACATGGTGGAGCAC)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "169", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA 59122-S (TTTAAACTGAAGGCGGGAAACGACAA)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 59122-S (TTTAAACTGAAGGCGGGAAACGACAA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "170", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA 603-S (TGGTACCACGCGACACACTTCCACTC)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 603-S (TGGTACCACGCGACACACTTCCACTC)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "171", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA ADH1 S (CTTAGGGGCAGACTCCCGTGTTCCCT)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA ADH1 S (CTTAGGGGCAGACTCCCGTGTTCCCT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "172", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA P35S S (CCCACTATCCTTCGCAAGACCCTTCCT)\nSONDAS, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA.SECUENCIA P35S S (CCCACTATCCTTCGCAAGACCCTTCCT)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "173", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA TNOS S (ATGGGTTTTTATGATTAGAGTCCCGCAA)\nSONDAS, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA TNOS S (ATGGGTTTTTATGATTAGAGTCCCGCAA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "174", "cucop_code": "25401-0091", "specific_item_code": "25401", "cucop_description": "CANDELILLA DE PLASTICO ACOPLABLE A LA SONDA", "description": "SONDAS SECUENCIA: 4032-S (CCTTTTCCATTTGGG)\nSONDA, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA: 3032-S (CCTTTTCCATTTGGG)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "175", "cucop_code": "25401-7099", "specific_item_code": "25401", "cucop_description": "080.823.3837 SOLUCIONES AMORTIGUADORAS AMORTIGUADORA (BUFFER) DE ACETATO PH 4.9. FRASCO CON 100 ML. TA.", "description": "STM BUFFER\nSTM BUFFER (270MM SUCROSE, 10MM TRIS. HCI, PH 7.5, 1MM MGCI2), 1 LITER, G-BIOSCIENCES. CAT. 786-537", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "176", "cucop_code": "25401-7692", "specific_item_code": "25401", "cucop_description": "080.830.3820 REACTIVOS QUIMICOS SULFATO DE SODIO ANHIDRO. RA. ACS. CRISTALES. FRASCO DE 500 G. TA.", "description": "SULFATO DE SODIO ANHIDRO EN POLVO GRADO R.A. CON PUREZA >99.0%)\nSULFATO DE SODIO ANHIDRO EN POLVO GRADO R.A. CON PUREZA >99.0%. FRASCO DE 5 KG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "177", "cucop_code": "25301-4084", "specific_item_code": "25301", "cucop_description": "040.000.4060.01 MIDAZOLAM. SOLUCION INYECTABLE CADA AMPOLLETA CONTIENE: CLORHIDRATO DE MIDAZOLAM EQUIVALENTE A 50 MG DE MIDAZOLAM. O MIDAZOLAM 50 MG. ENVASE CON 10 AMPOLLETAS CON 10 ML.", "description": "SURROGADOS BASITOS/NEUTROS PARA METODO EPA 8270C\nSURROGADOS BÁSICOS/NEUTROS PARA EL MÉTODO EPA 8270C, A 1000 UG / ML EN CLORURO DE METILENO QUE CONTENGA (1) 2-FLUOROFENOL (2) P-TERFENIL-D14 (3) NITROBENCENO-D5. CON CERTIFICADO DE TRAZABILIDAD A UN PATRÓN NACIONAL O INTERNACIONAL Y AL MENOS 18 MESES DE VIGENCIA. AMPOLLETA CON 1 O 1.2 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "178", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "SUSTRATO\nSUSTRATO PARA REVELAR CON PEROXIDASA (HRP) QUIMIOLUMINISCENCIA (WB) 100 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "179", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "SUSTRATO\nSUSTRATO PARA REVELAR CON FOSFATASA (AP) NBT/BCIP (WB) 100-250 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "180", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "SYBERGREEN\nMEZCLA DE FLUOROFORO, TAQPOLIMERASA Y BUFFERS PARA HACER PCR EN TIEMPO REAL.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "181", "cucop_code": "25501-0091", "specific_item_code": "25501", "cucop_description": "MATERIAL DE MADERA PARA USO EN LABORATORIO DE MEDICION", "description": "TABLA CON MARCA DE HUELLAS PARA COLOCAR LOS PIES.\nTABLA CON PIES, DE MADERA COMPRIMIDA O TRIPLAY CON MEDICIONES DE ANCHO (24 CM) Y LARGO DE (35 CM ), CON MARCA DE HUELLAS PARA COLOCAR LOS PIES.", "requested_quantity": "29", "minimum_quantity": "29", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "182", "cucop_code": "25401-0480", "specific_item_code": "25401", "cucop_description": "TAPA CON ROSCA (REPUESTO PARA BIBERON)", "description": "TAPAS DE ROSCA VERDE DE POLIPROPILENO\nTAPAS DE ROSCA VERDE DE POLIPROPILENO, CON SEPTA DE SILICÓN ROJO DE ALTA CALIDAD LAMINADO CON PTFE 0.005, RECOMENDADO PARA APLICACIONES DE INYECCIÓN MÚLTIPLE. PARA VIALES DE 2 ML DE BOCA ANCHA (9MM) PARA AUTOMUESTREADOR. PAQUETE DE 100 PIEZAS.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "183", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "TAQ DNA POLYMERASE, RECOMBINANT 500 UNITS\nVIAL CON 500 UNIDADES", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "184", "cucop_code": "25501-0093", "specific_item_code": "25501", "cucop_description": "MATERIAL CERAMICO PARA USO EN LABORATORIO DE MEDICION", "description": "TAZA DE RECOLECCIÓN (4 OZ)\nTAZA DE RECOLECCIÓN (4OZ)", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "185", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "TETRAMETHYLETHYLENEDIAMINE\nTEMED GRADO BIOLOGÍA MOLECULAR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "186", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "THINPREP FRASCOS DE PRESERVCYT. CAJA CON 25 PIEZAS\nFRASCOS DE PRESERVCYT", "requested_quantity": "90", "minimum_quantity": "90", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "187", "cucop_code": "25401-0002", "specific_item_code": "25401", "cucop_description": "ABRASIVO PARA AFILAR CUCHILLAS", "description": "TIJERAS DE VANNAS\nTIJERAS DE VANNAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "188", "cucop_code": "25401-0493", "specific_item_code": "25401", "cucop_description": "TIRAS DE FLUORESCEINA (USO OFTALMOLOGICO)", "description": "TIRAS DE SCHIRMER, TEARFLO, CAJA CON 100 TIRAS\nTIRAS DE SCHIRMER, TEARFLO, CAJA CON 100 TIRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "189", "cucop_code": "25501-0045", "specific_item_code": "25501", "cucop_description": "TIRAPUENTES", "description": "TIRAS PARA PCR DE 8 TUBOS DE 0.2 ML CON TAPA\nTIRAS PARA PCR DE 8 TUBOS DE 0.2 ML CON TAPA (1000 PIEZAS POR BOLSA)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "190", "cucop_code": "25401-8158", "specific_item_code": "25401", "cucop_description": "TORNIQUETE MÉDICO", "description": "TORNIQUETE VENOSO, MATERIAL: POLIÉSTER, SIN LÁTEX (\nLIGADURA)\nTORNIQUETE VENOSO, MATERIAL: POLIÉSTER, SIN LÁTEX , AJUSTABLES DE EMERGENCIA MÉDICA, PRIMEROS AUXILIOS, LIBERACIÓN RÁPIDA, CORREA ELÁSTICA PARA EXTERIORES, BANDA DE HEBILLA Y CLASE DE FLEBOTOMÍA\nLIGADURA)", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "191", "cucop_code": "25401-0506", "specific_item_code": "25401", "cucop_description": "TORUNDERO", "description": "TORUNDEROS DE PLÁSTICO BOCA ANCHA DE 250 ML\nFRASCOS RECTOS DE PLÁSTICO PET TRANSPARENTE - 16 OZ, TAPA BLANCA, TAPA A RAS BRINDA UNA APARIENCIA ELEGANTE.\nBOCA SUPERANCHA PARA LLENAR FÁCILMENTE.\nPET LIVIANO Y DURADERO.\nCUMPLE CON FDA.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "192", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "TRIPTOSA\nTRIPTOSA BACTO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "193", "cucop_code": "25401-7316", "specific_item_code": "25401", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBO CONICO TIPO FALCON PARA CENTRIFUGA DE 50 ML\nTUBO DE 50 ML CON TAPA DE ROSCA, DE POLIPROPILENO, ESTERILES, DE POLIPROPILENO (PP) GRADUADOS, TAPÓN DE ROSCA, FONDO CÓNICO,ADECUADOS PARA APLICACIONES DE BIOLOGÍA MOLECULAR, COMO LA CONCENTRACIÓN DE BACTERIAS PARA EL AISLAMIENTO DE ADN, LA PURIFICACIÓN Y LA PRECIPITACIÓN DE ÁCIDOS NUCLEICOS, EL ALMACENAMIENTO DE MUESTRAS (A TEMPERATURA AMBIENTE DE HASTA – 80 °C) Y LA CENTRIFUGACIÓN DE PRECIPITADOS. SUPERFICIE HIDROFÓBICA BIOLÓGICAMENTE INERTE PARA UNA BUENA RECUPERACIÓN DE CÉLULAS O PROTEÍNAS,GRADUACIONES EN AZUL OSCURO EN INCREMENTOS DE 5 ML,EL ÁREA DE ESCRITURA BLANCA ES RESISTENTE A LOS DISOLVENTES,ESTERILIZADOS POR RADIACIÓN, POLIPROPILENO CLARIFICADO,RESISTENTE A ALCOHOLES Y DISOLVENTES ORGÁNICOS SUAVES (NO RECOMENDADO PARA PROCEDIMIENTOS DE EXTRACCIÓN),PARED TRANSLÚCIDA PARA FACILITAR LA VISUALIZACIÓN,ESTABLES ENTRE LOS – 80 °C Y LOS 121 °C (– 112 ° A 250 °F),SOPORTAN FUERZAS CENTRÍFUGAS DE UNA RCF DE HASTA 16 000 × G C/500 PZS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "194", "cucop_code": "25401-8028", "specific_item_code": "25401", "cucop_description": "080.909.1648 TUBOS DE POLIPROPILENO PARA CENTRIFUGA CON CAPACIDAD DE 50 ML GRADUADO CONICO CON TAPON DE ROSCA ESTERIL. CAJA CON 400 PIEZAS.", "description": "TUBO P/CENTRIFUGA CONICO.\nCENTRIFUGA C/TAPA ROSCA DE 50ML, POLIPROPILENO, PAQUETE 50 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "195", "cucop_code": "25401-8029", "specific_item_code": "25401", "cucop_description": "080.909.1655 TUBOS DE POLIPROPILENO TIPO EPPENDORFF CON CAPACIDAD DE 200 MICROLITROS CON TAPA Y SELLO DE SEGURIDAD FONDO REDONDEADO RESISTE 16000 G SE ESTERILIZAN EN AUTOCLAVE. CALIDAD PCR. BOLSA MINIMO 200 MAXIMO 500 PIEZAS.", "description": "TUBO PARA PCR\nTUBO PARA PCR DE 0.2ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "196", "cucop_code": "25401-8052", "specific_item_code": "25401", "cucop_description": "080.909.6506 TUBOS TUBO SISTEMA PARA TOMA Y RECOLECCION DE SANGRE DE PLASTICO PET AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO SIN ANTICOAGULANTE TAPON ROJO CON SILICON COMO LUBRICANTE Y ACTIVADOR DE COAGULACION VOLUMEN DE DRENADO 6 ML (+ 0.3 ML). ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON TAPON DE SEGURIDAD. ESTERIL. CAJA CON 100 TUBOS.", "description": "TUBO VACUTAINER 10ML TAPA ROJA\nTUBOS PARA EXTRACCIÓN DE SUERO, SILICÓN, 16 X 100 MM, 10.0 ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "197", "cucop_code": "25401-8052", "specific_item_code": "25401", "cucop_description": "080.909.6506 TUBOS TUBO SISTEMA PARA TOMA Y RECOLECCION DE SANGRE DE PLASTICO PET AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO SIN ANTICOAGULANTE TAPON ROJO CON SILICON COMO LUBRICANTE Y ACTIVADOR DE COAGULACION VOLUMEN DE DRENADO 6 ML (+ 0.3 ML). ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON TAPON DE SEGURIDAD. ESTERIL. CAJA CON 100 TUBOS.", "description": "TUBO VACUTAINER C/EDTA-K2\nTUBO VACUTAINER C/EDTA-K2, 13X100, 6ML TAPÓN MORADO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "198", "cucop_code": "25401-8027", "specific_item_code": "25401", "cucop_description": "080.909.1630 TUBOS DE POLIPROPILENO PARA CENTRIFUGA CON CAPACIDAD DE 15 ML GRADUADO CONICO CON TAPON DE ROSCA ESTERIL. CAJA CON 500 PIEZAS.", "description": "TUBOS CENTRIFUGA.\n15ML, GRADUADO, PP, TAPÓN AZUL, PAQUETE 50 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "199", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS CRIOGENICOS\nTUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "200", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML.\nTUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML TAPA COLOR ROJO ESTÉRILES GRADUADOS CON FALDÓN QUE SOPORTEN TEMPERATURAS A -196 °C . FABRICADO EN PROPILENO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "201", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS CRIOGENICOS (CRIOTUBO)DE 2 ML.\nTUBOS CRIOGENICOS (CRIOTUBO)DE 2 ML TAPA COLOR AZUL CIELO ESTÉRILES GRADUADOS CON FALDÓN QUE SOPORTEN TEMPERATURAS A -196 °C. FABRICADO EN PROPILENO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "202", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS CRIOGENICOS (CRIOTUBOS) DE 2 ML\nTUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML TAPA COLOR BLANCO ESTÉRILES GRADUADOS CON FALDÓN QUE SOPORTEN TEMPERATURAS A -196 °C . FABRICADO EN PROPILENO.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "203", "cucop_code": "25401-8051", "specific_item_code": "25401", "cucop_description": "080.909.6498 TUBOS TUBO SISTEMA PARA TOMA Y RECOLECCION DE SANGRE DE PLASTICO PET AL VACIO (13 X 75 MM) DESECHABLE PARA ADULTO CON EDTA K2 (7.2 MG) APLICADO POR ASPERSION EN LA PARED DEL TUBO TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 4.0 ML (+ 0.3 ML). ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON TAPON DE SEGURIDAD. ESTERIL. CAJA CON 100 TUBOS.", "description": "TUBOS DE EXTRACCIÓN\nTUBOS DE EXTRACCIÓN 8.5 ML (CON DEXTROSA DE CITRATO ÁCIDO, 3 CU)", "requested_quantity": "600", "minimum_quantity": "600", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "204", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS DE PLÁSTICO DE 3 ML AL VACIÓ.\nTUBOS DE PLÁSTICO DE 3 ML AL VACIÓ, VACUTAINER CON TAPÓN COLOR MORADO, CON ANTICOAGULANTE (EDTA).", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "205", "cucop_code": "25501-0050", "specific_item_code": "25501", "cucop_description": "TUBO SUCCION", "description": "TUBOS DE PLÁSTICO DE 6 ML AL VACÍO.\nTUBOS DE PLÁSTICO DE 6 ML AL VACÍO, VACUTAINER CON TAPÓN AMARILLO CON GEL SEPARADOR", "requested_quantity": "34", "minimum_quantity": "34", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "206", "cucop_code": "25401-8031", "specific_item_code": "25401", "cucop_description": "080.909.1671 TUBOS DE POLIPROPILENO TIPO EPPENDORFF CON CAPACIDAD DE 1500 MICROLITROS CON TAPA Y SELLO DE SEGURIDAD FONDO REDONDEADO RESISTE 16000 G SE ESTERILIZAN EN AUTOCLAVE. LIBRE DE RNAASA. BOLSA CON 1000 PIEZAS.", "description": "TUBOS DE POLIPROPILENO CAP. 1500 UL\nCAP. 1.7 ML.CAJA CON 1000 PZAS.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "207", "cucop_code": "25401-0523", "specific_item_code": "25401", "cucop_description": "TUBO PARA CANALIZACION DE LATEX (NATURAL)", "description": "TUBOS RECOLECCIÓN ESTÉRIL 50 ML FALCON\nTUBO RECOLECCIÓN ESTÉRIL 50 ML FALCON", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "208", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "ULTRAPURE PHENOL CHLOROFORM: ISOAMYL ALCOHOL\nEL FENOL/CLOROFORMO/ALCOHOL ISOAMÍLICO ULTRAPURE™ (25:24:1, V/V) SE UTILIZA EN LA PURIFICACIÓN DE ÁCIDOS NUCLEICOS. ESTE REACTIVO CONSTA DE ALCOHOL ISOAMÍLICO, CLOROFORMO DE ALTA PUREZA Y FENOL ULTRAPURE™ SATURADO CON TRIS-HCL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "209", "cucop_code": "25401-8052", "specific_item_code": "25401", "cucop_description": "080.909.6506 TUBOS TUBO SISTEMA PARA TOMA Y RECOLECCION DE SANGRE DE PLASTICO PET AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO SIN ANTICOAGULANTE TAPON ROJO CON SILICON COMO LUBRICANTE Y ACTIVADOR DE COAGULACION VOLUMEN DE DRENADO 6 ML (+ 0.3 ML). ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON TAPON DE SEGURIDAD. ESTERIL. CAJA CON 100 TUBOS.", "description": "VACUTAINER TAPA APERLADO\nVACUTAINER TAPA APERLADO 5ML. PARA EXTRACCIÓN DE PLASMA C/EDTA, 13X 100MM, 5.0ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "210", "cucop_code": "25401-0549", "specific_item_code": "25401", "cucop_description": "ADHESIVOS MEDICOS", "description": "BANDITAS ADHESIVAS REDONDAS\nVENDITAS ADHESIVAS, REDONDAS", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "211", "cucop_code": "25401-6275", "specific_item_code": "25401", "cucop_description": "080.431.0159 FRASCOS AMBAR CON BOCA ANCHA Y TAPA DE ROSCA DE PLASTICO. CAPACIDAD: 115 ML. PIEZA.", "description": "VIAL ÁMBAR DE VIDRIO\nVIAL ÁMBAR DE VIDRIO SILANIZADO PARA TAPA ROSCADA ABIERTA, CAPACIDAD DE 2 ML Y ZONA DE ESCRITURA. PAQUETE DE 100 PIEZAS.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "212", "cucop_code": "25401-5593", "specific_item_code": "25401", "cucop_description": "080.070.1443 SUSTANCIA BIOLOGICAS SONDA DE DNA BIOTINILADA CONTRA EL VIRUS DEL PAPILOMA HUMANO TIPO 31. FRASCO CON 1 ML. RTC.", "description": "VIBA-BRUSH AUTOMUESTREADOR DE VPH\nVIBA-BRUSH AUTOMUESTREADOR DE VPH FÁCIL, INDOLORO Y SEGURO", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "213", "cucop_code": "25901-0011", "specific_item_code": "25901", "cucop_description": "SUSTANCIAS EN FORMA SOLIDA PARA USO EN LABORATORIO DE MEDICION", "description": "WIZARD SV GEL AND PCR CLEAN-UP\nWIZARD SV GEL AND PCR CLEAN-UP", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "214", "cucop_code": "25101-0031", "specific_item_code": "25101", "cucop_description": "HOMOLOGOS DEL BENCENO (COMPUESTOS AROMATICOS)", "description": "XILENO, FRASCO 1 L\nXILENO, FRASCO 1 L", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "215", "cucop_code": "25301-1352", "specific_item_code": "25301", "cucop_description": "010.000.0262.00 LIDOCAINA SOLUCION INYECTABLE AL 2 % 1 G/50 ML 5 FRASCOS AMPULA CON 50 ML", "description": "XILOCAÍNA AL 2%\nXILOCAÍNA AL 2% , 20 MG SOLUCIÓN INYECTABLE CAJA CON FRASCO ÁMPULA CON 50 ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "216", "cucop_code": "25401-8102", "specific_item_code": "25401", "cucop_description": "537.774.0211 REGLAS. CINTA METRICA. METALICA O DE PLASTICO. ESCALA EN CENTIMETROS. LONGITUD: 200 CM. PIEZA.", "description": "ESTADÍMETRO CON CINTA METÁLICA DE 220 CM DE LARGO CON UNA PRESICIÓN DE 1 MM, DE ESCUADRA MOVIL DE PLASTICO RÍGIDO , CON UN ÁNGULO DE 90°.\nESTADÍMETRO CON CINTA METÁLICA DE 220 CM DE LARGO CON UNA PRESICIÓN DE 1 MM, DE ESCUADRA MOVIL DE PLASTICO RÍGIDO , CON UN ÁNGULO DE 90°.", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] } ], "awards": [ { "id": "C-2023-00106968", "internal_reference": "DA-INSP-061-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "BIO FARBE SA DE CV", "normalized_name": "BIO FARBE", "rfc_type": null, "slug": "bio-farbe" }, "contract_period": { "published_at": "2023-09-13T00:34:26.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "105012", "tax": "16801.92", "total": "121813.92", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0020", "description": "AGUJA DE VACUTAINER\nAGUJA DE VACUTAINER ECLIPSE VERDES", "unit": "PIEZA", "requested_quantity": "300", "awarded_quantity": null, "unit_price": "5.84", "subtotal": "1752", "tax": "280.32", "other_taxes": null, "total": "2032.32" }, { "number": "0", "cucop_code": "25401-0014", "description": "AGUJAS DENTALES TIPO CARPULE, CALIBRE 27G LARGA\nAGUJA DENTALES TIPO CARPULE, CALIBRE 27G LARGA, CAJA CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "518", "subtotal": "1554", "tax": "248.64", "other_taxes": null, "total": "1802.64" }, { "number": "0", "cucop_code": "25401-4573", "description": "BOLSAS DE POLIETILENO COLOR ROJO PARA RPBI CON MEDIDAS DE 60 X 80 CENTÍMETROS.\nBOLSAS DE POLIETILENO COLOR ROJO PARA RPBI CON MEDIDAS DE 60 X 80 CENTÍMETROS, PARA LA RECOLECCIÓN DE RESIDUOS BIOLÓGICO INFECCIOSO.", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1256", "subtotal": "3768", "tax": "602.88", "other_taxes": null, "total": "4370.88" }, { "number": "0", "cucop_code": "25501-0101", "description": "CAJAS DE CARTON PARA ALMACENAR MUESTRAS\nCAJA DE CARTÓN PLASTIFICADO, PARA ALMACENAMIENTO, COLOR BLANCO, PARA USO EN ULTRACONGELADOR (-80°), CON DIVISIONES DE 7X7 ESPACIOS, DIMENSIONES: 13X13X8 CM, PARA ALMACENAR CRIOTUBOS DE 7 ML", "unit": "PIEZA", "requested_quantity": "100", "awarded_quantity": null, "unit_price": "396", "subtotal": "39600", "tax": "6336", "other_taxes": null, "total": "45936" }, { "number": "0", "cucop_code": "25401-7573", "description": "CARBÓN VEGETAL O CARBÓN ACTIVADO\nCARBÓN VEGETAL O CARBÓN ACTIVADO. FRASCO CON 250 G. TA.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "260", "subtotal": "260", "tax": "41.6", "other_taxes": null, "total": "301.6" }, { "number": "0", "cucop_code": "25401-4592", "description": "ENJUAGUE BUCAL\nENJUAGUE BUCAL SCOPE DE 1.5 L", "unit": "PIEZA", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "406", "subtotal": "5684", "tax": "909.44", "other_taxes": null, "total": "6593.44" }, { "number": "0", "cucop_code": "25901-0011", "description": "ESTANDAR ANALÍTICO =90% PUREZA. PM 338.44. FRASCO DE 100 ML\nPIPERONYL BUTOXIDE. (PBO) BUTOXIDO DE PIPERONILO.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3082", "subtotal": "3082", "tax": "493.12", "other_taxes": null, "total": "3575.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "FENILEFRINA 10%\nFENILEFRINA 10%, SOLUCIÓN OFTÁLMICA ESTÉRIL, FRASCO GOTERO DE 5 ML", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "660", "subtotal": "3300", "tax": "528", "other_taxes": null, "total": "3828" }, { "number": "0", "cucop_code": "25501-0078", "description": "GEL REFRIGERANTE TAMAÑO MEDIA CARTA\nGEL REFRIGERANTE 100 GRAMOS, CADA BOLSA MIDE\nLARGO 13 CM X ANCHO 11 CM.", "unit": "PIEZA", "requested_quantity": "105", "awarded_quantity": null, "unit_price": "98", "subtotal": "10290", "tax": "1646.4", "other_taxes": null, "total": "11936.4" }, { "number": "0", "cucop_code": "25401-0294", "description": "JERINGA 1 ML C/AGUJA MONTADA\nJERINGA 1 ML C/AGUJA MONTADA CAJA C/100", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "328", "subtotal": "1312", "tax": "209.92", "other_taxes": null, "total": "1521.92" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL DE PRUEBA DE PH\nPAPEL DE PRUEBA DE PH HYDRION® INSTA-CHECK® L 0-13", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "24.8", "subtotal": "4960", "tax": "793.6", "other_taxes": null, "total": "5753.6" }, { "number": "0", "cucop_code": "25401-5690", "description": "RIBONUCLEASA LIOFILIZADA DE PÁNCREAS DE BOVINO TIPO I-A\nRIBONUCLEASA LIOFILIZADA DE PÁNCREAS DE BOVINO TIPO I-A. ACTIVIDAD =60 U/MG. ADNASAS NO DETECTADAS. FRASCO DE 100 MG. CON CERTIFICADO DE ANÁLISIS Y CADUCIDAD MÍNIMA DE 12 MESES A PARTIR DE LA ENTREGA.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5264", "subtotal": "10528", "tax": "1684.48", "other_taxes": null, "total": "12212.48" }, { "number": "0", "cucop_code": "25301-3738", "description": "SOLUCIÓN DE ALMACENAMIENTO DE ELECTRODO CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL\nSOLUCIÓN DE ALMACENAMIENTO DE ELECTRODO CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL. BOTELLA DE 500 ML. CADUCIDAD MÍNIMA DE 12 MESES.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "576", "subtotal": "576", "tax": "92.16", "other_taxes": null, "total": "668.16" }, { "number": "0", "cucop_code": "25401-4613", "description": "SOLUCIÓN SALINA 0.9\nSOLUCIÓN SALINA 0.9%, BOTELLA DE 250 ML", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "60", "subtotal": "600", "tax": "96", "other_taxes": null, "total": "696" }, { "number": "0", "cucop_code": "25401-4613", "description": "SOLUCIÓN SALINA 0.9\nSOLUCIÓN SALINA 0.9 BOTELLA 1 L", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "112", "subtotal": "2016", "tax": "322.56", "other_taxes": null, "total": "2338.56" }, { "number": "0", "cucop_code": "25401-8027", "description": "TUBOS CENTRIFUGA.\n15ML, GRADUADO, PP, TAPÓN AZUL, PAQUETE 50 PZAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "500", "subtotal": "500", "tax": "80", "other_taxes": null, "total": "580" }, { "number": "0", "cucop_code": "25401-8051", "description": "TUBOS DE EXTRACCIÓN\nTUBOS DE EXTRACCIÓN 8.5 ML (CON DEXTROSA DE CITRATO ÁCIDO, 3 CU)", "unit": "PIEZA", "requested_quantity": "600", "awarded_quantity": null, "unit_price": "19.3", "subtotal": "11580", "tax": "1852.8", "other_taxes": null, "total": "13432.8" }, { "number": "0", "cucop_code": "25401-8031", "description": "TUBOS DE POLIPROPILENO CAP. 1500 UL\nCAP. 1.7 ML.CAJA CON 1000 PZAS.", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "670", "subtotal": "3350", "tax": "536", "other_taxes": null, "total": "3886" }, { "number": "0", "cucop_code": "25301-1352", "description": "XILOCAÍNA AL 2%\nXILOCAÍNA AL 2% , 20 MG SOLUCIÓN INYECTABLE CAJA CON FRASCO ÁMPULA CON 50 ML", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "150", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" } ] }, { "id": "C-2023-00107003", "internal_reference": "DA-INSP-070-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "TECROM SA DE CV", "normalized_name": "TECROM", "rfc_type": null, "slug": "tecrom" }, "contract_period": { "published_at": "2023-09-13T01:16:05.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "24010", "tax": "3841.6", "total": "27851.6", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-6722", "description": "ÁCIDO ACÉTICOL, SOLUCIÓN AL 5% MÁXIMO V/V\nÁCIDO ACÉTICO 5%: BOTELLA CON 500 ML", "unit": "PIEZA", "requested_quantity": "25", "awarded_quantity": null, "unit_price": "48", "subtotal": "1200", "tax": "192", "other_taxes": null, "total": "1392" }, { "number": "0", "cucop_code": "25401-0600", "description": "ALCOHOL 90%: BOTELLA CON 1000 ML\nALCOHOL 90%: BOTELLA CON 1000 ML", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "219", "subtotal": "2190", "tax": "350.4", "other_taxes": null, "total": "2540.4" }, { "number": "0", "cucop_code": "25401-0600", "description": "ALCOHOL ETÍLICO AL 96%\nALCOHOL ETÍLICO AL 96% V/V, CONTENEDOR DE 20 L. PARA USO EN LABORATORIO Y LA INDUSTRIA EN GENERAL, LÍQUIDO INCOLORO, SOLUBLE EN AGUA A 20ºC.", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "998.5", "subtotal": "1997", "tax": "319.52", "other_taxes": null, "total": "2316.52" }, { "number": "0", "cucop_code": "25401-0600", "description": "ALCOHOL ETILICO DEL 96°\nALCOHOL ETILICO DEL 96° PRESENTACIÓN DE 1 LT", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "125", "subtotal": "1250", "tax": "200", "other_taxes": null, "total": "1450" }, { "number": "0", "cucop_code": "25501-0095", "description": "AMARILLAS CAP. 1 A 200 MICROLITOS\nPUNTAS PARA MICROPIPETAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "299", "subtotal": "2990", "tax": "478.4", "other_taxes": null, "total": "3468.4" }, { "number": "0", "cucop_code": "25101-0061", "description": "CLORURO DE POTASIO\nCLORURO DE POTASIO CAT. P3911-1KG", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "401", "subtotal": "802", "tax": "128.32", "other_taxes": null, "total": "930.32" }, { "number": "0", "cucop_code": "25401-7599", "description": "EOSINA AMARILLENTA FRASCO 25 G COLORANTE\nEOSINA AMARILLENTA FRASCO 25 G COLORANTE", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "354", "subtotal": "354", "tax": "56.64", "other_taxes": null, "total": "410.64" }, { "number": "0", "cucop_code": "25401-7721", "description": "ETANOL 96% FRASCO CON 1 L\nETANOL 96% FRASCO CON 1 L", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "155", "subtotal": "310", "tax": "49.6", "other_taxes": null, "total": "359.6" }, { "number": "0", "cucop_code": "25901-0011", "description": "ISOPROPANOL\n2-PROPONOL, ISOPROPANOL PURO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "175", "subtotal": "350", "tax": "56", "other_taxes": null, "total": "406" }, { "number": "0", "cucop_code": "25401-0290", "description": "JABÓN QUIRURGICO DE 3.8 LITROS\nJABÓN QUIRURGICO DE 3.8 LITROS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "140", "subtotal": "280", "tax": "44.8", "other_taxes": null, "total": "324.8" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETAS\nMICROPIPETAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2256", "subtotal": "2256", "tax": "360.96", "other_taxes": null, "total": "2616.96" }, { "number": "0", "cucop_code": "25501-0068", "description": "PISETA INTEGRAL\nPISETA INTEGRAL DE CAPACIDAD DE 500 ML. BOCA ANCHA. MATERIAL DE FABRICACIÓN: LDPE.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "65", "subtotal": "650", "tax": "104", "other_taxes": null, "total": "754" }, { "number": "0", "cucop_code": "25901-0011", "description": "ROJO CONGO\nROJO CONGO CON UNA SOLUBILIDAD EN AGUA DE 1 MG/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "465", "subtotal": "465", "tax": "74.4", "other_taxes": null, "total": "539.4" }, { "number": "0", "cucop_code": "25401-7692", "description": "SULFATO DE SODIO ANHIDRO EN POLVO GRADO R.A. CON PUREZA >99.0%)\nSULFATO DE SODIO ANHIDRO EN POLVO GRADO R.A. CON PUREZA >99.0%. FRASCO DE 5 KG", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1225", "subtotal": "1225", "tax": "196", "other_taxes": null, "total": "1421" }, { "number": "0", "cucop_code": "25501-0050", "description": "TUBOS CRIOGENICOS\nTUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1858", "subtotal": "7432", "tax": "1189.12", "other_taxes": null, "total": "8621.12" }, { "number": "0", "cucop_code": "25101-0031", "description": "XILENO, FRASCO 1 L\nXILENO, FRASCO 1 L", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "259", "subtotal": "259", "tax": "41.44", "other_taxes": null, "total": "300.44" } ] }, { "id": "C-2023-00106897", "internal_reference": "DA-INSP-F057-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "ABALAT SA DE CV", "normalized_name": "ABALAT", "rfc_type": null, "slug": "abalat" }, "contract_period": { "published_at": "2023-09-12T22:51:39.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "436497", "tax": "69839.52", "total": "506336.52", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "MISEQ REAGENT\nMISEQ REAGENT KIT V2 (300-CYCLES) CAT. MS-102-2002\nKIT CON 2 CAJAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "31717", "subtotal": "63434", "tax": "10149.44", "other_taxes": null, "total": "73583.44" }, { "number": "0", "cucop_code": "25101-0037", "description": "MISEQ REAGENT KIT\nMISEQ REAGENT KIT V3 (150-CYCLE) CAT. MS-102-3001\nKIT CON 2 CAJAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "27494", "subtotal": "82482", "tax": "13197.12", "other_taxes": null, "total": "95679.12" }, { "number": "0", "cucop_code": "25101-0037", "description": "NEXTSEQ 500/550 HIGH OUTPUT\nNEXTSEQ 500/550 HIGH OUTPUT KIT V2.5 (300 CYCLES) CAT. 20024908\nKIT CON 3 CAJAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "137918", "subtotal": "275836", "tax": "44133.76", "other_taxes": null, "total": "319969.76" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHIX CONTROL V3\nPHIX CONTROL V3 CAT. FC-110-3001\nCAJA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4915", "subtotal": "14745", "tax": "2359.2", "other_taxes": null, "total": "17104.2" } ] }, { "id": "C-2023-00106920", "internal_reference": "DA-INSP-F058-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "ACCESORIOS PARA LABORATORIOS SA DE CV", "normalized_name": "ACCESORIOS PARA LABORATORIOS", "rfc_type": null, "slug": "accesorios-para-laboratorios" }, "contract_period": { "published_at": "2023-09-13T00:03:15.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "288605.11", "tax": "46176.84", "total": "334781.95", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0011", "description": "AGAR ENTÉRICO HEKTOEN PARA EL AISLAMIENTO Y DIFERENCIACIÓN DE BACTERIAS ENTÉRICAS GRAM NEGATIVAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3504.22", "subtotal": "3504.22", "tax": "560.68", "other_taxes": null, "total": "4064.9" }, { "number": "0", "cucop_code": "25101-0062", "description": "AGUA DESTILADA, FRASCO CON 1 L\nAGUA DESTILADA, FRASCO CON 1 L", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "107.62", "subtotal": "322.86", "tax": "51.66", "other_taxes": null, "total": "374.52" }, { "number": "0", "cucop_code": "25901-0011", "description": "CASSET DE DIÁLISIS\nSLIDE-A-LYZER™ G3 DIALYSIS CASSETTES, 10K MWCO.10 CASSETTES.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3208.97", "subtotal": "3208.97", "tax": "513.44", "other_taxes": null, "total": "3722.41" }, { "number": "0", "cucop_code": "25901-0011", "description": "CLOROFORM GRADO BIOLOGÍA MOLECULAR\nTHERMOSCIENTIFIC, CODIGO 15408689", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3110.85", "subtotal": "9332.55", "tax": "1493.21", "other_taxes": null, "total": "10825.76" }, { "number": "0", "cucop_code": "25501-0133", "description": "CRIOVIALES SAFESEAL MICROTUBE 2ML\nCRIOVIALES SAFESEAL MICROTUBE 2ML , PP (BOLSAS DE 250)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "167.31", "subtotal": "836.55", "tax": "133.85", "other_taxes": null, "total": "970.4" }, { "number": "0", "cucop_code": "25401-4613", "description": "DISOLUCIÓN AMORTIGUADORA O TAMPÓN PH 2 500ML\nDISOLUCIÓN AMORTIGUADORA O TAMPÓN PH 2 CON CERTIFICADO DE ANÁLISIS TRAZABLE A UN PATRÓN NACIONAL O INTERNACIONAL. BOTELLA DE 500 ML. CADUCIDAD MÍNIMA DE 12 MESES.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "539.4", "subtotal": "539.4", "tax": "86.3", "other_taxes": null, "total": "625.7" }, { "number": "0", "cucop_code": "25901-0011", "description": "ENZIMA DE RESTRICCIÓN SFII 1000 UNIDADES\nENZIMA DE RESTRICCIÓN SFII 1000 UNIDADES", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "997.27", "subtotal": "1994.54", "tax": "319.13", "other_taxes": null, "total": "2313.67" }, { "number": "0", "cucop_code": "25901-0011", "description": "INHIBIDOR\nRIBOLOCKTM RNASE INHIBITOR, THERMOSCIENTIFIC 40U /UL INHIBIDOR DE RNASAS 2500 UNITS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1506.97", "subtotal": "15069.7", "tax": "2411.15", "other_taxes": null, "total": "17480.85" }, { "number": "0", "cucop_code": "25901-0011", "description": "KIT DE PURIFICAIÓN DE PCR\nPCR CLEAN-UP MINI KIT (50 PREPS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1078.73", "subtotal": "1078.73", "tax": "172.6", "other_taxes": null, "total": "1251.33" }, { "number": "0", "cucop_code": "25901-0011", "description": "KIT PARA CLONAR PLASMIDOS\nKIT TOPO™ TA CLONING™ PARA SUBCLONACIÓN, SIN CÉLULAS COMPETENTES, 10 RXNS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4999.53", "subtotal": "4999.53", "tax": "799.92", "other_taxes": null, "total": "5799.45" }, { "number": "0", "cucop_code": "25901-0011", "description": "MARCADOR\nACCURULLER 100BP DNA LADDERS 50?G / 500?L (>150 LOADINGS)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1391.72", "subtotal": "2783.44", "tax": "445.35", "other_taxes": null, "total": "3228.79" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO PARA PRUEBAS SEROLÓGICAS CON 5 SPOTS.\nPAPEL FILTRO PARA PRUEBAS SEROLÓGICAS CON 5 SPOTS.TARJETA DE CINCO SPOTS CONSTITUIDA POR PAPEL ABSORBENTE CON UNA SUPERFICIE UNIFORME PARA LA TOMA DE MUESTRAS DE SANGRE, VIDA ÚTIL DE 3 A 5 AÑOS .", "unit": "PIEZA", "requested_quantity": "49", "awarded_quantity": null, "unit_price": "4551.42", "subtotal": "223019.58", "tax": "35683.13", "other_taxes": null, "total": "258702.71" }, { "number": "0", "cucop_code": "25901-0011", "description": "REACTIVOS COMPLEMENTARIOS DE LA PCR\nDNTP MIX, 10MM EACH, A SOLUTION CONTAINS 10MM DATP, 10MM DCTP, 10MM DGTP, AND 10MM DTTP", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "106.58", "subtotal": "213.16", "tax": "34.11", "other_taxes": null, "total": "247.27" }, { "number": "0", "cucop_code": "25501-0072", "description": "RECIPIENTES ESTÉRILES CON TAPA DE ROSCA\nRECIPIENTES ESTÉRILES CON TAPA DE ROSCA, CAPACIDAD DE 20 ML", "unit": "PIEZA", "requested_quantity": "100", "awarded_quantity": null, "unit_price": "108.23", "subtotal": "10823", "tax": "1731.68", "other_taxes": null, "total": "12554.68" }, { "number": "0", "cucop_code": "25901-0011", "description": "SUSTRATO\nSUSTRATO PARA REVELAR CON FOSFATASA (AP) NBT/BCIP (WB) 100-250 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4148.61", "subtotal": "4148.61", "tax": "663.78", "other_taxes": null, "total": "4812.39" }, { "number": "0", "cucop_code": "25901-0011", "description": "TETRAMETHYLETHYLENEDIAMINE\nTEMED GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1747.47", "subtotal": "1747.47", "tax": "279.6", "other_taxes": null, "total": "2027.07" }, { "number": "0", "cucop_code": "25401-7316", "description": "TUBO CONICO TIPO FALCON PARA CENTRIFUGA DE 50 ML\nTUBO DE 50 ML CON TAPA DE ROSCA, DE POLIPROPILENO, ESTERILES, DE POLIPROPILENO (PP) GRADUADOS, TAPÓN DE ROSCA, FONDO CÓNICO,ADECUADOS PARA APLICACIONES DE BIOLOGÍA MOLECULAR, COMO LA CONCENTRACIÓN DE BACTERIAS PARA EL AISLAMIENTO DE ADN, LA PURIFICACIÓN Y LA PRECIPITACIÓN DE ÁCIDOS NUCLEICOS, EL ALMACENAMIENTO DE MUESTRAS (A TEMPERATURA AMBIENTE DE HASTA – 80 °C) Y LA CENTRIFUGACIÓN DE PRECIPITADOS. SUPERFICIE HIDROFÓBICA BIOLÓGICAMENTE INERTE PARA UNA BUENA RECUPERACIÓN DE CÉLULAS O PROTEÍNAS,GRADUACIONES EN AZUL OSCURO EN INCREMENTOS DE 5 ML,EL ÁREA DE ESCRITURA BLANCA ES RESISTENTE A LOS DISOLVENTES,ESTERILIZADOS POR RADIACIÓN, POLIPROPILENO CLARIFICADO,RESISTENTE A ALCOHOLES Y DISOLVENTES ORGÁNICOS SUAVES (NO RECOMENDADO PARA PROCEDIMIENTOS DE EXTRACCIÓN),PARED TRANSLÚCIDA PARA FACILITAR LA VISUALIZACIÓN,ESTABLES ENTRE LOS – 80 °C Y LOS 121 °C (– 112 ° A 250 °F),SOPORTAN FUERZAS CENTRÍFUGAS DE UNA RCF DE HASTA 16 000 × G C/500 PZS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1245.7", "subtotal": "4982.8", "tax": "797.25", "other_taxes": null, "total": "5780.05" } ] }, { "id": "C-2023-00106957", "internal_reference": "DA-INSP-F059-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS SA DE CV", "normalized_name": "ACCESORIOS Y SUMINISTROS HOSPITALARIOS", "rfc_type": null, "slug": "accesorios-y-suministros-hospitalarios" }, "contract_period": { "published_at": "2023-09-13T00:28:39.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "63543", "tax": "10166.88", "total": "73709.88", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-7099", "description": "STM BUFFER\nSTM BUFFER (270MM SUCROSE, 10MM TRIS. HCI, PH 7.5, 1MM MGCI2), 1 LITER, G-BIOSCIENCES. CAT. 786-537", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6160", "subtotal": "12320", "tax": "1971.2", "other_taxes": null, "total": "14291.2" }, { "number": "0", "cucop_code": "25401-8158", "description": "TORNIQUETE VENOSO, MATERIAL: POLIÉSTER, SIN LÁTEX (\nLIGADURA)\nTORNIQUETE VENOSO, MATERIAL: POLIÉSTER, SIN LÁTEX , AJUSTABLES DE EMERGENCIA MÉDICA, PRIMEROS AUXILIOS, LIBERACIÓN RÁPIDA, CORREA ELÁSTICA PARA EXTERIORES, BANDA DE HEBILLA Y CLASE DE FLEBOTOMÍA\nLIGADURA)", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "855", "subtotal": "3420", "tax": "547.2", "other_taxes": null, "total": "3967.2" }, { "number": "0", "cucop_code": "25401-0506", "description": "TORUNDEROS DE PLÁSTICO BOCA ANCHA DE 250 ML\nFRASCOS RECTOS DE PLÁSTICO PET TRANSPARENTE - 16 OZ, TAPA BLANCA, TAPA A RAS BRINDA UNA APARIENCIA ELEGANTE.\nBOCA SUPERANCHA PARA LLENAR FÁCILMENTE.\nPET LIVIANO Y DURADERO.\nCUMPLE CON FDA.", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "92", "subtotal": "368", "tax": "58.88", "other_taxes": null, "total": "426.88" }, { "number": "0", "cucop_code": "25901-0011", "description": "TRIPTOSA\nTRIPTOSA BACTO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9555", "subtotal": "9555", "tax": "1528.8", "other_taxes": null, "total": "11083.8" }, { "number": "0", "cucop_code": "25901-0011", "description": "ULTRAPURE PHENOL CHLOROFORM: ISOAMYL ALCOHOL\nEL FENOL/CLOROFORMO/ALCOHOL ISOAMÍLICO ULTRAPURE™ (25:24:1, V/V) SE UTILIZA EN LA PURIFICACIÓN DE ÁCIDOS NUCLEICOS. ESTE REACTIVO CONSTA DE ALCOHOL ISOAMÍLICO, CLOROFORMO DE ALTA PUREZA Y FENOL ULTRAPURE™ SATURADO CON TRIS-HCL.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "22280", "subtotal": "22280", "tax": "3564.8", "other_taxes": null, "total": "25844.8" }, { "number": "0", "cucop_code": "25401-0549", "description": "BANDITAS ADHESIVAS REDONDAS\nVENDITAS ADHESIVAS, REDONDAS", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "78", "subtotal": "15600", "tax": "2496", "other_taxes": null, "total": "18096" } ] }, { "id": "C-2023-00106965", "internal_reference": "DA-INSP-F060-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "ASESORIA Y SERVICIO INTEGRAL BIOMEDICO SA DE CV", "normalized_name": "ASESORIA Y SERVICIO INTEGRAL BIOMEDICO", "rfc_type": null, "slug": "asesoria-y-servicio-integral-biomedico" }, "contract_period": { "published_at": "2023-09-13T01:47:35.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "13722", "tax": "2195.52", "total": "15917.52", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO (G)\nGUANTE PARA EXPLORACIÓN, LIBRE DE LÁTEX Y POLVO LUBRICANTE, NO ESTÉRIL, DE NITRILO SINTÉTICO, ACABADO TEXTURIZADO EN YEMA DE LOS DEDOS PARA UN MEJOR AGARRE, LIBRE DE PROTEÍNAS PROVENINETES DE LATEX, AMBIDIESTRO, COLOR AZUL Y TALLA GRANDE", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "142", "subtotal": "1420", "tax": "227.2", "other_taxes": null, "total": "1647.2" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO PARA EXPLORACIÓN, TALLA CHICA\nGUANTES DE NITRILO PARA EXPLORACIÓN, TEXTURIZADOS, NO ESTÉRILES, SIN POLVO, TALLA CHICA.", "unit": "PIEZA", "requested_quantity": "23", "awarded_quantity": null, "unit_price": "142", "subtotal": "3266", "tax": "522.56", "other_taxes": null, "total": "3788.56" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO PARA EXPLORACIÓN, TALLA MEDIANA\nGUANTES DE NITRILO PARA EXPLORACIÓN, TEXTURIZADOS, NO ESTÉRILES, SIN POLVO, TALLA MEDIANA.", "unit": "PIEZA", "requested_quantity": "33", "awarded_quantity": null, "unit_price": "142", "subtotal": "4686", "tax": "749.76", "other_taxes": null, "total": "5435.76" }, { "number": "0", "cucop_code": "25401-0612", "description": "SABANAS DESECHABLES\nSABANAS DESECHABLES 1.20X1.80", "unit": "PIEZA", "requested_quantity": "30", "awarded_quantity": null, "unit_price": "145", "subtotal": "4350", "tax": "696", "other_taxes": null, "total": "5046" } ] }, { "id": "C-2023-00106972", "internal_reference": "DA-INSP-F062-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "BRI BIORESEARCH SA DE CV", "normalized_name": "BRI BIORESEARCH", "rfc_type": null, "slug": "bri-bioresearch" }, "contract_period": { "published_at": "2023-09-13T00:39:27.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "10165", "tax": "1626.4", "total": "11791.4", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0011", "description": "AGAROSA GRADO BIOLOGIA MOLECULAR POLÍMERO DE SUBUNIDADES DE AGAROBIOSA (L- Y D-GALACTOSA). SE EXPLOTA PARA LA SEPARACIÓN DE ÁCIDOS NUCLEICOS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8683", "subtotal": "8683", "tax": "1389.28", "other_taxes": null, "total": "10072.28" }, { "number": "0", "cucop_code": "25901-0011", "description": "MARCADOR DE PESO MOLECULAR DNA LADDER.\nMARCADOR DE 11 FRAGMENTOS, DESDE 100PB HASTA 1,000PB, CON INCREMENTOS DE 100PB, Y UNA BANDA ADICIONAL DE 1,500PB. PRESENTA UNA BANDA DE ALTA INTENSIDAD A 500PB. NO ESTÁ DISEÑADO PARA ANÁLISIS CUANTITATIVOS. INCLUYE: MARCADOR DE 100PB DNA LADDER Y 'BUFFER DE CARGA BLUE/ORANGE 6X. PRESENTACIÓN: 250 ¿L.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1482", "subtotal": "1482", "tax": "237.12", "other_taxes": null, "total": "1719.12" } ] }, { "id": "C-2023-00106980", "internal_reference": "DA-INSP-F063-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE SA DE CV", "normalized_name": "DISTRIBUCION Y MANTENIMIENTO DEL NOROESTE", "rfc_type": null, "slug": "distribucion-y-mantenimiento-del-noroeste" }, "contract_period": { "published_at": "2023-09-13T00:41:57.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1232", "tax": "197.12", "total": "1429.12", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO CHICO 100\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO CHICO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "154", "subtotal": "308", "tax": "49.28", "other_taxes": null, "total": "357.28" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO GRANDES\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO GRANDE", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "154", "subtotal": "616", "tax": "98.56", "other_taxes": null, "total": "714.56" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DE NITRILO T.MEDIANO LIBRES POL\nCAJAS CON 100 PIEZAS. LIBRE DE POLVO. TAMAÑO MEDINO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "154", "subtotal": "308", "tax": "49.28", "other_taxes": null, "total": "357.28" } ] }, { "id": "C-2023-00106983", "internal_reference": "DA-INSP-F064-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "GARKEN MEDICAL SA DE CV", "normalized_name": "GARKEN MEDICAL", "rfc_type": null, "slug": "garken-medical" }, "contract_period": { "published_at": "2023-09-13T00:46:34.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "15258.91", "tax": "2441.42", "total": "17700.33", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0505", "description": "ALGODÓN (BOLSA GRANDE DE TORUNDAS), DE 500 GR\nTORUNDA BOLITA DE ALGODÓN NO ESTERILIZADO 100% ALGODÓN 500G, MATERIAL DE CURACIÓN", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "92.86", "subtotal": "742.86", "tax": "118.86", "other_taxes": null, "total": "861.72" }, { "number": "0", "cucop_code": "25401-0161", "description": "BANDAS ADHESIVAS REDONDAS.\nBANDAS ADHESIVAS REDONDAS CON APÓSITO ESPONJOSO, (REDONDOS), 2.2 CM X 2.2 CM, CURAS REDODONDO IMPERMEABLES.", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "52.86", "subtotal": "1057.14", "tax": "169.14", "other_taxes": null, "total": "1226.28" }, { "number": "0", "cucop_code": "25401-0120", "description": "CINTA TESTIGO\nCINTA ADHESIVA TESTIGO PARA ESTÉRILIZAR EN VAPOR. DIMENSIONES 19MM X 50 M.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "77.03", "subtotal": "154.06", "tax": "24.65", "other_taxes": null, "total": "178.71" }, { "number": "0", "cucop_code": "25401-0230", "description": "GASA DE ALGODÓN, NO ESTÉRIL, 7.5 X 5 CM.\nGASA DE ALGODÓN, NO ESTÉRIL 7.5 X 5 CM, CAJA CON 200 PIEZAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "79.71", "subtotal": "797.14", "tax": "127.54", "other_taxes": null, "total": "924.68" }, { "number": "0", "cucop_code": "25401-8052", "description": "TUBO VACUTAINER 10ML TAPA ROJA\nTUBOS PARA EXTRACCIÓN DE SUERO, SILICÓN, 16 X 100 MM, 10.0 ML", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "508.87", "subtotal": "5088.71", "tax": "814.19", "other_taxes": null, "total": "5902.9" }, { "number": "0", "cucop_code": "25401-8052", "description": "TUBO VACUTAINER C/EDTA-K2\nTUBO VACUTAINER C/EDTA-K2, 13X100, 6ML TAPÓN MORADO", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "741.9", "subtotal": "7419", "tax": "1187.04", "other_taxes": null, "total": "8606.04" } ] }, { "id": "C-2023-00106990", "internal_reference": "DA-INSP-F065-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "GENES2LIFE S A P I DE CV", "normalized_name": "GENES2LIFE", "rfc_type": null, "slug": "genes2life" }, "contract_period": { "published_at": "2023-09-13T00:55:35.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "45847.8", "tax": "7335.65", "total": "53183.45", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-7660", "description": "ACETONA. GALÓN\nGALON 4LTS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "654", "subtotal": "654", "tax": "104.64", "other_taxes": null, "total": "758.64" }, { "number": "0", "cucop_code": "25401-7828", "description": "AGAROSA PARA ELECTROFORESIS\nAGAROSA PARA ELECTROFORESIS. FRASCO CON 100 G. TA.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2914.8", "subtotal": "5829.6", "tax": "932.74", "other_taxes": null, "total": "6762.34" }, { "number": "0", "cucop_code": "25401-4561", "description": "ALCOHOL AL 70%. PRESENTACIÓN DE 1 GALÓN\nALCOHOL ETILICO AL 70%. PRESENTACIÓN DE 1 GALÓN", "unit": "GALON", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "304.2", "subtotal": "304.2", "tax": "48.67", "other_taxes": null, "total": "352.87" }, { "number": "0", "cucop_code": "25401-7723", "description": "ALCOHOL ISOPROPILICO\nALCOHOL ISOPROPILICO. RA. ACS. FRASCO CON 1000 ML. TA.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "350", "subtotal": "700", "tax": "112", "other_taxes": null, "total": "812" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA 305423-S (TGACACAAATGATTTTCATACAAAAGTCGAGA)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 305423-S (TGACACAAATGATTTTCATACAAAAGTCGAGA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA 356043-S (CTCTAGAGATCCGTCAACATGGTGGAGCAC)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 356043-S (CTCTAGAGATCCGTCAACATGGTGGAGCAC)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA 603-S (TGGTACCACGCGACACACTTCCACTC)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA 603-S (TGGTACCACGCGACACACTTCCACTC)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA ADH1 S (CTTAGGGGCAGACTCCCGTGTTCCCT)\nSONDAS PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA ADH1 S (CTTAGGGGCAGACTCCCGTGTTCCCT", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA P35S S (CCCACTATCCTTCGCAAGACCCTTCCT)\nSONDAS, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA.SECUENCIA P35S S (CCCACTATCCTTCGCAAGACCCTTCCT)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA TNOS S (ATGGGTTTTTATGATTAGAGTCCCGCAA)\nSONDAS, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA TNOS S (ATGGGTTTTTATGATTAGAGTCCCGCAA)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" }, { "number": "0", "cucop_code": "25401-0091", "description": "SONDAS SECUENCIA: 4032-S (CCTTTTCCATTTGGG)\nSONDA, PARA REACCIÓN PCR TIEMPO REAL, ESCALA DE SÍNTESIS 6,000 PICOMOLES, PUREZA HPLC, LIOFILIZADAS DE 20 A 30 PB. VIAL DE 6000 PICOMOLES. VIGENCIA MÍNIMA DE 8 MESES A PARTIR DE LA ENTREGA. SECUENCIA: 3032-S (CCTTTTCCATTTGGG)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5480", "subtotal": "5480", "tax": "876.8", "other_taxes": null, "total": "6356.8" } ] }, { "id": "C-2023-00106993", "internal_reference": "DA-INSP-F066-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "HI - TEC MEDICAL DEL SUR SA DE CV", "normalized_name": "HI TEC MEDICAL DEL SUR", "rfc_type": null, "slug": "hi-tec-medical-del-sur" }, "contract_period": { "published_at": "2023-09-13T00:59:39.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "5412.87", "tax": "866.06", "total": "6278.93", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0011", "description": "PEROXIDO DE HIDROGENO\nPERÓXIDO DE HIDRÓGENO AL 30% DE 100 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "403.67", "subtotal": "403.67", "tax": "64.59", "other_taxes": null, "total": "468.26" }, { "number": "0", "cucop_code": "25401-0480", "description": "TAPAS DE ROSCA VERDE DE POLIPROPILENO\nTAPAS DE ROSCA VERDE DE POLIPROPILENO, CON SEPTA DE SILICÓN ROJO DE ALTA CALIDAD LAMINADO CON PTFE 0.005, RECOMENDADO PARA APLICACIONES DE INYECCIÓN MÚLTIPLE. PARA VIALES DE 2 ML DE BOCA ANCHA (9MM) PARA AUTOMUESTREADOR. PAQUETE DE 100 PIEZAS.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "500.92", "subtotal": "5009.2", "tax": "801.47", "other_taxes": null, "total": "5810.67" } ] }, { "id": "C-2023-00106997", "internal_reference": "DA-INSP-F067-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "LAUKA MEXICANA SA DE CV", "normalized_name": "LAUKA MEXICANA", "rfc_type": null, "slug": "lauka-mexicana" }, "contract_period": { "published_at": "2023-09-13T01:05:36.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "127537", "tax": "20405.92", "total": "147942.92", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0018", "description": "AGAR MAC CONKEY MEDIOS DE CULTIVO BACTERIANO MCCONKEY PARA CULTIVOS BACTERIANOS", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "1192", "subtotal": "8344", "tax": "1335.04", "other_taxes": null, "total": "9679.04" }, { "number": "0", "cucop_code": "25901-0011", "description": "AGAR SOYA TRIPTICASA (TSA) MEDIO NUTRITIVO GENERAL PARA EL CRECIMIENTO Y AISLAMIENTO DE BACTERIAS AERÓBICAS Y ANAERÓBICAS.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1068", "subtotal": "2136", "tax": "341.76", "other_taxes": null, "total": "2477.76" }, { "number": "0", "cucop_code": "25301-3534", "description": "AZITROMICINA\nAZITROMICINA SAL. POTENCIA: =98%.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8750", "subtotal": "8750", "tax": "1400", "other_taxes": null, "total": "10150" }, { "number": "0", "cucop_code": "25501-0130", "description": "BULBO DE LATEX PARA PIPETA PASTEUR DE 2ML 52X13X6 MN\nBULBO DE LATEX PARA PIPETA PASTEUR DE 2ML 52X13X6 MN", "unit": "PIEZA", "requested_quantity": "209", "awarded_quantity": null, "unit_price": "11", "subtotal": "2299", "tax": "367.84", "other_taxes": null, "total": "2666.84" }, { "number": "0", "cucop_code": "25401-7372", "description": "CLOROFORMO\nCLOROFORMO. RA. ACS. FRASCO CON 2500 ML.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2150", "subtotal": "2150", "tax": "344", "other_taxes": null, "total": "2494" }, { "number": "0", "cucop_code": "25301-0571", "description": "CLORURO DE SODIO\nCLORURO DE SODIO CAT. S9888", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "244", "subtotal": "488", "tax": "78.08", "other_taxes": null, "total": "566.08" }, { "number": "0", "cucop_code": "25901-0011", "description": "CRISTAL VIOLETA\nCRISTAL VIOLETA CON UNA SOLUBILIDAD EN AGUA DE 1 MG/ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "265", "subtotal": "265", "tax": "42.4", "other_taxes": null, "total": "307.4" }, { "number": "0", "cucop_code": "25901-0011", "description": "FOSFATO DE POTASIO MONOBÁSICO.\nFRASCO 500 GRS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "545", "subtotal": "545", "tax": "87.2", "other_taxes": null, "total": "632.2" }, { "number": "0", "cucop_code": "25901-0011", "description": "FOSFATO DE POTASIO. DIBASICO., ANHIDRO, GRANULAR, A.C.S.\nFRASCO DE 500G,", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "572", "subtotal": "572", "tax": "91.52", "other_taxes": null, "total": "663.52" }, { "number": "0", "cucop_code": "25901-0011", "description": "FOSFATO DE SODIO MONOBASICO. FRASCO -500 GRAMOS\nFRACO CON 500 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "476", "subtotal": "476", "tax": "76.16", "other_taxes": null, "total": "552.16" }, { "number": "0", "cucop_code": "25401-0230", "description": "GASA DE ALGODÓN\nGASA DE ALGODÓN 100%, ESTÉRIL, DIMENSIONES: 10 X 10 CM. PAQUETE CON 100 GASAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "230", "subtotal": "690", "tax": "110.4", "other_taxes": null, "total": "800.4" }, { "number": "0", "cucop_code": "25901-0011", "description": "LISOZIMA\nENZIMA EN POLVO CON 250 MG", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3990", "subtotal": "19950", "tax": "3192", "other_taxes": null, "total": "23142" }, { "number": "0", "cucop_code": "25401-6174", "description": "LONGITUD TOTAL 40CM. D ECRDAS 16CM\nESCOBILLÓN DE CERDAS PARA FRASCOS", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "40", "subtotal": "240", "tax": "38.4", "other_taxes": null, "total": "278.4" }, { "number": "0", "cucop_code": "25401-6571", "description": "PIPETAS TRANSFERENCIA\nPIPETAS TRANSFERENCIA 5 ML DE CAPACIDAD", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "2.55", "subtotal": "510", "tax": "81.6", "other_taxes": null, "total": "591.6" }, { "number": "0", "cucop_code": "25301-1023", "description": "POTASSIUM PHOSPHATE MONOBASIC\nPOTASSIUM PHOSPHATE MONOBASIC CAT. 795488", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1530", "subtotal": "3060", "tax": "489.6", "other_taxes": null, "total": "3549.6" }, { "number": "0", "cucop_code": "25901-0011", "description": "PROTEINASA K\nPOLVO LIOFILIZADO, =30 UNIDADES/MG PROTEÍNA, GRADO BIOLOGÍA MOLECULAR", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1900", "subtotal": "5700", "tax": "912", "other_taxes": null, "total": "6612" }, { "number": "0", "cucop_code": "25401-6682", "description": "PUNTA CON FILTRO PARA PIPETA\nPUNTA CON FILTRO PARA PIPETA DE 1 A 10 MICROLITROS. LIBRES DE RNAASA DNAASA Y PIROGENOS. RESISTEN LA ESTERILIZACION EN AUTOCLAVE. SEÑALAR LA MARCA Y MODELO DE PIPETA QUE SE VA A EMPLEAR. ENVASE CON MÍNIMO 960 PIEZAS.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1070", "subtotal": "2140", "tax": "342.4", "other_taxes": null, "total": "2482.4" }, { "number": "0", "cucop_code": "25401-6680", "description": "PUNTAS AZULES\nPUNTAS AZULES DE 1000 UL LIBRE DE DNASA Y RNASA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "290", "subtotal": "870", "tax": "139.2", "other_taxes": null, "total": "1009.2" }, { "number": "0", "cucop_code": "25401-6679", "description": "PUNTAS DE PP AMARILLAS\nPUNTAS DE PP AMARILLAS DE 200UL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "170", "subtotal": "510", "tax": "81.6", "other_taxes": null, "total": "591.6" }, { "number": "0", "cucop_code": "25401-6678", "description": "PUNTAS PARA PIPETA 1000¿L\nPUNTA PARA PIPETA 1000¿L (BOLSA DE 1000 PIEZAS)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "290", "subtotal": "290", "tax": "46.4", "other_taxes": null, "total": "336.4" }, { "number": "0", "cucop_code": "25901-0011", "description": "TAQ DNA POLYMERASE, RECOMBINANT 500 UNITS\nVIAL CON 500 UNIDADES", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1975", "subtotal": "19750", "tax": "3160", "other_taxes": null, "total": "22910" }, { "number": "0", "cucop_code": "25501-0045", "description": "TIRAS PARA PCR DE 8 TUBOS DE 0.2 ML CON TAPA\nTIRAS PARA PCR DE 8 TUBOS DE 0.2 ML CON TAPA (1000 PIEZAS POR BOLSA)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1440", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25401-8029", "description": "TUBO PARA PCR\nTUBO PARA PCR DE 0.2ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "633", "subtotal": "2532", "tax": "405.12", "other_taxes": null, "total": "2937.12" }, { "number": "0", "cucop_code": "25501-0050", "description": "TUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML.\nTUBOS CRIOGENICOS (CRIOTUBO) DE 2 ML TAPA COLOR ROJO ESTÉRILES GRADUADOS CON FALDÓN QUE SOPORTEN TEMPERATURAS A -196 °C . FABRICADO EN PROPILENO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5895", "subtotal": "17685", "tax": "2829.6", "other_taxes": null, "total": "20514.6" }, { "number": "0", "cucop_code": "25501-0050", "description": "TUBOS CRIOGENICOS (CRIOTUBO)DE 2 ML.\nTUBOS CRIOGENICOS (CRIOTUBO)DE 2 ML TAPA COLOR AZUL CIELO ESTÉRILES GRADUADOS CON FALDÓN QUE SOPORTEN TEMPERATURAS A -196 °C. FABRICADO EN PROPILENO", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5895", "subtotal": "17685", "tax": "2829.6", "other_taxes": null, "total": "20514.6" }, { "number": "0", "cucop_code": "25401-0523", "description": "TUBOS RECOLECCIÓN ESTÉRIL 50 ML FALCON\nTUBO RECOLECCIÓN ESTÉRIL 50 ML FALCON", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "13.5", "subtotal": "2700", "tax": "432", "other_taxes": null, "total": "3132" } ] }, { "id": "C-2023-00107000", "internal_reference": "DA-INSP-F068-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "SISTEMAS BIOMEDICOS DE DIAGNOSTICO SA DE CV", "normalized_name": "SISTEMAS BIOMEDICOS DE DIAGNOSTICO", "rfc_type": null, "slug": "sistemas-biomedicos-de-diagnostico" }, "contract_period": { "published_at": "2023-09-13T01:09:56.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "20262.2", "tax": "3241.96", "total": "23504.16", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0149", "description": "CUBREBOCAS TRIPLE CAPA\nCUBREBOCAS TRIPLE CAPA, PLISADO CON AJUSTE NASAL, 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "42.3", "subtotal": "676.8", "tax": "108.29", "other_taxes": null, "total": "785.09" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO CHICO.\nGUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO CHICO, LUBRICADO CON POLVO ABSORBENTE", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "198.4", "subtotal": "1388.8", "tax": "222.21", "other_taxes": null, "total": "1611.01" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO MEDIANO.\nGUANTES DESECHABLES DE LÁTEX O DE POLIETILENO ESTÉRILES TAMAÑO MEDIANO, LUBRICADO CON POLVO ABSORBENTE", "unit": "PIEZA", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "198.4", "subtotal": "2777.6", "tax": "444.42", "other_taxes": null, "total": "3222.02" }, { "number": "0", "cucop_code": "25401-0242", "description": "GUANTES PARA EXPLORACIÓN\nGUANTES PARA EXPLORACIÓN", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "2.2", "subtotal": "440", "tax": "70.4", "other_taxes": null, "total": "510.4" }, { "number": "0", "cucop_code": "25401-8102", "description": "ESTADÍMETRO CON CINTA METÁLICA DE 220 CM DE LARGO CON UNA PRESICIÓN DE 1 MM, DE ESCUADRA MOVIL DE PLASTICO RÍGIDO , CON UN ÁNGULO DE 90°.\nESTADÍMETRO CON CINTA METÁLICA DE 220 CM DE LARGO CON UNA PRESICIÓN DE 1 MM, DE ESCUADRA MOVIL DE PLASTICO RÍGIDO , CON UN ÁNGULO DE 90°.", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "998.6", "subtotal": "14979", "tax": "2396.64", "other_taxes": null, "total": "17375.64" } ] }, { "id": "C-2023-00107002", "internal_reference": "DA-INSP-F069-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "DISTRIBUIDORA INTEGRAL DE ANALISIS CLINICOS SA DE CV", "normalized_name": "DISTRIBUIDORA INTEGRAL DE ANALISIS CLINICOS", "rfc_type": null, "slug": "distribuidora-integral-de-analisis-clinicos" }, "contract_period": { "published_at": "2023-09-13T01:12:47.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "38274", "tax": "6123.84", "total": "44397.84", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0015", "description": "AGUJAS HIPODÉRMICAS PARA TOMA MÚLTIPLE CALIBRE 21.\nAGUJAS HIPODÉRMICAS PARA TOMA MÚLTIPLE CALIBRE 21 COLOR VERDE 21G X 1.5 \" (0.8 X 38 MM). PRESICIÓN GLIDE CAJA CON 100", "unit": "PIEZA", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "358", "subtotal": "5728", "tax": "916.48", "other_taxes": null, "total": "6644.48" }, { "number": "0", "cucop_code": "25101-0052", "description": "GLICEROL\nGLICEROL GRADO REACTIVO", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "427", "subtotal": "854", "tax": "136.64", "other_taxes": null, "total": "990.64" }, { "number": "0", "cucop_code": "25501-0050", "description": "MICROTAINER (TUBOS CON K2 EDTA DE 500 MICROLITROS)\nTUBO MICROTAINER PARA COLECCIÓN DE SANGRE CAPILAR CON EDTA, COLOR LILA: CÓDIGO 365974; 250-500 ¿L, CLAVE SS: 080.909.5599 CAJA C/200 PZAS. MATERIAL: DE PLÁSTICO CON RECUBRIMIENTO CON EDTA K2 COMO ADITIVO.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "2307", "subtotal": "23070", "tax": "3691.2", "other_taxes": null, "total": "26761.2" }, { "number": "0", "cucop_code": "25501-0050", "description": "TUBOS DE PLÁSTICO DE 3 ML AL VACIÓ.\nTUBOS DE PLÁSTICO DE 3 ML AL VACIÓ, VACUTAINER CON TAPÓN COLOR MORADO, CON ANTICOAGULANTE (EDTA).", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "479", "subtotal": "8622", "tax": "1379.52", "other_taxes": null, "total": "10001.52" } ] }, { "id": "C-2023-00107005", "internal_reference": "DA-INSP-F071-2023", "title": "ADQUISICIÓN DE MATERIALES SUMINISTROS MÉDICOS Y LABORATORIO PARA LA ENSANUT", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2023-09-13T01:30:41.000Z", "starts_at": "2023-09-12T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "56244.79", "tax": "8999.16", "total": "65243.95", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-0019", "description": "AGAR MUELLER HINTON MEDIOS DE CULTIVO BACTERIANO MULLER HINTON PARA CULTIVOS BACTERIANOS. AJUSTADO CON CATIONES", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "1496.88", "subtotal": "10478.16", "tax": "1676.51", "other_taxes": null, "total": "12154.67" }, { "number": "0", "cucop_code": "25901-0011", "description": "AGAR MUELLER HINTON MEDIOS DE CULTIVO BACTERIANO MULLER HINTON PARA CULTIVOS BACTERIANOS. NO AJUSTADO CON CATIONES", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1496.88", "subtotal": "7484.4", "tax": "1197.5", "other_taxes": null, "total": "8681.9" }, { "number": "0", "cucop_code": "25401-7837", "description": "BROMURO DE ETIDIO\nBROMURO DE ETIDIO (BROMURO DE 7-DIAMINO-10-ETIL-9-FENIL-FENENTRIDINIO). GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 G. TA.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1656.34", "subtotal": "3312.68", "tax": "530.03", "other_taxes": null, "total": "3842.71" }, { "number": "0", "cucop_code": "25501-0101", "description": "CAJAS DE CARTON PARA ALMACENAR MUESTRAS\nCAJA DE CARTÓN PLASTIFICADO, PARA ALMACENAMIENTO, COLOR BLANCO, PARA USO EN ULTRACONGELADOR (-80°), DE 9X9 ESPACIOS, DIMENSIONES: 13X13X5 CM, CRIOTUBOS DE 2 ML", "unit": "PIEZA", "requested_quantity": "250", "awarded_quantity": null, "unit_price": "40.28", "subtotal": "10070", "tax": "1611.2", "other_taxes": null, "total": "11681.2" }, { "number": "0", "cucop_code": "25901-0011", "description": "CALDO SOYA TRIPTICASA (TSB)\nMEDIO NUTRITIVO GENERAL PARA EL CRECIMIENTO Y AISLAMIENTO DE BACTERIAS AERÓBICAS Y ANAERÓBICAS.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "872.76", "subtotal": "1745.52", "tax": "279.28", "other_taxes": null, "total": "2024.8" }, { "number": "0", "cucop_code": "25401-7929", "description": "DNA POLYMERASE\nDNA POLYMERASE DNA POLIMERASA DE THERMUS AQUATICUS. (TAQ-POLIMERASA) RECOMBINANTE. GRADO BIOLOGIA MOLECULAR. FRASCO CON 5 UNIDADES/MICROLITRO. C (-20 °C 0 °C).", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2012.86", "subtotal": "10064.3", "tax": "1610.29", "other_taxes": null, "total": "11674.59" }, { "number": "0", "cucop_code": "25901-0011", "description": "DNTP MIX 10MM EACH 2.0ML\nCONJUNTO DE DNTP (100 MM)100 MM (DE CADA UNO) DE DATP, DCTP, DGTP Y DTTP.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "547.2", "subtotal": "1094.4", "tax": "175.1", "other_taxes": null, "total": "1269.5" }, { "number": "0", "cucop_code": "25901-0011", "description": "DNTP MIX 10MM EACH 2.0ML\nCONJUNTO DE DNTP (100 MM)100 MM (DE CADA UNO) DE DATP, DCTP, DGTP Y DTTP.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "547.2", "subtotal": "1094.4", "tax": "175.1", "other_taxes": null, "total": "1269.5" }, { "number": "0", "cucop_code": "25901-0011", "description": "ENZIMA\nDNASA 1, 1000U (1U/UL) THERMOSCIENTIFIC", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "971.28", "subtotal": "2913.84", "tax": "466.21", "other_taxes": null, "total": "3380.05" }, { "number": "0", "cucop_code": "25901-0011", "description": "EXTRACTO DE LEVADURA\nINGREDIENTE PARA MEDIO DE CULTIVO", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1083.6", "subtotal": "1083.6", "tax": "173.38", "other_taxes": null, "total": "1256.98" }, { "number": "0", "cucop_code": "25901-0011", "description": "INFUNCION DE HIGADO\nLIVER INFUSION BROTH F", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3331.65", "subtotal": "3331.65", "tax": "533.06", "other_taxes": null, "total": "3864.71" }, { "number": "0", "cucop_code": "25401-8028", "description": "TUBO P/CENTRIFUGA CONICO.\nCENTRIFUGA C/TAPA ROSCA DE 50ML, POLIPROPILENO, PAQUETE 50 PZAS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "621.6", "subtotal": "621.6", "tax": "99.46", "other_taxes": null, "total": "721.06" }, { "number": "0", "cucop_code": "25901-0011", "description": "WIZARD SV GEL AND PCR CLEAN-UP\nWIZARD SV GEL AND PCR CLEAN-UP", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2950.24", "subtotal": "2950.24", "tax": "472.04", "other_taxes": null, "total": "3422.28" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "CONVOCATORIA", "filename": "Convocatoria Versión para CompraNet.pdf", "availability": "available", "size_bytes": "1410224", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:58:14.412Z", "updated_at": "2025-12-03T01:58:14.413Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO PREVIO A LA JUNTA DE ACLARACIONES", "filename": "Cambio de Día de la Junta de Aclaración a la Convocatoria.pdf", "availability": "available", "size_bytes": "406759", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:58:15.989Z", "updated_at": "2025-12-03T01:58:15.990Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "ACTA DE DIFERIMIENTO DE FALLO.pdf", "availability": "available", "size_bytes": "236781", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:24.284Z", "updated_at": "2025-12-03T01:59:24.286Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "SEGUNDA ACTA DE DIFERIMIENTO DE FALLO.pdf", "availability": "available", "size_bytes": "253803", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:26.095Z", "updated_at": "2025-12-03T01:59:26.097Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "AVISO DE DIFERIMIENTO DE FALLO", "filename": "TERCERA ACTA DE DIFERIMIENTO DE FALLO.pdf", "availability": "available", "size_bytes": "94048", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:27.867Z", "updated_at": "2025-12-03T01:59:27.868Z" }, { "id": null, "annex_number": 2, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "Anexo.xlsx", "availability": "available", "size_bytes": "31646", "mime_type": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "sha256": null, "uploaded_at": "2025-12-03T01:58:07.395Z", "updated_at": "2025-12-03T01:58:07.396Z" }, { "id": null, "annex_number": 3, "document_type": null, "description": "MODELO DE CONTRATO", "filename": "20230804_LAASSP_BIENES.docx", "availability": "available", "size_bytes": "65718", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2025-12-03T01:58:09.027Z", "updated_at": "2025-12-03T01:58:09.028Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "NOTA ACLARATORIA DONDE SE ELIMINAN TRES PARTIDAS DEL ANEXO TÉCNICO", "filename": "Nota aclaratoria donde se eliminan tres partidas del Anexo Técnico del formato â¿¿xlsx⿝.xlsx", "availability": "available", "size_bytes": "32062", "mime_type": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "sha256": null, "uploaded_at": "2025-12-03T01:58:17.517Z", "updated_at": "2025-12-03T01:58:17.519Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "ACTA JUNTA DE ACLARACIONES", "filename": "ACTA DE JUNTA DE ACLARACIONES.pdf", "availability": "available", "size_bytes": "1388162", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:58:21.193Z", "updated_at": "2025-12-03T01:58:21.194Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "ACTA CIERRE JUNTA DE ACLARACIONES", "filename": "ACTA DE CIERRE JUNTA DE ACLARACIONES.pdf", "availability": "available", "size_bytes": "502813", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:58:23.694Z", "updated_at": "2025-12-03T01:58:23.695Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "ACTA DE APERTURA DE PROPOSICIONES", "filename": "ACTA DE PRESENTACIÿN Y APERTURA DE PROPOSICIONES.pdf", "availability": "available", "size_bytes": "20279761", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:22.309Z", "updated_at": "2025-12-03T01:59:22.310Z" }, { "id": null, "annex_number": 14, "document_type": null, "description": "ACTA DE FALLO", "filename": "Acta fallo.pdf", "availability": "available", "size_bytes": "1909560", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:32.862Z", "updated_at": "2025-12-03T01:59:32.863Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "FE DE ERRATAS FALLO", "filename": "FE DE ERRATAS FALLO.pdf", "availability": "available", "size_bytes": "403693", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T01:59:38.062Z", "updated_at": "2025-12-03T01:59:38.063Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "la-12-nde-012nde001-i-127-2025", "nombre_procedimiento": "REACTIVOS ANALÍTICOS Y MATERIAL DE LABORATORIO DE DIRECCION MEDICA Y DE INVESTIG", "dependencia": "INPER", "siglas": "INPER", "score": 0.09985625743865967 }, { "numero_procedimiento": "la-77-014-918032996-t-39-2025", "nombre_procedimiento": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "dependencia": "SSN", "siglas": "SSN", "score": 0.1013045967402798 }, { "numero_procedimiento": "la-12-nde-012nde001-i-174-2023", "nombre_procedimiento": "SUSTANCIAS QUÍMICAS, REACTIVOS ANALÍTICOS, MATERIALES DE CURACIÓN Y LABORATORIO.", "dependencia": "INPER", "siglas": "INPER", "score": 0.10482988073914845 }, { "numero_procedimiento": "la-38-9zy-0389zy998-n-98-2026", "nombre_procedimiento": "2026 LP3 - PASAJES, SERVICIOS DE MANTENIMIENTO Y ADQUISICIÓN DE INSUMOS DE LAB", "dependencia": "CENTRO DE INVESTIGACION EN ALIMENTACION Y DESARROLLO, A.C.", "siglas": "CIAD", "score": 0.10537452133741942 }, { "numero_procedimiento": "la-08-b00-008b00001-i-187-2025", "nombre_procedimiento": "ADQUISICIÓN PRODUCTOS QUÍMICOS, MATERIALES Y SUMINISTROS DE LABORATORIO", "dependencia": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "siglas": "SENASICA", "score": 0.10905747305661129 }, { "numero_procedimiento": "la-62-o27-903006996-n-5-2023", "nombre_procedimiento": "ADQUISICIÓN DE EQUIPO MÉDICO, MATERIALES, ACCESORIOS Y SUMINISTROS PARA EL LABOR", "dependencia": "SECRETARÍA DE SALUD (BCS)", "siglas": "SSBCS", "score": 0.11201858520507812 } ] }