{ "html_url": "https://licitia.com.mx/licitacion/la-77-014-918032996-t-39-2025", "canonical": "https://licitia.com.mx/licitacion/la-77-014-918032996-t-39-2025", "id": "d3362eeee4f84bd39d8bb5808b4136d1", "procedure_number": "LA-77-014-918032996-T-39-2025", "file_number": "E-2025-00106697", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "description": { "short": null, "detailed": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO PARCIAL", "moved_at": "2026-01-11T01:23:23.960Z" }, "buyer": { "agency": "SSN", "acronym": "SSN", "branch": "77 - NAYARIT", "buying_unit": "DIRECCIÓN DE ADMINISTRACIÓN", "requesting_unit": "unidad requiriente data", "requesting_group": "DIRECCIÓN DE ADMINISTRACIÓN", "entity": "TESORERÍA DE LA FEDERACIÓN", "slug": "ssn", "unit_slug": "direccion-de-administracion-918032996" }, "classification": { "procedure_type": "LICITACIÓN PÚBLICA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "INTERNACIONAL BAJO LA COBERTURA DE TRATADOS", "fiscal_year": 2025, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": null, "exception_basis": null, "internal_control_number": "SSN-DRMSG-LPT-10-2025", "supply_source_number": null }, "schedule": { "published_at": "2025-11-11T19:26:48.000Z", "clarification_meeting_at": "2025-11-14T19:00:00.000Z", "clarification_questions_deadline_at": "2025-11-13T19:00:00.000Z", "clarification_responses_deadline_at": null, "bid_opening_at": "2025-11-21T19:00:00.000Z", "award_at": "2025-12-01T19:00:00.000Z", "estimated_contract_at": "2025-12-05T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "CEFTAZIDIMA SODICA PENTAHIDRATADA. FRASCO DE 500 MG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "2", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "KIT DIGITAL PARA DETERMINACIÓN DE CLORO RESIDUAL Y PH, COLORIMETRO DIGITAL PARA CLORO RESIDUAL, PORTATIL. INTERVALO DE MEDICION DE 0.0 A 2.5 PPM, RESOLUCION 0.01, EXACTITUD +/- 0.03 +/- 3% DE LAL LECTURA. FUENTE DE LUZ: LED A 525 NM, DETECTOR DE LUZ: FOTOCELDA DE SILICIO. CAT HI701", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "3", "cucop_code": "25301-3575", "specific_item_code": "25301", "cucop_description": "PRUEBA DE DETECCION DEL SARS-COV-2 (COVID-19)", "description": "KIT FLU-COVID RT-PCR, KIT DE DIAGNOSTICO P/DETECCION DE RNA DEL VIRUS INFLUENZA A (FLUA) INFLUENZA B (FLUB) Y SARS-COV-2 MEDIANTE ONE-STEP REAL-TIME RT-PCR", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "4", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PASTILLAS DPD PAQUETE CON 1000 TABLETAS.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "5", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PASTILLAS DPD PAQUETE CON 1000 TABLETAS.", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "6", "cucop_code": "25401-0420", "specific_item_code": "25401", "cucop_description": "PROTECTOR PULPAR PARA SELLAR CAVIDADES, DENTALES", "description": "PROTECTOR PULPAR PARA SELLAR CAVIDADES DENTALES", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "7", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "AAGCCAACACCCGGCCATTATGGT, 50 NMOL, HPLC, 24 BASES, 5-FAM, 3-TAMRA T4 OLIGO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "8", "cucop_code": "25401-0202", "specific_item_code": "25401", "cucop_description": "ESPATULA", "description": "ACERO INOXIDABLE", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "9", "cucop_code": "25901-1692", "specific_item_code": "25901", "cucop_description": "080.830.3465 REACTIVOS QUÍMICOS ÁCIDO CLORHIDRICO FUMANTE (MÍNIMO 37%). RA. ACS. FRASCO CON 500 ML. TA.", "description": "ÁCIDO CLORHÍDRICO, FRASCO CON 500 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "10", "cucop_code": "25901-0716", "specific_item_code": "25901", "cucop_description": "080.610.1200 MEDIOS DE CULTIVO AGAR. AGAR BASE SANGRE PARA AISLAR E INVESTIGAR LA ACTIVIDAD HEMOLITICA DE MICROORGANISMOS. FRASCO CON 450 G. TA.", "description": "AGAR BASE PARA LISTERIA OTTAVIANI Y AGOSTI. FRASCO 500 GRS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "11", "cucop_code": "25901-0796", "specific_item_code": "25901", "cucop_description": "080.610.2596 MEDIOS DE CULTIVO AGAR. AGAR BILIS Y ROJO VIOLETA. PARA CUENTA DE BACTERIAS COLIFORMES. FRASCO CON 450 G. TA.", "description": "AGAR BILIS ESCULINA FRASCO DE 500 GRS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "12", "cucop_code": "25401-6492", "specific_item_code": "25401", "cucop_description": "080.610.2604 MEDIOS DE CULTIVO AGAR. AGAR PARA METODO ESTANDAR. PARA CUENTA MICROBIANA TOTAL EN LA LECHE. FRASCO CON 450 G. TA.", "description": "AGAR CUENTA ESTÁNDAR, FRASCO 500 GR.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "13", "cucop_code": "25901-0654", "specific_item_code": "25901", "cucop_description": "080.610.0269 MEDIOS DE CULTIVO AGAR. AGAR LISINA Y HIERRO (LIA). FRASCO CON 450 G. TA.", "description": "AGAR DE HIERRO Y LISINA (LIA), FRASCO 450 GR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "14", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "AGAR DEXTROSA TRIPTONA EXTRACTO (EXTRACTO DE CARNE 3 GR, TRIPTONA 5 GR, GLUCOSA 1 GR, AGAR 15 G) CULTIVO DE BACTERIAS EN EL AGUA, LA LECHE Y OTROS PRODUCTOS LACTEOS CAT 223000 CAD. MIN. 12 MESES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "15", "cucop_code": "25901-0019", "specific_item_code": "25901", "cucop_description": "AGAR MANITOL SALADO", "description": "AGAR ENTÉRICO DE HEKTOEN EH, FRASCO 500 GR.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "16", "cucop_code": "25901-0698", "specific_item_code": "25901", "cucop_description": "080.610.0962 MEDIOS DE CULTIVO AGAR. AGAR EOSINA-AZUL DE METILENO. MEDIO SELECTIVO Y DIFERENCIAL PARA ENTEROBACTERIAS LACTOSA POSITIVAS. FRASCO CON 450 G. TA.", "description": "AGAR EOSINA AZUL DE METILENO DE LEVIN (EMB-L) FRASCO 500 GR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "17", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "AGAR EOSINA AZUL DE METILENO DE LEVIN (EMB-L), FRASCO 500 GR.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "18", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "AGAR INDICADOR PM, FRASCO DE 500 G", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "19", "cucop_code": "25901-0018", "specific_item_code": "25901", "cucop_description": "AGAR MACCONKEY", "description": "AGAR MACCONKEY, FRASCO 450 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "20", "cucop_code": "25901-0658", "specific_item_code": "25901", "cucop_description": "080.610.0533 MEDIOS DE CULTIVO AGAR. AGAR NUTRITIVO. MEDIO DE CULTIVO SIMPLE PARA EL AISLAMIENTO DE MICROORGANISMOS CON POCAS EXIGENCIAS NUTRITIVAS. FRASCO CON 450 G. TA.", "description": "AGAR NUTRITIVO, FRASCO 450 GR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "21", "cucop_code": "25901-0646", "specific_item_code": "25901", "cucop_description": "080.610.0129 AGAR SAL Y MANITO. PARA EL AISLAMIENTO DE STAPHYLOCOCCUS PATOGENOS. FRASCO CON 450 G. TA.", "description": "AGAR SAL Y MANITOL ES UN MEDIO SELECTIVO MUY EMPLEADO PARA AISLAR ESTAFILOCOCOS PATOGENOS DE MATERIALES CLINICOS DIVERSOS (ORINAS, GENITALES, HERIDAS, EXUDADOS FARANGEOS, ETC.) CAT 214600 CAD. MIN. 12 MESES FCO 450 GRS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "22", "cucop_code": "25901-0737", "specific_item_code": "25901", "cucop_description": "080.610.1515 MEDIOS DE CULTIVO PLACAS. PLACA DE AGAR SANGRE DESECHABLE ESTERIL DE POLIESTIRENO CRISTAL DE 92 MM DE DIÁMETRO CON 18 ML DE MEDIO HIDRATADO CON 5% DE SANGRE DESFIBRINADA DE CARNERO. APILABLE CON IDENTIFICACION IMPRESA INDIVIDUAL. BOLSA ESTERIL DE PVDC POLIPROPILENO SELLADA AL CALOR CON ETIQUETA DE IDENTIFICACION. CADUCIDAD 14 SEMANAS. PLACA. RTC.", "description": "AGAR SANGRE (5% CÉLULAS ROJAS DE OVEJA), FRASCO 450 GR", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "23", "cucop_code": "25901-0663", "specific_item_code": "25901", "cucop_description": "080.610.0574 MEDIOS DE CULTIVO AGAR. AGAR SULFITO DE BISMUTO. AISLAMIENTO DE SALMONELLA TYPHI. FRASCO CON 450 G. TA.", "description": "AGAR SULFITO DE BISMUTO ASB, FRASCO 450 GR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "24", "cucop_code": "25901-0783", "specific_item_code": "25901", "cucop_description": "080.610.2448 MEDIOS DE CULTIVO MEDIOS ESPECIALES. MEDIO TCBS (TIOSULFATO CITRATO SALES BILIARES SACAROSA). FRASCO CON 450 G. TA.", "description": "AGAR TIOSULFATO, CITRATO, SALES BILIARES Y SACAROSA (TCBS) FRASCO 500 GR", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "25", "cucop_code": "25901-0783", "specific_item_code": "25901", "cucop_description": "080.610.2448 MEDIOS DE CULTIVO MEDIOS ESPECIALES. MEDIO TCBS (TIOSULFATO CITRATO SALES BILIARES SACAROSA). FRASCO CON 450 G. TA.", "description": "AGAR TIOSULFATO, CITRATO, SALES BILIARES Y SACAROSA (TCBS), FRASCO 450 GR", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "26", "cucop_code": "25901-0780", "specific_item_code": "25901", "cucop_description": "080.610.2364 MEDIOS DE CULTIVO AGAR. AGAR HIERRO Y TRIPLE AZUCAR. PARA LA IDENTIFICACION DE ENTEROBACTERIAS. FRASCO CON 450 G. TA.", "description": "AGAR TRIPLE AZÚCAR HIERRO (TSI), FRASCO 450 GR", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "27", "cucop_code": "25901-0823", "specific_item_code": "25901", "cucop_description": "080.610.9799 MEDIOS DE CULTIVO AGAR. AGAR XLD. PARA EL AISLAMIENTO Y DIFERENCIACION DE ENTEROBACTERIAS PATOGENAS PRINCIPALMENTE DE LOS GENEROS SHIGELLA SALMONELLA Y ARIZONA. FRASCO CON 450 G. TA.", "description": "AGAR XILOSA, LISINA, DESOXICOLATO XLD, FRASCO 500 GR.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "28", "cucop_code": "25401-0554", "specific_item_code": "25401", "cucop_description": "AGUJAS", "description": "AGUJA VACUTAINER VERDE CAL 21G LONG 38 MM C/100 PZ", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "29", "cucop_code": "25401-0554", "specific_item_code": "25401", "cucop_description": "AGUJAS", "description": "AGUJA VACUTAINER VERDE CAL 21G LONG 38MM", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "30", "cucop_code": "25401-1021", "specific_item_code": "25401", "cucop_description": "060.040.3786 AGUJAS HIPODERMICAS. HIPODERMICAS CON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLES. LONGITUD: 32 MM. CALIBRE: 22 G. ENVASE CON 100 PIEZAS.", "description": "AGUJAS HIPODERMICAS CON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLE, LONG 32MM CAL. 22G ENVASE C/100", "requested_quantity": "70", "minimum_quantity": "70", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "31", "cucop_code": "25401-1017", "specific_item_code": "25401", "cucop_description": "060.040.3711 AGUJAS HIPODERMICAS. HIPODERMICAS CON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLES. LONGITUD: 32 MM. CALIBRE: 20 G. ENVASE CON 100 PIEZAS.", "description": "AGUJAS HIPODERMICASCON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLES. LONG. 32MM, CALB. 20G ENVASE C/100", "requested_quantity": "115", "minimum_quantity": "115", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "32", "cucop_code": "25401-1090", "specific_item_code": "25401", "cucop_description": "060.066.0039 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 1 LT.", "description": "ALCOHOL DESNATURALIZADO 70 C/100ML", "requested_quantity": "130", "minimum_quantity": "130", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "33", "cucop_code": "25401-1090", "specific_item_code": "25401", "cucop_description": "060.066.0039 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 1 LT.", "description": "ALCOHOL DESNATURALIZADO 70 C/100ML", "requested_quantity": "317", "minimum_quantity": "317", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "34", "cucop_code": "25901-1746", "specific_item_code": "25901", "cucop_description": "080.830.4646 REACTIVOS QUÍMICOS. ALCOHOL ETILICO ABSOLUTO (ETANOL). RA. ACS. FRASCO CON 1000 ML. TA.", "description": "ALCOHOL ETÍLICO ABSOLUTO, FRASCO DE 1000 ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "35", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "ALFA NAFTOL CAT. 90-15-2.FRASCO 250 GRS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "36", "cucop_code": "25401-0034", "specific_item_code": "25401", "cucop_description": "ALGODON ABSORBENTE", "description": "ALGODON ABSORBENTE (ENVASE CON 500 ROLLOS)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "37", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "ALMIDON REACTIVO PARA YODOMETRIA, USO DE LABORATORIO CAS 9005-85-9. FRASCO 100 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "38", "cucop_code": "25101-0007", "specific_item_code": "25101", "cucop_description": "ANTIGENOS (EXCLUYE OXIGENO VIA) (INORGANICA BASICA)", "description": "ANTIGENO BLANCO (BRUCELLA) CON CONTRO L POSITIVO Y NEGATIVO FRASCO 5 ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "39", "cucop_code": "25401-1090", "specific_item_code": "25401", "cucop_description": "060.066.0039 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 1 LT.", "description": "ANTISEPTICOS, ALCOHOL DESNATURALIZADO ENV. C/1LT.", "requested_quantity": "525", "minimum_quantity": "525", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "40", "cucop_code": "25901-0410", "specific_item_code": "25901", "cucop_description": "080.081.2166 SUSTANCIAS BIOLÓGICAS. ANTISUERO SALMONELLA. POLIVALENTE A HASTA I MAS VI. FRASCO CON 3 ML. RTC.", "description": "ANTISUERO POLIVALENTE V. CHOLERAE O1, FRASCO DE 3ML", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "41", "cucop_code": "25901-0410", "specific_item_code": "25901", "cucop_description": "080.081.2166 SUSTANCIAS BIOLÓGICAS. ANTISUERO SALMONELLA. POLIVALENTE A HASTA I MAS VI. FRASCO CON 3 ML. RTC.", "description": "ANTISUERO SOMATICO POLIVALENTE SALMONELLA O: A -1 VI CAT. 222641", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "42", "cucop_code": "25901-0478", "specific_item_code": "25901", "cucop_description": "080.081.4808 SUSTANCIAS BIOLÓGICAS. ANTISUERO VIBRIO CHOLERAE MONOVALENTE INABA. FRASCO CON 3 ML. RTC.", "description": "ANTISUERO VIBRIO COLERA INABA FRASCO C/3 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "43", "cucop_code": "25401-5967", "specific_item_code": "25401", "cucop_description": "080.081.4816 SUSTANCIAS BIOLOGICAS. ANTISUERO VIBRIO CHOLERAE MONOVALENTE OGAWA. FRASCO CON 3 ML. RTC.", "description": "ANTISUERO VIBRIO COLERA OGAWA FRASCO 3ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "44", "cucop_code": "25901-0410", "specific_item_code": "25901", "cucop_description": "080.081.2166 SUSTANCIAS BIOLÓGICAS. ANTISUERO SALMONELLA. POLIVALENTE A HASTA I MAS VI. FRASCO CON 3 ML. RTC.", "description": "ANTISUERO SOMÁTICO (O) POLIVALENTE DE SALMONELLA SPP, ANTISUERO SOMATICO POLIVALENTE SALMONELLA O:A -1 +VI. FRASCO CON 3 ML.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "45", "cucop_code": "25901-1189", "specific_item_code": "25901", "cucop_description": "080.784.7942 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. ANTI-ZIKA VIRUS (IGM). KIT O ESTUCHE DE REACTIVOS PARA LA DETERMINACIÓN DE ANTICUERPOS HUMANOS CLASE IGM CONTRA EL VIRUS ZIKA MEDIANTE LA TÉCNICA DE INMUNOENSAYO ENZIMATICO (ELISA). KIT O ESTUCHE PARA 96 DETERMINACIÓNES (12 TIRAS CON 8 POCILLOS CADA UNA) RTC.", "description": "ANTI-ZIKA VIRUS ELISA (IGM). ZIKV DETECT TM 2.0 IGM CAPTURE ELISA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "46", "cucop_code": "25401-0040", "specific_item_code": "25401", "cucop_description": "APLICADOR DE MADERA (SIN ALGODON)", "description": "APLICADOR DE MADERA SIN ALGODON C/750 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "47", "cucop_code": "25401-4569", "specific_item_code": "25401", "cucop_description": "060.082.0104 APLICADORES. CON ALGODON. DE MADERA. ENVASE CON 150 A 750 PIEZAS.", "description": "APLICADORES DE MADERA CON ALGODON BOLSA CON 150 PZAS", "requested_quantity": "25", "minimum_quantity": "25", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "48", "cucop_code": "25401-0048", "specific_item_code": "25401", "cucop_description": "BARNIZ DE COPAL (USO MEDICO)", "description": "BARNIZ DE COPAL (USO MEDICO)", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "49", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BARRA MAGNÉTICA CERTIFICADO DE CALIDAD (SI APLICA), BARRA MAGNETICA OCTAGONAL DE PTFE COLOR BLANCO 10X5MM APROXIMADO. 50 PIEZAS.", "requested_quantity": "50", "minimum_quantity": "50", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "50", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BARRA MAGNÉTICA CERTIFICADO DE CALIDAD (SI APLICA), BARRA MAGNETICA OCTAGONAL DE PTFE COLOR BLANCO 12.7 X 3.2MM. CAJA C/100 PIEZAS.", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "51", "cucop_code": "25401-8682", "specific_item_code": "25401", "cucop_description": "060.116.0021 BATA DESECHABLE PARA PACIENTE", "description": "BATA DESECCHABLES. PIEZA", "requested_quantity": "500", "minimum_quantity": "500", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "52", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "BHQ1 HURNASE-P, TTCTGACCTGAAGGCTCTGCGCG, 200 NMOL, HPLC, NO. DE BASES 27, MODIFICACIONES 5’ FAM, 3’ BHQ1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "53", "cucop_code": "25401-0860", "specific_item_code": "25401", "cucop_description": "060.483.0117 HOJA PARA BISTURI. DE ACERO INOXIDABLE. EMPAQUE INDIVIDUAL. ESTERILES Y DESECHABLES. PIEZA. 12 ENVASE CON 100 PIEZAS.", "description": "BISTURI (HOJA) #12", "requested_quantity": "105", "minimum_quantity": "105", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "54", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BOLSA PARA STOMACHER CON ALAMBRE 24 OZ (1,6 LT) CAJA C/ 500 PZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "55", "cucop_code": "23701-0003", "specific_item_code": "23701", "cucop_description": "BOLSAS DE POLIETILENO", "description": "BOLSAS DE POLIETILENO PARA HOMOGENEIZADOR PERISTÁLTICO, BOLSA WHIRL-PAK CON ZONA DE MARCADO CAPACIDAD 1627 ML, ESTERIL 19 X 30 CM, CON CINTA COLOR AMARILLO.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "56", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BOLSAS DE POLIETILENO TRANSPARENTE AUTOSELLABLES ESTÉRILES DE 69 ONZAS CAJA CON 250 PIEZAS", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "57", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BOLSAS ESTÉRILES CON TIOSULFATO DE SODIO PARA TOMA DE MUESTRA CON 300 ML. CAJA CON 100.", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "58", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "BOTELLAS DE POLIPROPILENO PARA CENTRIFUGA, CAPACIDAD 400 ML. PACK DE 12", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "59", "cucop_code": "25901-1270", "specific_item_code": "25901", "cucop_description": "080.823.3837 SOLUCIÓNES AMORTIGUADORAS AMORTIGUADORA (BUFFER) DE ACETATO PH 4.9. FRASCO CON 100 ML. TA.", "description": "BUFFER DE REFERENCIA CERTIFICADA PH 7 A NIST C/ CERTIFICADO. FRASCO 500 ML", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "60", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "BUFFER SOLUCION ESTANDAR DE CALIBRACION PARA CONDUCTIMETRO DE 1413 MS/CM (692 PPM) CON CERTIFICADO CAT. 11007", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "61", "cucop_code": "25401-0083", "specific_item_code": "25401", "cucop_description": "BURETA", "description": "BURETA CLASE A, VERIFICADA, CON CERTIFICADO DE CALIDAD, BURETA GRADUADA 5ML. CLASE A ASTM; NÚMERO DE SERIE INDIVIDUAL Y CERTIFICADO*. FABRICADA EN VIDRIO DE BOROSILICATO CON BAJO CONTENIDO DE EXTRACTABLES; CONFORME A USP TIPO I Y ASTM E438, TIPO I, CLASE A. LONGITUD APROXIMADA DE 790MM. GRADUACIÓN EN COLOR BLANCO. DIVISIÓN DE 0.01ML. TOLERANCIA DE ±0.01ML. LLAVE DE PTFE. *CERTIFICADO DE PRECISIÓN DE LA GRADUACIÓN TRACEABLE A NIST.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "62", "cucop_code": "25401-0496", "specific_item_code": "25401", "cucop_description": "TOALLAS PARA GINECO OBSTETRICIA", "description": "CAJA CON 100 PIEZAS", "requested_quantity": "30", "minimum_quantity": "30", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "63", "cucop_code": "25401-8247", "specific_item_code": "25401", "cucop_description": "060.456.0391 GUANTES PARA EXPLORACIÓN AMBIDIESTRO ESTÉRILES. DE LÁTEX DESECHABLES. TAMAÑOS: MEDIANO. ENVASE CON 100 PIEZAS.", "description": "CAJA CON 100 PÍEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "64", "cucop_code": "25401-0599", "specific_item_code": "25401", "cucop_description": "TIRAS REACTIVAS", "description": "CAJA CON 50 TIRAS REACTIVAS PARA GLUCÓMETRO PARLANTE", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "65", "cucop_code": "25401-6025", "specific_item_code": "25401", "cucop_description": "080.148.0062 CAJAS. DE CRISTAL PARA TINCION CON CANASTILLA METALICA PARA 50 PREPARACIONES. (PORTAOBJETOS) JUEGO CON 22 PIEZAS.", "description": "CAJA DE VIDRIO PARA TINCION HIRIZONTAL, CON TAPA Y CANASTILLA, ASA DE MATAL. CANASTILLA CON 10 RANURAS P/20 PORT DE 26X76 MMNASTILLA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "66", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS PETRI DE APROXIMADAMENTE 90MM DE DIÁMETRO", "requested_quantity": "20165", "minimum_quantity": "20165", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "67", "cucop_code": "25901-0784", "specific_item_code": "25901", "cucop_description": "080.610.2455 MEDIOS DE CULTIVO CALDOS.CALDO BASE DE MULLER DESCARBOXILASA. FRASCO CON 450 G. TA.", "description": "CALDO DE MULLER-KAUFFMANN TETRATIONATO NOVOBIOCINA MKTTN, FRASCO 500 GR.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "68", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CALDO EC, FCO. 500 GR.CALDO EC, FCO. 500 GR.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "69", "cucop_code": "25901-0793", "specific_item_code": "25901", "cucop_description": "080.610.2562 MEDIOS DE CULTIVO CALDOS. CALDO LAURIL SULFATO DE SODIO. USADO PARA EL ANALISIS MICROBIOLÓGICO DE AGUAS Y ALIMENTOS. FRASCO CON 450 G. TA.", "description": "CALDO LAURIL TRIPTOSA CON MUG, FRASCO 500 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "70", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CALDO LAURIL SULFATO TRIPTOSA, FRASCO 450 GR.", "requested_quantity": "16", "minimum_quantity": "16", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "71", "cucop_code": "25901-0756", "specific_item_code": "25901", "cucop_description": "080.610.1812 MEDIOS DE CULTIVO CALDOS. CALDO MR-VP. PARA LA IDENTIFICACION BACTERIANA BASADO EN LA REACCION DE ROJO DE METILO Y VOGES PROSKAUER. FRASCO CON 450 G. TA.", "description": "CALDO MR-VP, FRASCO 450 GR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "72", "cucop_code": "25901-0834", "specific_item_code": "25901", "cucop_description": "080.611.0102 MEDIOS DE CULTIVO CALDOS. CALDO SOYA TRIPTICASEINA PARA ENRIQUECIMIENTO. LIBRE DE SUSTANCIAS INHIBITORIAS Y DE INDICADORES. PARA CRECIMIENTO DE BACTERIAS Y LEVADURAS. FRASCO CON 100 G. T.A.", "description": "CALDO SOYA TRIPTICASEÍNA CST, FRASCO 500 GR.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "73", "cucop_code": "25901-0786", "specific_item_code": "25901", "cucop_description": "080.610.2497 MEDIOS DE CULTIVO AGAR. AGAR VERDE BRILLANTE. MEDIO SELECTIVO Y DIFERENCIAL DE ENTEROBACTERIAS PATOGENAS Y PRINCIPALMENTE SALMONELLA. FRASCO CON 450 G. TA.", "description": "CALDO VERDE BRILLANTE LACTOSA BILIS ,FRASCO 500 GR.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "74", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CAMPA DE DURHAM PARA TUBO . PIEZA", "requested_quantity": "2000", "minimum_quantity": "2000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "75", "cucop_code": "25401-8227", "specific_item_code": "25401", "cucop_description": "060.182.1440 CEMENTOS IONÓMERO DE VIDRIO RESTAURATIVO TIPO II. PARA TRATAMIENTO RESTAURATIVO ATRAUMÁTICO (TRA). ESTUCHE.", "description": "CEMENTO DE IONOMERO DE VIDRIO RESTAURATIVO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "76", "cucop_code": "25401-8226", "specific_item_code": "25401", "cucop_description": "060.182.1366 CEMENTOS DENTALES. PARA USO QUIRÚRGICO. DE ÓXIDO DE ZINC CON ENDURECEDOR (POLVO) 65 G Y EUGENOL (LÍQUIDO) 30 ML. CON GOTERO DE PLÁSTICO. EQUIPO", "description": "CEMENTO DENTAL DE OXIDO DE ZINC CON ENDURECEDOR POLVO/LIQUIDO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "77", "cucop_code": "25401-8674", "specific_item_code": "25401", "cucop_description": "060.189.0049 CEPILLOS", "description": "CEPILLO DENTAL DESECHABLE", "requested_quantity": "20000", "minimum_quantity": "20000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "78", "cucop_code": "25401-8674", "specific_item_code": "25401", "cucop_description": "060.189.0049 CEPILLOS", "description": "CEPILLO PARA PULIDO DE AMALGAMAS Y PROFILAXIS DESECHABLE", "requested_quantity": "500", "minimum_quantity": "500", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "79", "cucop_code": "25401-8228", "specific_item_code": "25401", "cucop_description": "060.189.0106 CEPILLOS DENTAL INFANTIL CON MANGO DE PLÁSTICO Y CERDAS RECTAS DE NYLON 6.12 100% VIRGEN O POLIÉSTER P.B.T. 100% VIRGEN DE PUNTAS REDONDEADAS EN 3 HILERAS CABEZA CORTA CONSISTENCIA MEDIANA. PIEZA.", "description": "CEPILLOS DENTAL INFANTIL (DESECHABLE)", "requested_quantity": "5000", "minimum_quantity": "5000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "80", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CESTILLOS REDONDOS PARA ROTOR BASCULANTE, JUEGO C/4", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "81", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CGAGACGATGCAGCCATTC 100NMOL, HPLC, 19 BASES T4 OLIGO,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "82", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "CHAROLAS CON 48 CELDAS PEQUEÑAS Y 48 CELDAS GRANDES, 100-PACK STERILE 97-WELL QUANTI-TRAY/200.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "83", "cucop_code": "25401-0119", "specific_item_code": "25401", "cucop_description": "CINTA MICROPOROSA", "description": "CINTA MOCROPOROSA", "requested_quantity": "43", "minimum_quantity": "43", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "84", "cucop_code": "25401-0120", "specific_item_code": "25401", "cucop_description": "CINTA TESTIGO PARA ESTERILIZACION", "description": "CINTA TESTIGO PARA ESTERILIZACION", "requested_quantity": "86", "minimum_quantity": "86", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "85", "cucop_code": "25401-8230", "specific_item_code": "25401", "cucop_description": "060.203.0165 CINTAS UMBILICALES. DE ALGODÓN TEJIDO PLANO (TRENZADO DE 21 HILOS) ESTÉRILES. LONGITUD: 41 CM. ANCHO: 4 MM. ENVASE CON 100 SOBRES.", "description": "CINTA UMBILICAL DE ALGODON (ENVASE CON 100 SOBRES)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "86", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "CITRATO DE AMONIO Y HIERRO III. FRASCO 100 GRS. SIGMA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "87", "cucop_code": "25901-0816", "specific_item_code": "25901", "cucop_description": "080.610.7454 MEDIOS DE CULTIVO AGAR. AGAR SIMMONS CON CITRATO. PARA DIFERENCIAR LAS ENTEROBACTERIAS EN LA UTILIZACION DEL CITRATO. FRASCO CON 450 G. TA.", "description": "CITRATO DE SIMMONS, FRASCO 450 GR.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "88", "cucop_code": "25301-0571", "specific_item_code": "25301", "cucop_description": "010.000.3634.00 CLORURO DE SODIO AL 0.9% SOLUCION INYECTABLE NACL 900 MG / 100 ML ENVASE CON 100 ML Y ADAPTADOR PARA VIAL", "description": "CLORURO DE SODIO (NACL), GRADO REACTIVO LIBRE DE FLÚOR, NACL RA/ACS, FRASCO CON 500GR.", "requested_quantity": "27", "minimum_quantity": "27", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "89", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "COMPARADORES COLORIMTRICOS (CL RESIDUAL Y PH) COLORIMETRO PORTATIL CHECKER MINI CLORO LIBRE 0-250PPM", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "90", "cucop_code": "25401-8663", "specific_item_code": "25401", "cucop_description": "060.234.0069 CONTENEDORES", "description": "CONTENEDOR 60L PARA BIOLÓGICOS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "91", "cucop_code": "25401-8662", "specific_item_code": "25401", "cucop_description": "060.234.0051 CONTENEDORES", "description": "CONTENEDORES, DESECHABLES DE PUNZOCORTANTES, DE POLIPROPILENO, ESTERILIZABLE, INCINERABLE Y NO TOXICO, RESISTENTE A LA PERFORACIONAL IMPACTO Y PERDIDA DEL CONTENIDO, CON O SIN SEPARADOR DE AGUJAS Y ABERTURA PARA EL DEPOSITO DE OTROS PUNZO-CORTANTES, CON TAPA DE SEGURIDAD PARA LAS ABERTURAS DE COLOR ROJO ETIQUETADO CON LEYENDA \"PLEIGRO RESIDUOS PUNZO-CORTANTES BIOLOGICO-INFECCIOSOS\" Y MARCADO CON EL SIMBOLO UNIVERSAL DE RIESGO BIOLOGICO. DEBE CONTAR CON CERTIFICADO ANALITICO CUYAS ESPEC. TEC. DEBEN CUMPLIR LA NORMA-087-SEMARNAT-SSA1 VIG. CAPACIDAD : 0.94 A 1.90 LT.", "requested_quantity": "175", "minimum_quantity": "175", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "92", "cucop_code": "25501-0479", "specific_item_code": "25501", "cucop_description": "080.909.6480 TUBOS CRIOTUBOS ESTERILES CON TAPA DE POLIPROPILENO DE 2 ML PARA TEMPERATURAS INFERIORES A MENOS 120°C. ENVASE CON MÍNIMO 500 PIEZAS.", "description": "CRIOTUBO DE 2ML CON TAPA PLANA DESMONTABLE, ESTERIL, GRADUADO. PQT CON 50 PZS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "93", "cucop_code": "25401-8163", "specific_item_code": "25401", "cucop_description": "060.621.0524 CUBREBOCAS DE DOS CAPAS DE TELA NO TEJIDA, RESISTENTE A FLUIDOS, ANTIESTÁTICO, HIPOALERGÉNICO, CON BANDAS O AJUSTE ELÁSTICO A LA CABEZA. DESECHABLE.", "description": "CUBRE BOCA QX C/DOS CAPAS EXT. DE TELA NO TEJIDA, UN FILTRO INTERMEDIO DE POLIPROPILENO, PLANO O PLISADO, CON AJUSTE NASAL, RESISTENTE A FLUIDOS, ANTIESTATICO, HIPOALERGENICOS, CON BANDAS O AJUSTE ELASTICO ENTORCHADO A LA CABEZA O RETROAURICULA, DESECHABLE", "requested_quantity": "1750", "minimum_quantity": "1750", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "94", "cucop_code": "25401-0149", "specific_item_code": "25401", "cucop_description": "CUBRE BOCA", "description": "CUBRE BOCAS TRIPLE CAPA CAJA CON 50 PZAS", "requested_quantity": "60", "minimum_quantity": "60", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "95", "cucop_code": "25401-0149", "specific_item_code": "25401", "cucop_description": "CUBRE BOCA", "description": "CUBREBOCAS DESECHABLES PARA ÁREA HOSPITALARIA. C/100 PIEZAS", "requested_quantity": "66", "minimum_quantity": "66", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "96", "cucop_code": "25401-0150", "specific_item_code": "25401", "cucop_description": "CUBRE OBJETOS", "description": "CUBREOBJETOS DE 22 X 22 MM", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "97", "cucop_code": "25401-8679", "specific_item_code": "25401", "cucop_description": "060.439.0039 GORROS", "description": "CUBREPELO", "requested_quantity": "3800", "minimum_quantity": "3800", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "98", "cucop_code": "25401-0151", "specific_item_code": "25401", "cucop_description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR", "description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR", "requested_quantity": "350", "minimum_quantity": "350", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "99", "cucop_code": "25401-0151", "specific_item_code": "25401", "cucop_description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR", "description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR INFANTIL", "requested_quantity": "350", "minimum_quantity": "350", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "100", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "DIGERIDO ENZIMÁTICO DE CASEÍNA, FRASCO DE 300 GR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "101", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "DISOLUCIÓN FORTIFICANTE, DF, [CLENBUTEROL] = 100 NG/ML. CLORHIDRATO DE CLENBUTEROL ESTANDAR PRIMARIO (100 NG/ML) B-AGONISTS SPIKING SOL EN TAMPON.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "102", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "DISPENSADOR VARISPENSER 2X MONOCANAL P/BOTELLA C/VALVULA DE RECIRCULACION Y ADAPTADORES GLS25, GLS28/S28,GL32, GL38, S40, Y TUBO DE ASPIRACION TELESCOPICO 125-240MM, 1-10 ML.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "103", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO COMBINADO ISE P/FLUORURO CUERPO EPOXICO 1M CABLE IMPERMEABLE CONECTOR BNC TEMPERATURA DE FUNCIONAMIENTO, CONTINUO: DE 0 °C A 80 °C. JUNTA SURE-FLOW.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "104", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO COMBINADO PARA PH CON COMPENSADOR DE TEMPERATURA ATC, ELECTRODO COMBINADO DE PH/ATC CON SENSOR Y COMPENSADOR DE TEMPERATURA INTEGRADO, RELLENABLES ULTRA TRIODE CON UN CONECTOR BNC Y MINIDIN DE 8 PINES Y CABLE DE 1 METRO JUNTA FIBRA DE VIDRIO MATERIAL CUERPO EPÓXICO INTERVALO DE PH 0 A 14 TEMPERATURA DE FUNCIONAMIENTO 0 °C A 100 °C- COMPATIBLE CON MEDIDOR THERMO SCIENTIFIC™ ORION™", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "105", "cucop_code": "25301-0783", "specific_item_code": "25301", "cucop_description": "010.000.3622.00 ELECTROLITOS ORALES (FORMULA DE OSMOLARIDAD BAJA) POLVO GLUCOSA ANHIDRA O GLUCOSA 13.5 G CLORURO DE POTASIO 1.5 G CLORURO DE SODIO 2.6 G CITRATO TRISODICO DIHIDRATADO 2.9 G ENVASE CON 20.5 G", "description": "ELECTROLITOS ORALES POLVO FORMULA DE OSMOLARIDAD BAJA CADA SOBRE CON POLVO CONTIENE GLUCOSA ANHIDRA O GLUCOSA 13.5G CLORURO DE POTASIO 1.5G CLORURO DE SODIO 2.6G CITRATO TRISDICO DIHIDRATADO 2.9G ENVASE CON 20.5G ELECTROLITOS ORALES FORMULA DE BAJA OSMORALIDAD", "requested_quantity": "1434", "minimum_quantity": "1434", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "106", "cucop_code": "25501-0201", "specific_item_code": "25501", "cucop_description": "080.343.0768 EMBUDOS DE VIDRIO. DIÁMETRO: LONGITUD: 90 MM. 50 MM.", "description": "EMBUDO CERTIFICADO DE CALIDAD (SI APLICA), EMBUDO DE VIDRIO 75 M DE DIAMETRO, TALLO CORTO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "107", "cucop_code": "25501-0201", "specific_item_code": "25501", "cucop_description": "080.343.0768 EMBUDOS DE VIDRIO. DIÁMETRO: LONGITUD: 90 MM. 50 MM.", "description": "EMBUDO DE FILTRACIÓN, EMBUDO DE VIDRIO 90 M DE DIAMETRO, TALLO CORTO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "108", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "EMULSIÓN DE YEMA DE HUEVO, FRASCO DE 100ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "109", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "EQUIPO ESTÁNDARES DE FORMACINA PARA TURBIDEZ (ESTANDARES PRIMARIOS DE FORMACINA PARA TURBIDEZ CON CERTIFICADO PARA CADA VIAL DE: <0,1 NTU, 20 NTU, 200 NTU, 1000 NTU Y 4000 NTU) SET C/5 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "110", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "EQUIPO TOXINA ESTAFILOCOCCICA PARA INMUNOENSAYO VISUAL SET TOTALES KIT, CONTIENE OLACA P/96 PBS, CONTROL POSITIVO, CONTROL NEGATIVO CAT. R4105", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "111", "cucop_code": "25401-0210", "specific_item_code": "25401", "cucop_description": "EYECTOR DE SALIVA DE PLASTICO", "description": "EYECTOR DE SALIVA DE PLASTICO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "112", "cucop_code": "25901-0857", "specific_item_code": "25901", "cucop_description": "080.782.0444 REACTIVOS QUÍMICOS. SOLUCIÓN INDICADORA DE FENOLFTALEINA. VERIFICAR CAMBIOS DE PH. FRASCO CON 25 ML. TA.", "description": "FENOLFTALEINA 1% EN SOLUCION ALOHOL 96º.FRASCO 125 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "113", "cucop_code": "25901-1696", "specific_item_code": "25901", "cucop_description": "080.830.3507 REACTIVOS QUÍMICOS ROJO DE METILO. QP. POLVO. FRASCO CON 25 G. TA.", "description": "FENOLFTALEÍNA, NARANJADO DE METILO, INDICADOR. CAT. 1024-10. 1 FRASCO DE 10 GR. DETERMINACIÓN: ACIDEZ EN CREMAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "114", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FITOPLACTON COMPLEMENTO PARA CILINDROS DE CÁMARA DE SEDIMENTACIÓN UTERMOL . PLACA BASE ACRÍLICO, VOL: 3 ML. ANILLO ROSCADO ACERO INOXIDABLE AISI 316. LLAVE DE CIERRE ACERO INOXIDABLE AISI 316. ABT-UT-002. JUEGO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "115", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FITOPLACTON COMPLEMENTO PARA CILINDROS DE CÁMARA DE SEDIMENTACIÓN UTERMOL, PLACA BASE ACRÍLICO, VOL: 3 ML. ANILLO ROSCADO ACERO INOXIDABLE AISI 316. LLAVE DE CIERRE ACERO INOXIDABLE AISI 316.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "116", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FITOPLANCTON. ACCESORIOS PARA MICROSCOPIO, OBJECT GUIDE 108X72 R FOR PRIMOVERT UNIVERSAL MOUNTING FRAME M. DETERMINACIÓN FITOPLANCTON.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "117", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "FLUORIDE ESTÁNDAR 100 PPM CON CERTIFICADO SOLUCION PARA ISE, TOLERANCIA DE ± 0.5 PPM COMO FLUORURO. TRAZABLE A NIST CON FLUORURO DE POTASIO. FRASCO 475 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "118", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "FORWARD PRIMER (RV98F), GGCAGTTGGGTAAGAGACCA, 200 NMOL, HPLC, NO. DE BASES 20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "119", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCO CON 100 CAPILARES 75MM SIN HEPARINA", "requested_quantity": "300", "minimum_quantity": "300", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "120", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCO DE BOCA ANCHA CON TAPA HERMÉTICA, FRASCO O BOTELLA BOCA ANCHA DE POLIETILENO DE 250 ML DE ALTA DESINDAD.", "requested_quantity": "50", "minimum_quantity": "50", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "121", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCO PLÁSTICO BOCA ANCHA DE 1000 ML. C/TAPA DE ROSCA RESISTENTE A LA ESTERILIZACION", "requested_quantity": "75", "minimum_quantity": "75", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "122", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCOS DE BOCA ANCHA CON TAPA ROSCA ESTÉRIL, FRASCO PLÁSTICO BOCA ANCHA DE 1000 ML. C/TAPA DE ROSCA RESISTENTE A LA ESTERILIZACIONL,", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "123", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCOS DE POLIETILENO DE BOCA ANCHA DE 500 ML. CON TAPA DE ROSCA. PIEZA. DETERMINACIÓN: VIBRIO CHOLERAE.", "requested_quantity": "150", "minimum_quantity": "150", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "124", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "FRASCOS ESTÉRILES", "requested_quantity": "94", "minimum_quantity": "94", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "125", "cucop_code": "25401-8343", "specific_item_code": "25401", "cucop_description": "060.436.0727 GASA SECA CORTADA", "description": "GASA CORTADA 10 X 10 NO ESTERIL PAQUETE CON 200 GASAS", "requested_quantity": "57", "minimum_quantity": "57", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "126", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "GCTTGAAGCTTGCGGACAGT 100NMOL, HPLC, 20 BASES T4 OLIGO,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "127", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "GGCCTACCGCTGCGAAT, 100NMOL, HPLC, 17 BASES, T4 OLIGO,", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "128", "cucop_code": "25401-8154", "specific_item_code": "25401", "cucop_description": "GLUCÓMETRO", "description": "GLUCÓMETRO PARLANTE PARA PERSONAS CON DISCAPACIDAD VISUAL QUE ASISTEN A UNIDADES MOASMI", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "129", "cucop_code": "25401-8679", "specific_item_code": "25401", "cucop_description": "060.439.0039 GORROS", "description": "GORRO DESECHABLE PARA ENFERMERIA CON RESORTE. BOLSA CON 100 PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "130", "cucop_code": "29101-0105", "specific_item_code": "29101", "cucop_description": "GRADILLA (MOLDE)", "description": "GRADILLA ACERO INOXIDABLE, GRADILLA P/72 TUBOS 19MM DE ALAMBRE RECUBIERTA DE VINILO.", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "131", "cucop_code": "29101-0105", "specific_item_code": "29101", "cucop_description": "GRADILLA (MOLDE)", "description": "GRADILLA PARA MICROTUBOS CON TAPÓN A PRESIÓN DE 1.5 ML, DE ACERO INOXIDABLE, GRADILLA P/50 VIALES DE 12 MM DE DIÁM. (2 ML), POLICARBONATO. 199X105X23 MM.", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "132", "cucop_code": "27201-0013", "specific_item_code": "27201", "cucop_description": "GUANTES DE SEGURIDAD", "description": "GUANTE DE MALLA DE ACERO INCLUYE GUANTE DE ACERO INOXIDABLE Y GUANTE DE ALGODÓN. ANCHO DE LA PALMA: 10,5 CM LONGITUD TOTAL: 25 CM. LONGITUD DEL DEDO MEDIO: 8,5 CM.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "133", "cucop_code": "25401-8247", "specific_item_code": "25401", "cucop_description": "060.456.0391 GUANTES PARA EXPLORACIÓN AMBIDIESTRO ESTÉRILES. DE LÁTEX DESECHABLES. TAMAÑOS: MEDIANO. ENVASE CON 100 PIEZAS.", "description": "GUANTES DE LÁTEX", "requested_quantity": "400", "minimum_quantity": "400", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "134", "cucop_code": "25401-0244", "specific_item_code": "25401", "cucop_description": "GUANTES PARA EXPLORACION", "description": "GUANTES DE LATEX GRANDES NO ESTERIL. CAJA 100 PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "135", "cucop_code": "25401-8247", "specific_item_code": "25401", "cucop_description": "060.456.0391 GUANTES PARA EXPLORACIÓN AMBIDIESTRO ESTÉRILES. DE LÁTEX DESECHABLES. TAMAÑOS: MEDIANO. ENVASE CON 100 PIEZAS.", "description": "GUANTES DE LATEX MEDIANO NO ESTERIL. CAJA 100 PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "136", "cucop_code": "25401-8250", "specific_item_code": "25401", "cucop_description": "060.456.0649 GUANTES DE NITRILO O POLIBUTADINE-ACRYLONITRILO LIBRE DE LÁTEX AMBIDIESTRO DESECHABLE ESTÉRIL. TAMAÑO: GRANDE PAR.", "description": "GUANTES DE NITRILO GRANDES SIN POLVO. CAJA 100 PZS", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "137", "cucop_code": "25401-8249", "specific_item_code": "25401", "cucop_description": "060.456.0631 GUANTES DE NITRILO O POLIBUTADINE-ACRYLONITRILO LIBRE DE LÁTEX AMBIDIESTRO DESECHABLE ESTÉRIL. TAMAÑO: MEDIANO PAR.", "description": "GUANTES DE NITRILO MEDIANOS SIN POLVO. CAJA 100 PZS", "requested_quantity": "13", "minimum_quantity": "13", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "138", "cucop_code": "25401-8248", "specific_item_code": "25401", "cucop_description": "060.456.0623 GUANTES DE NITRILO O POLIBUTADINE-ACRYLONITRILO LIBRE DE LÁTEX AMBIDIESTRO DESECHABLE ESTÉRIL. TAMAÑO: CHICO PAR.", "description": "GUANTES DE NITRILO RESISTENTES A PRODUCTOS QUIMICOS. POROSIDAD 0,65 AQL, SIN LATEX Y DIAMANTE EN RELIEVE EN PUNTAS DE LOS DEDOS.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "139", "cucop_code": "25401-8247", "specific_item_code": "25401", "cucop_description": "060.456.0391 GUANTES PARA EXPLORACIÓN AMBIDIESTRO ESTÉRILES. DE LÁTEX DESECHABLES. TAMAÑOS: MEDIANO. ENVASE CON 100 PIEZAS.", "description": "GUANTES PARA EXPLORACION, AMBIDIESTRO, ESTERILES DE LATEX, DESECHABLE ( ENVASE 200 PIEZAS)", "requested_quantity": "175", "minimum_quantity": "175", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "140", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA 48 LITROS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "141", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "142", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "143", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "144", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "145", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "146", "cucop_code": "22301-0036", "specific_item_code": "22301", "cucop_description": "HIELERA", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "147", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "HIELO POTABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "148", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "HIELO POTABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "149", "cucop_code": "25901-0009", "specific_item_code": "25901", "cucop_description": "HIPOCLORITO", "description": "HIPOCLORITO DE CALCIO (CUÑETE DE 45 KG)", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "150", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "HIPOCLORITO DE SODIO, SOLUCION 4-4.99% GRADO REACTIVO, CON CERTIFICADO. FRASCO CON 500 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "151", "cucop_code": "25401-8253", "specific_item_code": "25401", "cucop_description": "060.483.0133 HOJA PARA BISTURÍ DE ACERO INOXIDABLE. EMPAQUE INDIVIDUAL. ESTÉRILES Y DESECHABLES. PIEZA. 20 ENVASE CON 100 PIEZAS.", "description": "HOJA PARA BISTURI HOJA. NO. 20. PIEZA", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "152", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "INDICADORES BIOLOGICOS ESPORAS BACILLUS ATROPHAEUS. BOLSA CON 100 TIRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "153", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "INICIADOR RNASAS P (HURNASE-P-F), AGATTTGGACCTGCGAGCG, 200 NMOL, HPLC, NO. DE BASES 19", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "154", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "INICIADOR RNASAS P (HURNASE-P-R), GAGCGGCTGTCTCCACAAGT, 200 NMOL, HPLC, NO. DE BASES 20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "155", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "INICIADOR SARAMPIÓN MVN1139-F, TGGCATCTGAACTCGGTATCAC, 200 NMOL, HPLC, NO. DE BASES 22", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "156", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "INICIADOR SARAMPIÓN MVN1213-R, TGTCCTCAGTAGTATGCATTGCAA, 200 NMOL, HPLC, NO. DE BASES 24", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "157", "cucop_code": "25401-1091", "specific_item_code": "25401", "cucop_description": "060.066.0054 JABONES. NEUTRO ADICIONADO CON GLICERINA. PASTILLA DE 100 G. PIEZA.", "description": "JABÓN NEUTRO", "requested_quantity": "125", "minimum_quantity": "125", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "158", "cucop_code": "25401-1092", "specific_item_code": "25401", "cucop_description": "060.066.0062 JABONES. PARA USO PREQUIRURGICO. LIQUIDO Y NEUTRO (PH 7). ENVASE CON 3.850 LTS.", "description": "JABONES PARA USO PREQUIRURGICO, LIQ Y NEUTRO (PH7) ENV C/3850 LTS.", "requested_quantity": "105", "minimum_quantity": "105", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "159", "cucop_code": "25401-3110", "specific_item_code": "25401", "cucop_description": "060.550.2590 JERINGAS. DE PLASTICO GRADO MEDICO DE 1 ML DE CAPACIDAD ESCALA GRADUADA EN ML CON DIVISIONES DE 0.1 Y SUBDIVISIONES DE 0.01 ML Y AGUJA DE 22 G Y 32 MM DE LONGITUD ESTERIL Y DESECHABLE. PIEZA.", "description": "JERIGA DE PLASTICO CON AGUJA DE 10 ML. PIEZA", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "160", "cucop_code": "25401-8260", "specific_item_code": "25401", "cucop_description": "060.550.2699 JERINGAS JERINGA DESECHABLE PARA APLICAR VACUNA CONTRA HEPATITIS \"B\" CAPACIDAD 1.0 ML GRADUADA EN DÉCIMAS DE MILÍMETROS CON DOS AGUJAS. CAJA INCINERABLE CON 50 JERINGAS.", "description": "JERINGA DE PLASTICO C/AGUJA CALIBRE 20G Y LONG. 32MM. ESTERIL DESECHABLE CAP. 10ML. ESCALA GRADUADA EN ML.CON DIVISIONES DE 1.0 Y SUBDIVISIONES DE 0.2 ENVASE C/100 PZAS)", "requested_quantity": "86", "minimum_quantity": "86", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "161", "cucop_code": "25401-3110", "specific_item_code": "25401", "cucop_description": "060.550.2590 JERINGAS. DE PLASTICO GRADO MEDICO DE 1 ML DE CAPACIDAD ESCALA GRADUADA EN ML CON DIVISIONES DE 0.1 Y SUBDIVISIONES DE 0.01 ML Y AGUJA DE 22 G Y 32 MM DE LONGITUD ESTERIL Y DESECHABLE. PIEZA.", "description": "JERINGA DE PLASTICO CON AGUJA DE 5 ML. PIEZA", "requested_quantity": "400", "minimum_quantity": "400", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "162", "cucop_code": "25401-0297", "specific_item_code": "25401", "cucop_description": "JERINGA DE PLASTICO SIN AGUJA", "description": "JERINGA DE PLASTICO SIN AGUJA DE 10 ML. CAJA CON 100 PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "163", "cucop_code": "25401-0297", "specific_item_code": "25401", "cucop_description": "JERINGA DE PLASTICO SIN AGUJA", "description": "JERINGA DE PLASTICO SIN AGUJA DE 20 ML ESTERIL, CAJA C/50 PIEZAS.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "164", "cucop_code": "25401-0297", "specific_item_code": "25401", "cucop_description": "JERINGA DE PLASTICO SIN AGUJA", "description": "JERINGA DE PLASTICO SIN AGUJA ED 5 ML. CAJA CON 100 PZS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "165", "cucop_code": "25401-0297", "specific_item_code": "25401", "cucop_description": "JERINGA DE PLASTICO SIN AGUJA", "description": "JERINGA DE PLASTICO SIN AGUJA, CON PIVOTE TIPO LUER-LOCK ESTERIL Y DESECHABLE CAP. 5ML ENVASE C/100 PZAS)", "requested_quantity": "350", "minimum_quantity": "350", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "166", "cucop_code": "25901-1147", "specific_item_code": "25901", "cucop_description": "080.784.3453 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS PARA LA DETECCIÓN DE ANTICUERPOS ESPECÍFICOS CONTRA EL VIRUS HIV-1 EN SUERO O PLASMA. POR EL MÉTODO DE AGLUTINACION PASIVA DE PARTICULAS DE GELATINA QUE INCLUYE SOLUCIÓNES DILUYENTES DE REACTIVOS Y MUESTRAS UN CONTROL POSITIVO PARTICULAS NO SENSIBILIZADAS Y PARTICULAS SENSIBILIZADAS RECUBIERTAS DEL LISADO VIRAL DE HIV PURIFICADO. PARA MÍNIMO 40 PRUEBAS. RTC.", "description": "JUEGO DE REACTIVO PARA LA TECNICA DE INMUNOENSAYO ENZIMATICO PARA LA DETECCION DE ANTICUERPOS-CAPTURA HIV-2 EN SUERO O PLASMA GENSCREEN ULTRA HIV AG AB ELISA (EVALUADO POR INDRE)", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "167", "cucop_code": "25901-0288", "specific_item_code": "25901", "cucop_description": "080.074.2009 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. PRUEBA PARA LA DETECCIÓN POR FLOCULACION DE ANTICUERPOS REAGINICOS EN SUERO O PLASMA. PARA DIAGNÓSTICO DE SIFILIS. INCLUYE CONTROL POSITIVO. FRASCO CON 10 ML. RTC.", "description": "JUEGO DE REACTIVO PARA PRUEBA SIFILIS NEONATAL. ANTI-TREPONEMA PALLIDUM WESTERNBLOT IGM, PRUEBA WESTERN BLOT (WB) TREPONEMA PALLIDUM (SIFILIS) IGM 16PRUEBAS (EUROINMUN, EVALUADO POR INDRE)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "168", "cucop_code": "25901-0408", "specific_item_code": "25901", "cucop_description": "080.081.2141 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS RUBEOLA. IGM. PARA DETERMINAR EN SUERO Y PLASMA POR TÉCNICA INMUNOENZIMATICA. EQUIPO COMPLETO INCLUYE: CONTROLES REACTIVOS. PARA MÍNIMO 96 PRUEBAS. RTC.", "description": "JUEGO DE REACTIVOS MICROELISA PARA LA DETERMINACION DE ANTICUERPOS IGM CONTRA EL VIRUS DE RUBEOLA. RUBEOLLA VIRUS GLYCOPROTEIN INCL. IGM/RF ABSORBENT ELISA TEST 96X01 PRESENTACION KIT C/96 PBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "JUEGO DE REACTIVOS PARA TECNICA INMUNOENZIMATICA PARA LA DETERMINACION DE ANTICUERPOS IGM CONTRA EL VIRUS DE HEPATITIS “A” EN SUERO O PLASMA PARA EQUIPO MINIVIDAS KIT CON 30 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "170", "cucop_code": "25501-0379", "specific_item_code": "25501", "cucop_description": "080.720.0241 PLACAS DE VIDRIO PARA REACCION DE AGLUTINACION MICROSCOPICA (VDRL). DE 75 X 51 MM Y 2.3 M DE ESPESOR. CON 12 ANILLOS DE CERAMICA DE 14 MM DE DIÁMETRO. PIEZA.", "description": "JUEGO DE REACTIVOS PARA VDRL-ANTIGENO USR ID, VDRL C/CONTROLES KIT C/250 PRUEBAS (SPINREACT, EVALUADO POR INDRE) FRASCO 5 ML (KIT 250 PBS)", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "171", "cucop_code": "25901-0122", "specific_item_code": "25901", "cucop_description": "080.070.2516 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS SARAMPION. IGG. PRUEBA POR MICRO ELISA PARA DETERMINAR ANTICUERPOS IGM Y IGG. PARA MÍNIMO 96 PRUEBAS. RTC.", "description": "JUEGO DE RECTIVOS PARA LA TECNICA INMUNOENZIMATICA PARA LA DETERMINACION DE IGG CONTRA EL VIRUS DE SARAMPION, MEASLES VIRUS KIT 1GR, KIT/ 96 PBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "172", "cucop_code": "25901-0121", "specific_item_code": "25901", "cucop_description": "080.070.2508 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS SARAMPION. IGM. PRUEBA POR MICRO ELISA PARA DETERMINAR ANTICUERPOS IGM Y IGG. PARA MÍNIMO 96 PRUEBAS. RTC.", "description": "JUEGO DE RECTIVOS PARA LA TECNICA INMUNOENZIMATICA PARA LA DETERMINACION DE IGM CONTRA EL VIRUS DE SARAMPION, MEASLES VIRUS KIT, INCL. IGM/RF ABSORBENT 96X01, KIT C/96 PBAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "173", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT AQUABC RAPID TESTING PSP (INCLUYE BUFFER, TIRAS REACTIVAS, DESECANTE AZUL E INSTRUCTIVO), PRUEBA RAPIDA PARA PSP (TOXINAS PARALITICAS DE MARISCOS).", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "174", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT AQUABC RAPID TESTING PSP (INCLUYE BUFFER, TIRAS REACTIVAS, DESECANTE AZUL E INSTRUCTIVO), PRUEBA RÁPIDA PARA PSP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERAL. CAJA CON 10 PRUEBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "175", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT DE DISOLUCIONES DECOLORANTES R-1699, (R-BIOPHARM) DECOLORANTE DE MUESTRAS (CLENBUTEROL) KIT CON 3 DISOLUCIONES ELIMINA LAS SUSTANCIAS INTERFERENTES POR PRECIPITACIÓN EN MUESTRAS DE HIGADO, KIT CON 400 PRUEBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "176", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT DE EXTRACCION QIA AMP VIRAL RNA, KIT DE PURIFICACION DE ARN VIRAL 250 PREPS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "177", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "KIT DE MEDICIÓN DE CLORO RESIDUAL COMPARADORES COLORIMTRICOS (CL RESIDUAL Y PH) COLORIMETRO PORTATIL CHECKER MINI CLORO LIBRE 0-250PPM", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "178", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT DE MEDICIÓN DE CLORO RESIDUAL, COMPARADOR COLORIMETRICO KIT PARA MONITOREO DE CLORO RESIDUAL CON ESCALA COLORIMETRICA DE 0.2 A 3 PARTES POR MILLON Y PH. DE 0 A14.L", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "179", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT ENSAYO INMUNOENZIMÁTICO: CLENBUTEROL RIDASCREEN R-1711 (R-BIOPHARM). JUEGO DE REACTIVOS PARA EL INMUNOENSAYO ENZIMÁTICO COMPETITIVO PARA EL ANÁLISIS CUANTITATIVO DE CLENBUTEROL. CONTIENE: PLACA DE MICROTITULACIÓN CON 96 POCILLOS (12 TIRAS DE 8 POCILLOS CADA UNA), STANDARD 1: 0 NG/L , STANDARD 2: 75 NG/L , STANDARD 3: 150 NG/L, STANDARD 4: 300 NG/L, STANDARD 5: 900 NG/L,STANDARD 6: 2700 NG/L, CONJUGADO, CROMOGNO, SOLUCION DE PARO Y BUFFER DE LAVADO. VALIDADO EN MATRICES: CARNE, HÍGADO, ORINA, PLASMA/SUERO, GLOBO OCULAR. KIT CON 96 PBAS.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "180", "cucop_code": "25401-0577", "specific_item_code": "25401", "cucop_description": "BOTIQUÍN MÉDICO", "description": "KIT EPIDEMIOLÓGICO PARA DIAGNÓSTICO Y TRATAMIENTO A PACIENTES CON LEISHMANIASIS, DIVERSOS ARTÍCULOS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "181", "cucop_code": "25901-0930", "specific_item_code": "25901", "cucop_description": "080.783.3249 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. FOSFATASA ACIDA Y FRACCION PROSTATICA. PRUEBA ENZIMATICA COLORIMETRICA DE PUNTO FINAL CON SUSTRATO DE 4-NITROFENIL-FOSFATO. SUSTRATO: 10 TABLETAS DE 55 MICROMOLES. SOLUCIÓN AMORTIGUADORA PH 4.9. FRASCO CON 100 ML. REACTIVOS ACCESORIOS. RTC.", "description": "KIT PARA DSP (PP2A FOSFATASA ABRAXIS), PLACA PARA 96 MICROPOZOS (ACIDO OKADOICO)(OA) AND OTHER CARBOXYLIC TOXINS OF THE OA GROUP INCLUDING DTX1, DTX2 AND DTX3.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "182", "cucop_code": "25901-2033", "specific_item_code": "25901", "cucop_description": "533.819.0613 EQUIPO PARA INMUNOENSAYO. SISTEMA PARA ANALISIS INMUNOLOGICO. QUE INCLUYA COMO PRINCIPIO DE MEDICION ALGUNA DE LAS SIGUIENTES METODOLOGIAS: ELISA FIA FPIA ELFA MEIA QUIMIOLUMINISCENCIA O ELECTROQUIMIOLUMINISCENCIA. CON LAS SIGUIENTES CARACTERÍSTICAS SELECCIONABLES DE ACUERDO A LAS NECESIDADES DE LAS UNIDADES MÉDICAS: ANALITOS O ESTUDIOS A DETERMINAR. CAPACIDAD DE PROCESAMIENTO DE MUESTRAS POR HORA. VOLUMEN DE MUESTRAS. MUESTRAS EN TUBO PRIMARIO COPA COPILLA O CARTUCHO. CONTROL DE TEMPERATURA. IDENTIFICACION DE MUESTRAS Y REACTIVOS POR CODIGO DE BARRAS. CALIBRACION AUTOMÁTICA O MANUAL. CONTROL DE CALIDAD INTEGRADO. PUERTO DE COMUNICACIÓN PARA INTERFASE. SOFTWARE EN ESPAÑOL. MONITOR O PANTALLA E IMPRESORA INTEGRADOS O ADICIONALES. REGULADOR DE VOLTAJE Y BATERÍA DE RESPALDO.", "description": "KIT RIDASCREEN SET TOTAL, EQUIPO TOXINA ESTAF.P/INMUNOENSAYO C/96 PBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "183", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT SCOTIA RAPID TEST-ASP (BUFFER, TIRAS REACTIVAS, DESECANTE AZUL, INSTRUCTIVO), PRUEBA RÁPIDA PARA ASP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERA. CAJA C/ 10 PRUEBAS. DETERMINACIÓN FICOTOXINAS MARINAS (ÁCIDO DOMOICO).", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "184", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "KIT SCOTIA RAPID TEST-ASP (BUFFER, TIRAS REACTIVAS, DESECANTE AZUL, INSTRUCTIVO), PRUEBA RÁPIDA PARA ASP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERAL. CAJA CON 10 PRUEBAS.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "185", "cucop_code": "25501-0394", "specific_item_code": "25501", "cucop_description": "080.723.0271 LAMINILLAS. COLESTEROL. CAJA CON 25 LAMINILLAS. RTC.", "description": "LAMINILLAS TRIGLICERIDOS C/25 LAMINILLAS", "requested_quantity": "172", "minimum_quantity": "172", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "186", "cucop_code": "25901-0647", "specific_item_code": "25901", "cucop_description": "080.610.0144 MEDIOS DE CULTIVO MEDIOS ESPECIALES. MEDIO BASE EMJH PARA EL CULTIVO Y AISLAMIENTO DE ESPECIES DEL GENERO LEPTOSPIRA. FRASCO CON 500 G. TA.", "description": "LEPTOSPIRA ENRIQUECIMIENTO CAJA CON 6 FCOS. DE 100 ML. ENRIQUECIMIENTO P/LEPTOSPIRA 6 X 100ML. CAJA 6 FCOS. 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "187", "cucop_code": "25401-3133", "specific_item_code": "25401", "cucop_description": "060.593.0106 LOSETA. PARA BATIR CEMENTO. DE VIDRIO. TAMAÑO: 8 X 12 X 0.5 CM. PIEZA.", "description": "LOSETA PARA BATIR CEMENTO DE VIDRIO", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "188", "cucop_code": "24501-0004", "specific_item_code": "24501", "cucop_description": "LUPAS", "description": "LUPA MECÁNICA CON LÁMPARA LED PARA PERSONAS CON DISCAPACIDAD VISUAL QUE ASISTEN A UNIDADES MOASMI", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "189", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE POLIPROPILENO 500ML CLASE B C/TAPON DE ROSCA.", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "190", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICO DE VIDRIO, DE 1000 ML, CON CERTIFICADO DE CALIDAD", "requested_quantity": "60", "minimum_quantity": "60", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "191", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMÉTRICOS, CLASE A DE 100 ML, VERIFICADOS, CON CERTIFICADO DE CALIDAD, MATRAZ VOLUMETRICO DE POLIPROPILENO 100ML CLASE B C/TAPON DE ROSCA.", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "192", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "MAYV-FNP, ACAGATCAGACATGCAGG, 200 NMOL, HPLC, NO, DE BASES 18, MODIFICACIONES 5’ MIKE, 3’ 4BOND", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "193", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "MEDIO PARA PRUEBA DE MOVILIDAD (SEMISÓLIDA), FRASCO 450 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "194", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "MEMBRANAS DE 0,45 MICRAS, UNIDAD DE FILTRACION ESTERIL TIPO PIRINOLA, CONSISTE EN UN PORTAFILTROS DE 25 MM. DE DIAM. PARA JERINGA QUE INCLUYE MEMBRANA DE ACETATO DE CELULOSA CON PORO DE 0.45 MICRAS, PAQUETE DE 20", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "195", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "MEZCLA MAESTRA TAQMAN ENVIROMENTAL MASTER MIX 2.0, APPLIED BIOSYSTEMS, CAT 4398044 O TAQMAN FAST UNIVERSAL PCR MASTER MIX (2X), NO AMPERASE UNG, 50ML, APPLIED BIOSYSTEMS, CAT 4367846 O TAQMAN GENE EXPRESSION MASTER MIX, 5ML. APPLIED BIOSYSTEMS, CAT 4369016", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "196", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA 1 A 10 ML (1000 A 10000 UL) VOLUMEN VARIABLE MONOCANAL, CERTIFICADO DE CALIBRACION.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "197", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA AUTOMATICA 20-200 UL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "198", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA AUTOMATICA VARIABLE DE 100-1000 UL", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "199", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA AUTOMATICA VARIABLE DE 10-100 MICROLITROS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "200", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA DE 1-10 MILIMETROS EPPENDORF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "201", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "MICROTUBO CONICO DE PLASTICO 1.5ML CON TAPA. PAQ CON 500 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "202", "cucop_code": "25501-0446", "specific_item_code": "25501", "cucop_description": "080.909.0657 TUBO DE POLIESTIRENO O POLIPROPILENO CON TAPON DE ROSCA DE 12 X 75 MM. ENVASE CON 1000 PIEZAS.", "description": "MICROTUBOS CON TAPÓN A PRESIÓN DE 1.5 ML, CERTIFICADO DE CALIDAD, TUBOS DE 1.5 ML DE POLIPROPILENO CÓNICO, TAPO A PRESIÓN SAFE-LOCK, PARA CENTRIFUGAR A 30000×G. CAJA DE 2X500.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "203", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "MMGB MEDIO SELECTIVO DE ENRIQUECIMIENTO, FRASCO 500 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "204", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "MVNP1163-P, CCGAGGATGCAAGGCTTGTTTCAGA, 200 NMOL, HPLC, NO. DE BASES 29, MODIFICACIONES 5’ FAM, 3’ BHQ1", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "205", "cucop_code": "25901-1696", "specific_item_code": "25901", "cucop_description": "080.830.3507 REACTIVOS QUÍMICOS ROJO DE METILO. QP. POLVO. FRASCO CON 25 G. TA.", "description": "NARANJA DE METILO, FENOLFTALEÍNA 1% EN SOLUCIÓN ALCOHOL DE 96°. SOLUCIÓN INDICADORA ESTANDARIZADA. 1 FRASCO DE 125 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "206", "cucop_code": "25901-1696", "specific_item_code": "25901", "cucop_description": "080.830.3507 REACTIVOS QUÍMICOS ROJO DE METILO. QP. POLVO. FRASCO CON 25 G. TA.", "description": "NARANJADO DE METILO INDOCADOR. FRASCO DE 10 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "207", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "OLIGOS PARA EL CONTROL INTERNO DE AMPLIFICACION GACATCGATATGGGTGCCG 100NMOL, HPLC, 19 BASES, T4 OLIGO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "208", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "OROV_FNP, CATTTGAAGCTAGATACGG, 200 NMOL, HPLC, NO. DE BASES 19, MODIFICACIONES 5’FAM, 3’ 4BOND", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "209", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "OXALATO DE N,N-DIETIL-P-FENILENDIAMINA, REACTIVO DPD (N, N-DIETIL-P-FENILENDIAMINA) PARA CLORO LIBRE, EN POLVO, PARA COLORIMETRO DIGITAL HI71-25. CAJA CON 25 SOBRES.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "210", "cucop_code": "25901-1203", "specific_item_code": "25901", "cucop_description": "080.784.8098 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. PANEL PARA LA IDENTIFICACION DE ÁCIDOS NUCLEICOS DE BACTERIAS VIRUS Y PARASITOS EN INFECCION GASTROINTESTINAL. REACTIVO PARA LA DETECCIÓN E IDENTIFICACION SIMULTANEA DE ÁCIDOS NUCLEICOS DE MULTIPLES BACTERIAS VIRUS Y PARASITOS EN MUESTRAS DE HECES DE INDIVIDUOS CON SOSPECHA DE INFECCION GASTROINTESTINAL. KIT PARA 6 PRUEBAS", "description": "PANELES DE IDENTIFICACIÓN BACTERIANA GRAN NEGATIVAS. CAJA C/30 PLACAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "211", "cucop_code": "25901-1203", "specific_item_code": "25901", "cucop_description": "080.784.8098 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. PANEL PARA LA IDENTIFICACION DE ÁCIDOS NUCLEICOS DE BACTERIAS VIRUS Y PARASITOS EN INFECCION GASTROINTESTINAL. REACTIVO PARA LA DETECCIÓN E IDENTIFICACION SIMULTANEA DE ÁCIDOS NUCLEICOS DE MULTIPLES BACTERIAS VIRUS Y PARASITOS EN MUESTRAS DE HECES DE INDIVIDUOS CON SOSPECHA DE INFECCION GASTROINTESTINAL. KIT PARA 6 PRUEBAS", "description": "PANELES DE IDENTIFICACIÓN BACTERIANA GRAN POSITIVAS . CAJA CON 30 PLACAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "212", "cucop_code": "25901-1206", "specific_item_code": "25901", "cucop_description": "080.784.8122 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS. PANEL PARA LA IDENTIFICACION DE ÁCIDOS NUCLEICOS DE BACTERIAS VIRUS Y LEVADURAS PARA MENINGITIS O ENCEFALITIS. PANEL DE REACTIVOS PARA LA DETECCIÓN E IDENTIFICACION SIMULTANEA DE ÁCIDOS NUCLEICOS DE MULTIPLES AGENTES INFECCIOSOS EN TIEMPO REAL DE ESPECIMENES DE LIQUIDO CEFALORRAQUIDEO. KIT CON 30 PRUEBAS", "description": "PANELES DE IDENTIFICACIÓN DE LEVADURAS. CAJA C/30 PLACAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "213", "cucop_code": "25401-3262", "specific_item_code": "25401", "cucop_description": "060.683.0057 PAÑOS. PARA EXPRIMIR AMALGAMA. DE ALGODON. FORMA CIRCULAR. ENVASE CON 100 PIEZAS.", "description": "PAÑO PARA EXPRIMIR AMALGAMA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "214", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO NO.2 DE 125 MM. CAJA 100 PZS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "215", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO NO.42 DE 90 MM SIN CENIZAS. CAJA CON 100 PZS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "216", "cucop_code": "25401-0335", "specific_item_code": "25401", "cucop_description": "PAPEL INDICADOR DE CONTACTO OCLUSAL", "description": "PAPEL INDICADOR DE CONTACTO OCLUSAL", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "217", "cucop_code": "21101-0142", "specific_item_code": "21101", "cucop_description": "PAPEL KRAFT", "description": "PAPEL KRAFT 45 CM ROLLO 9 KG.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "218", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PAPEL SEDA PARA MICROSCOPIO 4X6\" (10X15 CM) PARA LIMPIEZA DE LENTES, CAJA C/50", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "219", "cucop_code": "25401-0577", "specific_item_code": "25401", "cucop_description": "BOTIQUÍN MÉDICO", "description": "PARA LA COMPRA DE BOTIQUINES O CAJAS ESPECIALES PARA COLOCAR Y RESGUARDAR LOS INSUMOS DE ATENCIÓN A LA VIOLACIÓN SEXUAL, CONSIDERANDO SU DISTRIBUCIÓN EN LAS UNIDADES DE SALUD QUE ATIENDEN Y REGISTRAN CASOS.", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "220", "cucop_code": "25901-1276", "specific_item_code": "25901", "cucop_description": "080.823.4983 SUSTANCIAS BIOLÓGICAS SOLUCIÓN DE PENICILINA-ESTREPTOMICINA CON 10000 U/ML DE PENICILINA G Y 10000 µG/ML DE ESTREPTOMICINA. FRASCO CON 20 ML. CTC.", "description": "PENICILINA G (SUSTANCIA DE REFERENCIA)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "221", "cucop_code": "25901-0578", "specific_item_code": "25901", "cucop_description": "080.316.0126 DISCOS CON ANTIMICROBIANOS PENICILINA DISCOS CON 10 UNIDADES. EN CARTUCHO CON 50 SENSIDISCOS PARA DISTRIBUIDOR AUTOMATICO. RTC.", "description": "PENICILINASA (Â-LACTAMASA), DISCOS IMPREGNADOS, VIAL 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "222", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "PENICILLIN G SODIUM 96.0-102.0%", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "223", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PERILLA DE SEGURIDAD, BULBO SUCCIONADOR PARA PIPETA 3 VIAS (PERILLA O PROPIPETA). CAT..25315", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "224", "cucop_code": "25401-7653", "specific_item_code": "25401", "cucop_description": "080.830.2707 REACTIVOS QUIMICOS. PEROXIDO DE HIDROGENO (SOLUCION AL 30%). RA. FRASCO CON 500 ML. TA.", "description": "PEROXIDO DE HIDROGENO AL 30 POR CIENTO, FRASCO 500 ML.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "225", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PH-INDICATOR STRIPS PH 0 – 6, INCREMENTOS DE 0.5 UNIDADES. CAT. 1.09531.0001. CAJA CON 100", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "226", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PIPETA BACTERIOLOGICA DE VIDRIO DE 2 ML. CON SUBDIVISIONES 0.1", "requested_quantity": "58", "minimum_quantity": "58", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "227", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA DE TRANSFERENCIA, CAPACIDAD 5 ML, PAQUETE 500 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "228", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA PASTEUR DE PLASTICO DE 3 ML. PAQU 500 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "229", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA SEROLOGICA DE PLASTICO ESTERIL 1ML GRADUADA 1/100. PAQUETE 500 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "230", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA VOLUMETRICA DE VIDRIO 50ML CLASE A CERTIFICADO/LOTE SERIALIZADA", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "231", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PIPETAS DE 1 ML. CERTIFICADO DE CALIDAD, GRADUADAS EN 0.1ML, PIPETA BACTERIOLOGICA DE VIDRIO DE 1 ML. CON SUBDIVISIONES 0.1. PIEZA", "requested_quantity": "250", "minimum_quantity": "250", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "232", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "PIZETA DE PLASTICO DE 100 ML", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "233", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "PLASMA DE CONEJO CON EDTA, CAJA 10X3.0 ML.", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "234", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "PLASMA DE CONEJO LIOFILIZADO CON EDTA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "235", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTA OBJETOS DE VIDRIO 75 X 25 MM BORDE ESMERILADO CAJA 50 PZS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "236", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PORTA OBJETOS DE VIDRIO DE 76 X 25 MM. CAJA 50 PZS", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "237", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "PROBE(RUV), ACATCGCGCACTTCCCACG, 200 NMOL, HPLC, NO. DE BASES 23, MODIFICACIONES 5’ FAM, 3’ BHQ", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "238", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "PRUEBA RAPIDA PARA PSP EN FORMATO DE TESTS RAPIDOS DE FLUJO LATERAL, CAJA C/ 10 PRUEBAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "239", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS CON FILTRO 0.1-100 UL. PUNTAS 100UL CLARAS ESTERIL C/FILTRO RACK CON 960 PIEZA(S) AXYGEN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "240", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS CON FILTRO 0.5 - 10 UL.PUNTAS 10UL CLARAS ESTERIL MAXYMUM RECOVERY C/FILTRO RACK CON 960 PIEZA(S) AXYGEN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "241", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS CON FILTRO 2-100 UL. PUNTAS 2-100UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "242", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS CON FILTRO 2-20 UL. PUNTAS 2-20UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "243", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS CON FILTRO 50-1000 UL. PUNTAS 50-1000UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96) EPPENDORF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "244", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS DE POLIPROPILENO DESECHABLES PARA PIPETORES DE 1-200 MICROLITROS (AMARILLAS) LIBRES DE DNASA / RNASA Y PIROGENOS. ACABADO BISELADO. COMPATIBLES CON PIPETAS DE GRADO DE INVESTIGACIÓN CAJA 1000 PZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "245", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS DESECHABLES PARA PIPETORES 1-200 MICROLITROS (BLANCAS), AXIGEN", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "246", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS DESECHABLES PARA PIPETORES DE 1-200 MICROLITROS (AMARILLAS), AXIGEN. PUNTAS 200UL AMARILLAS NO ESTERIL BISELADAS PAQUETE(S) CON 1000 PIEZA(S) AXYGEN", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "247", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS ESTERILES DE 0.5 A 20 UL PCR. PUNTAS 20UL CLARAS ESTERIL C/FILTRO PAQUETE(S) CON 960 PIEZA(S) AXYGEN", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "248", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS ESTERILES S/FILTRO 0,1-10 UL P/PCR. PUNTAS 0.1-10UL CLARAS ESTERIL DUALFILTER PCR CLEAN 40MM C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "249", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA 0.5", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "250", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA 1000UL", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "251", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA INCOLORA RANGO 50- 1250 UL. MARCA EPPENDORF. PUNTAS 1250UL CLARAS NO ESTERIL EPPENDORF QUALITY C/1000 EPPENDORF", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "252", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "253", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETAS DE VOLÚMENES: 50, 100, 200, 300, 1000, 5000 Y 10000 ?L, CERTIFICADO DE CALIDAD, PUNTAS DE POLIPROPILENO DESECHABLES PARA PIPETORES DE 1-200 MICROLITROS (AMARILLAS) LIBRES DE DNASA / RNASA Y PIRÓGENOS. ACABADO BISELADO. COMPATIBLES CON PIPETAS DE GRADO DE INVESTIGACIÓN. BOLSA CON 1000 PIEZAS.", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "254", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETAS PUNTAS DE 1-10 ML BLANCAS, DE POLIPROPILENO. PAQUETES DE 100", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "255", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTILLAS T-1000-B AZUL. PUNTAS 1000UL AZULES NO ESTERIL PAQUETE(S) CON 1000 PIEZA(S) AXYGEN", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "256", "cucop_code": "25901-0552", "specific_item_code": "25901", "cucop_description": "080.229.0718 REACTIVOS QUÍMICOS. PURPURA DE BROMOCRESOL. FRASCO CON 10 G. TA.", "description": "PÚRPURA DE BROMOCRESOL, PRESENTACION DE 5G", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "257", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO DE COLILERT C/200 PRUEBAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "258", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "REACTIVO DPD (N, N-DIETIL-P-FENILENDIAMINA) PARA CLORO LIBRE, EN POLVO, PARA COLORIMETRO DIGITAL CAT HI71-25. CAJA CON 25 SOBRES", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "259", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "REACTIVO ENTEROLERT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "260", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA LA DETERMINACIÓN DE CLORO RESIDUAL (DPD), CONJUNTO DE REACTIVOS EN POLVO PARA CLORO LIBRE METODO DPD 100 PRUEBAS.", "requested_quantity": "26", "minimum_quantity": "26", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "261", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "RED DE PLACTON CON POSTE RETRACTIL DE ACERO INOXIDABLE", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "262", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "REVERSE PRIMER (RV251R), CGTGGAGTGCTGGGTGAT, 200 NMOL, HPLC, NO. DE BASES 18", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "263", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "RNASAP_F, AGATTTGGACCTGCGAGCG, 200 NMOL, HPLC, NO. DE BASES 19", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "264", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "RNASAP_PB, TTCTGACCTGAAGGCTCTGCGCG, 200 NMOL, HPLC, NO. DE BASES 23, MODIFICACIONES 5’ QUASAR 705, 3’ BHQ2", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "265", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "RNASAP_R, GAGCGGCTGTCTCCACAAGT, 200 NMOL, HPLC, NO. DE BASES 20", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "266", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "SISTEMA DE FILTRACION 500ML, MEMBRANA SFCA (ACETATO DE CELULOSA SIN SURFACTANTES) 75MM, 0.2UM ESTERIL RAPID-FLOW PIEZA(S) CON 1 PIEZA(S) NALGENE", "requested_quantity": "42", "minimum_quantity": "42", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "267", "cucop_code": "25901-1270", "specific_item_code": "25901", "cucop_description": "080.823.3837 SOLUCIÓNES AMORTIGUADORAS AMORTIGUADORA (BUFFER) DE ACETATO PH 4.9. FRASCO CON 100 ML. TA.", "description": "SOLUCION AMORTIGUADORA PBS 10X, PH 7.2, PARA CULTIVO DE CELULAR", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "268", "cucop_code": "25901-1270", "specific_item_code": "25901", "cucop_description": "080.823.3837 SOLUCIÓNES AMORTIGUADORAS AMORTIGUADORA (BUFFER) DE ACETATO PH 4.9. FRASCO CON 100 ML. TA.", "description": "SOLUCIÓN AMORTIGUADORA TISAB II, PARA ISE DE FLUORURO CON CDTA C/CERTIFICADO, FRASCO DE 3.78 LT.", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "269", "cucop_code": "25901-1270", "specific_item_code": "25901", "cucop_description": "080.823.3837 SOLUCIÓNES AMORTIGUADORAS AMORTIGUADORA (BUFFER) DE ACETATO PH 4.9. FRASCO CON 100 ML. TA.", "description": "SOLUCION PARA AJUSTE DE ELECTRODO TISAB II PARA ISE DE FLUORURO CON CDTA C/CERTIFICADO FRASCO 3.78 LTS CAT. D 940909", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "270", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "SUERO CONTROL NEGATIVO ACCURUN 810, CONTROL NEGATIVO SERLOGICO ACCURUN 810 MULTIANALYTE, PRESENTACION 6X3.5ML. CAJA 12 PZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "271", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "SUERO CONTROL POSITIVO ACCURUN 121 ANTI HAV IGM, PRESENTACION FRASCO 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "272", "cucop_code": "25901-0345", "specific_item_code": "25901", "cucop_description": "080.081.1382 CONTROLES Y ESTANDARES SUERO CONTROL POSITIVO INESPECIFICO PARA USO EN DETERMINAR DE ANTICUERPOS TREPONEMICOS. FRASCO PARA 1 ML. RTC.", "description": "SUERO CONTROL POSITIVO ACCURUN 155 SERIES 2000 SIFILIS, ACCURUN 155 SERIE 2000, 3X2.0ML, PRESENTACION VIAL 2 ML. CAJA CON 6", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "273", "cucop_code": "25901-2001", "specific_item_code": "25901", "cucop_description": "080.835.7024 CONTROLES Y ESTANDARES ESTUCHE DE SUEROS CONTROL. PARA LA EVALUACION DEL DESEMPEÑO ANALITICO. PANEL ANTI-SIFILIS. VIAL DESDE 1 A 2 ML. RTC.", "description": "SUERO CONTROL POSITIVO ACCURUN 155 SERIES 5000 SIFILIS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "274", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "SUPLEMENTO SELECTIVO MODIFICADO PARA BRUCELLA. PAQ./10 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "275", "cucop_code": "25901-0014", "specific_item_code": "25901", "cucop_description": "PLATA COLOIDAL", "description": "SUSTANCIAS QUIMICAS PARA TRATAMIENTOS DE AGUA PLATA COLOIDAL", "requested_quantity": "1766", "minimum_quantity": "1766", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "276", "cucop_code": "25401-3647", "specific_item_code": "25401", "cucop_description": "060.841.2623 SUTURAS. CATGUT CROMICO CON AGUJA. LONGITUD DE LA HEBRA: 68 A 75 CM. CALIBRE DE LA SUTURA: 0 CARACTERISTICAS DE LA AGUJA: 1/2 CIRCULO AHUSADA (35-37 MM). ENVASE CON 12 PIEZAS.", "description": "SUTURAS CATGUT CROMICO C/AGUJA, LONG. DE HEBRA 68-75 CM.CAL. 0", "requested_quantity": "50", "minimum_quantity": "50", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "277", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "TAPA OPTICA EN TIRA DE 8 P/TIRAS DE TUBOS MICROAMP COMPATIBLE CON TERMOCICLADORES THERMO SCIENTIFIC C/300 APPLIED BIOSYSTEMS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "278", "cucop_code": "25901-2005", "specific_item_code": "25901", "cucop_description": "OTROS PRODUCTOS QUÍMICOS", "description": "TBX, FRASCO 500 GR.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "279", "cucop_code": "25901-1172", "specific_item_code": "25901", "cucop_description": "080.784.7777 REACTIVOS Y JUEGOS DE REACTIVOS PARA PRUEBAS ESPECÍFICAS REACTIVO Y EQUIPO COMPLETO PARA LA TIPIFICACION DE ANTÍGENOS HLA CLASE I (A B C) Y HLA CLASE II DE CADENA B (DR DQ) MEDIANTE MÉTODOS MOLECULARES SSO (OLIGONUCLEOTIDOS DE SECUENCIA ESPECIFICA) Y SSP (INICIADORES DE SECUENCIA ESPECIFICA). EL EQUIPO INCLUYE TODO LO NECESARIO PARA EL DESARROLLO DEL MÉTODO. HLA-AB. MÍNIMO 10 PRUEBAS MÁXIMO 100 PRUEBAS. RTC.", "description": "TCTCATGCGTCTCCCTGGTGAATGTG 200NMOL, HPLC, 26 BASES, CY5 BHQ-2 T4 OLIGO, CAT. IAC SONDA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "280", "cucop_code": "25401-0486", "specific_item_code": "25401", "cucop_description": "TELA ADHESIVA", "description": "TELA ADHESIVA DE ACETATO CON ADHESIVO EN UNA DE SUS CARAS LONG. 10M X2.50 CM CAJA", "requested_quantity": "35", "minimum_quantity": "35", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "281", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "TERMO ICE ENVASES PLÁSTICO SUSTITUTO DE HIELO ANCHO DEL PRODUCTO ENSAMBLADO 14.5 CM ALTURA DEL PRODUCTO ENSAMBLADO 21.5 CM LONGITUD DEL PRODUCTO ENSAMBLADO 2.5 CM", "requested_quantity": "50", "minimum_quantity": "50", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "282", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO 5280824 PARA ALIMENTOS, -40 GRADOS C A 232 GRADOS C, PUERTO DE CARGA USB,", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "283", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO 5280824, - 40 GRADOS C A 232 GRADOS C, PUERTO DE CARGA USB,", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "284", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO DE INMERSION PARCIAL -10º A 60º C DIVISION 1°C", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "285", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO LASER DIGITAL DE 0° A 40° TIPO PISTOLA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "286", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO/ HIGRÓMETRO CON RADIOSEÑA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "287", "cucop_code": "25101-0060", "specific_item_code": "25101", "cucop_description": "TIOSULFATO DE SODIO", "description": "TIOSULFATO DE SODIO, O.1 N SOLUCION VALORADA CON CERTIFICADO, TOLERANCIA DE ± 0.005N. FRASCO DE 1LT.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "288", "cucop_code": "25901-2023", "specific_item_code": "25901", "cucop_description": "080.889.2632 TIRAS REACTIVAS TIRA REACTIVA PARA LA DETERMINACIÓN SEMICUANTITATIVA DE MICROALBÚMINA EN ORINA EN UN RANGO DE 10 A 100 MG/L EN UN TIEMPO APROXIMADO DE UN MINUTO. TUBO CON 25, 30 O 50 TIRAS REACTIVAS. RTC Y/O TA.", "description": "TIRA REACTIVA PARA DETERMINAR SEMICUANTITATIVA DE MICROALBUMINA EN ORINA EN UN RANFO DE 10A 100MG/L EN UN TIEMPO APROX. DE UN MINUTO. TUBO C/ 25,30 O 50 TIRAS REACTIVAS", "requested_quantity": "86", "minimum_quantity": "86", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "289", "cucop_code": "25401-0599", "specific_item_code": "25401", "cucop_description": "TIRAS REACTIVAS", "description": "TIRAS REACTIVAS INDICADOR DE 0.0 A 6.0 (DIVISIONES DE 0.5 UNIDADES DE PH), H-INDICATOR STRIPS PH 0 – 6, INCREMENTOS DE 0.5 UNIDADES . CAJA DE 100 PIEZAS.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "290", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBO CÓNICO ESTÉRIL DE 50 ML. GRADUADO DE POLIPROPILENO, BOLSA C/25 TUBOS", "requested_quantity": "22", "minimum_quantity": "22", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "291", "cucop_code": "25501-0446", "specific_item_code": "25501", "cucop_description": "080.909.0657 TUBO DE POLIESTIRENO O POLIPROPILENO CON TAPON DE ROSCA DE 12 X 75 MM. ENVASE CON 1000 PIEZAS.", "description": "TUBO DE POLIESTIRENO CON TAPA 12 X 75 MM", "requested_quantity": "3000", "minimum_quantity": "3000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "292", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "TUBO DE VIDRIO DE 13X100 CON ROSCA TAPON DE VAQUELITA", "requested_quantity": "500", "minimum_quantity": "500", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "293", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBO P/CENTRIFUGA 15ML DE POLIPROPILENO FONDO CONICO ALTA CLARIDAD TAPON DE ROSCA C/SELLO DE DOMO ESTERIL PAQUETE(S) CON 50 PIEZA(S) FALCON", "requested_quantity": "47", "minimum_quantity": "47", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "294", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBO P/CENTRIFUGA 50ML DE POLIPROPILENO ALTA CLARIDAD FONDO CONICO, GRADUADO ESTERIL C/TAPA DE POLIETILENO AZUL PAQUETE(S) CON 25.00 PIEZA(S) FALCON", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "295", "cucop_code": "25401-8025", "specific_item_code": "25401", "cucop_description": "080.909.1531 TUBOS DE POLIPROPILENO DE 12 X 75 MM. PIEZA.", "description": "TUBO POLIPROPILENO TAPÓN A PRESIÓN, 5,0 ML, CLARO, NO ESTÉRIL. CAT 0030119401. PAQUETE DE 2 BOLSAS POR 100 TUBOS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "296", "cucop_code": "25401-8025", "specific_item_code": "25401", "cucop_description": "080.909.1531 TUBOS DE POLIPROPILENO DE 12 X 75 MM. PIEZA.", "description": "TUBOS DE 1.5 ML DE POLIPROPILENO CONICO TAPON A PRESION SAFE-LOCK PRA CENTRIFUGA A 30000XG.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "297", "cucop_code": "25501-0446", "specific_item_code": "25501", "cucop_description": "080.909.0657 TUBO DE POLIESTIRENO O POLIPROPILENO CON TAPON DE ROSCA DE 12 X 75 MM. ENVASE CON 1000 PIEZAS.", "description": "TUBOS DE 2 ML, ESTÉRILES, LIBRES DE DNASAS Y RNASAS, CON CERTIFICADO DE CALIDAD, MICROTUBOS DE POLIPROPILENOS 2 ML, CLARO ESTERIL PCR CLEAN SAFE LOCK, CAT. 0030120094 O 30123344. PAQUETE DE 1000", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "298", "cucop_code": "25501-0457", "specific_item_code": "25501", "cucop_description": "080.909.1648 TUBOS DE POLIPROPILENO PARA CENTRIFUGA CON CAPACIDAD DE 50 ML GRADUADO CONICO CON TAPON DE ROSCA ESTERIL. CAJA CON 400 PIEZAS.", "description": "TUBOS DE CENTRIFUGA CÓNICOS DE POLIPROPILENO DE 50 Y 15 ML GRADUADOS CON TAPA DE ROSCA, NO ESTÉRILES REUTILIZABLES CERTIFICADO DE CALIDAD, TUBO P/CENTRIFUGA 15 ML, POLIPROPILENO CLARO FONDO CONICO, 17X114 MM. RFC MÁXIMO: 12,000 X G, TAPON DE ROSCA. BOLSA CON 50 PIEZA.", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "299", "cucop_code": "25501-0429", "specific_item_code": "25501", "cucop_description": "080.826.5920 TUBOS TUBO CONICO DE POLIESTIRENO O POLIPROPILENO ESTERIL CON TAPON DE ROSCA GRADUADO CON CAPACIDAD DE 15 ML. ENVASE CON 1000 PIEZAS.", "description": "TUBOS DE POLIPROPILENO NEGRO, PARA CENTRÍFUGA DE 50 ML, CON TAPÓN, CON CERTIFICADO DE CALIDAD (SI APLICA), TUBO CÓNICO PARA CENTRÍFUGA COLOR NEGRO. FABRICADO EN POLIPROPILENO CON CAPACIDAD DE 50 ML. TAPA PLANA EN POLIETILENO, RESISTENTE A 9,400 RCF. CAJA C/ 500 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "300", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "TUBOS PARA BIOQUÍMICASDE 13 X 100 MM, TUBO DE VIDRIO DE 13X100 CON ROSCA TAPON DE VAQUELITA. PIEZA", "requested_quantity": "1000", "minimum_quantity": "1000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "301", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADOS DE VIDRIO DE 250 ML, VASOS DE PRECIPITADO DE 250 ML VIDRIO.", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "302", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASO DE PRECIPITADOS UTILIZAR PREFERENTEMENTE DE POLIETILENO O TFE, VASOS DE PRECIPITADO DE 150 ML POLIETILENO O POLIPROPILENO. 201-0150.", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "303", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADO DE 600 ML POLIETILENO O POLIPROPILENO,", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "304", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADOS DE 50 ML, PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "305", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADOS DE 600 ML, CERTIFICADO DE CALIDAD (SI APLICA), VASO DE PRECIPITADO DE VIDRIO DE BOROSILICATO DE 600 ML", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "306", "cucop_code": "25501-0052", "specific_item_code": "25501", "cucop_description": "VASO PRECIPITADO", "description": "VASOS DE PRECIPITADOS, CON CERTIFICADO DE CALIDAD (SI APLICA), VASOS DE PRECIPITADO DE 150 ML VIDRIO.", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "307", "cucop_code": "25901-0786", "specific_item_code": "25901", "cucop_description": "080.610.2497 MEDIOS DE CULTIVO AGAR. AGAR VERDE BRILLANTE. MEDIO SELECTIVO Y DIFERENCIAL DE ENTEROBACTERIAS PATOGENAS Y PRINCIPALMENTE SALMONELLA. FRASCO CON 450 G. TA.", "description": "VERDE BRILLANTE, CALDO VERDE BRILLANTE AL 2 %,. FRASCO CON 500 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "308", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "VIAL 40 ML. VIDRIO DE BOROSILICATO TAPON DE ROSCA CON TAPON SOLIDO CON REVESTIMIENTO DE PTFE 29 MM X 82 MM. CAJA 100 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "309", "cucop_code": "25501-0510", "specific_item_code": "25501", "cucop_description": "BOLSA ESTÉRIL", "description": "VIAL 4ML VIDIRO DE BOROSILICATO TAPON DE ROSCA CON TAPON SOLIDO CON REVESTIMIENTO DE PTFE 15MM X 45 MM. CAJA CON 100 PZS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "310", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES PARA HEMOCULTIVO BACTEC PED PLUS/F PEDIATRICO 40 ML, CAJA/50 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "311", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES PARA HEMOCULTIVO BACTEC PLUS AEROBIC/F ADULTO 30 ML, CAJA/50 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "312", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES PARA HEMOCULTIVO BACTEC PLUS ANAEROBIC/F ADULTO 30ML, CAJA/50 VIALES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "313", "cucop_code": "25901-1849", "specific_item_code": "25901", "cucop_description": "080.830.9694 REACTIVOS QUÍMICOS YODATO DE POTASIO. RA. ACS. GRANULADO. FRASCO CON 500 G. TA", "description": "YODATO DE POTASIO, AR CERTIFICADO, PUREZA 99.9%. MARCA FISHER CAT P/5800. FRASCO 100 GR", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null }, { "number": "314", "cucop_code": "25901-1780", "specific_item_code": "25901", "cucop_description": "080.830.5312 REACTIVOS QUÍMICOS YODURO DE POTASIO. RA. ACS. CRISTALES O GRANULADO. FRASCO CON 100 G. TA.", "description": "YODURO DE POTASIO, KL RA/ACS FRASCO CON 100GR.", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null } ] } ], "awards": [ { "id": "C-2026-00009592", "internal_reference": "DRMSG-150/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "ALFONSO FONSECA SIERRA", "normalized_name": "ALFONSO FONSECA SIERRA", "rfc_type": null }, "contract_period": { "published_at": "2026-07-17T19:18:41.000Z", "starts_at": "2025-12-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "298406.5", "tax": "47745.04", "total": "346151.54", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-1021", "description": "AGUJAS HIPODERMICAS CON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLE, LONG 32MM CAL. 22G ENVASE C/100", "unit": "PIEZA", "requested_quantity": "70", "awarded_quantity": null, "unit_price": "65", "subtotal": "4550", "tax": "728", "other_taxes": null, "total": "5278" }, { "number": "0", "cucop_code": "25401-1017", "description": "AGUJAS HIPODERMICASCON PABELLON LUER-LOCK HEMBRA DE PLASTICO DESECHABLES. LONG. 32MM, CALB. 20G ENVASE C/100", "unit": "PIEZA", "requested_quantity": "115", "awarded_quantity": null, "unit_price": "65", "subtotal": "7475", "tax": "1196", "other_taxes": null, "total": "8671" }, { "number": "0", "cucop_code": "25401-8682", "description": "BATA DESECCHABLES. PIEZA", "unit": "PIEZA", "requested_quantity": "500", "awarded_quantity": null, "unit_price": "18", "subtotal": "9000", "tax": "1440", "other_taxes": null, "total": "10440" }, { "number": "0", "cucop_code": "25401-0860", "description": "BISTURI (HOJA) #12", "unit": "PIEZA", "requested_quantity": "105", "awarded_quantity": null, "unit_price": "2.7", "subtotal": "283.5", "tax": "45.36", "other_taxes": null, "total": "328.86" }, { "number": "0", "cucop_code": "25401-8226", "description": "CEMENTO DENTAL DE OXIDO DE ZINC CON ENDURECEDOR POLVO/LIQUIDO", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "80", "subtotal": "800", "tax": "128", "other_taxes": null, "total": "928" }, { "number": "0", "cucop_code": "25401-8674", "description": "CEPILLO DENTAL DESECHABLE", "unit": "PIEZA", "requested_quantity": "20000", "awarded_quantity": null, "unit_price": "4", "subtotal": "80000", "tax": "12800", "other_taxes": null, "total": "92800" }, { "number": "0", "cucop_code": "25401-8674", "description": "CEPILLO PARA PULIDO DE AMALGAMAS Y PROFILAXIS DESECHABLE", "unit": "PIEZA", "requested_quantity": "500", "awarded_quantity": null, "unit_price": "2.5", "subtotal": "1250", "tax": "200", "other_taxes": null, "total": "1450" }, { "number": "0", "cucop_code": "25401-8228", "description": "CEPILLOS DENTAL INFANTIL (DESECHABLE)", "unit": "PIEZA", "requested_quantity": "5000", "awarded_quantity": null, "unit_price": "4", "subtotal": "20000", "tax": "3200", "other_taxes": null, "total": "23200" }, { "number": "0", "cucop_code": "25401-8230", "description": "CINTA UMBILICAL DE ALGODON (ENVASE CON 100 SOBRES)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "483", "subtotal": "483", "tax": "77.28", "other_taxes": null, "total": "560.28" }, { "number": "0", "cucop_code": "25401-8163", "description": "CUBRE BOCA QX C/DOS CAPAS EXT. DE TELA NO TEJIDA, UN FILTRO INTERMEDIO DE POLIPROPILENO, PLANO O PLISADO, CON AJUSTE NASAL, RESISTENTE A FLUIDOS, ANTIESTATICO, HIPOALERGENICOS, CON BANDAS O AJUSTE ELASTICO ENTORCHADO A LA CABEZA O RETROAURICULA, DESECHABLE", "unit": "PIEZA", "requested_quantity": "1750", "awarded_quantity": null, "unit_price": "0.8", "subtotal": "1400", "tax": "224", "other_taxes": null, "total": "1624" }, { "number": "0", "cucop_code": "25401-8679", "description": "CUBREPELO", "unit": "PIEZA", "requested_quantity": "3800", "awarded_quantity": null, "unit_price": "0.8", "subtotal": "3040", "tax": "486.4", "other_taxes": null, "total": "3526.4" }, { "number": "0", "cucop_code": "25401-0151", "description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR", "unit": "PIEZA", "requested_quantity": "350", "awarded_quantity": null, "unit_price": "2.7", "subtotal": "945", "tax": "151.2", "other_taxes": null, "total": "1096.2" }, { "number": "0", "cucop_code": "25401-0151", "description": "CUCHARILLA PARA APLICACION TOPICA DE FLUOR INFANTIL", "unit": "PIEZA", "requested_quantity": "350", "awarded_quantity": null, "unit_price": "2.5", "subtotal": "875", "tax": "140", "other_taxes": null, "total": "1015" }, { "number": "0", "cucop_code": "25401-0210", "description": "EYECTOR DE SALIVA DE PLASTICO", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "93", "subtotal": "465", "tax": "74.4", "other_taxes": null, "total": "539.4" }, { "number": "0", "cucop_code": "25401-8343", "description": "GASA CORTADA 10 X 10 NO ESTERIL PAQUETE CON 200 GASAS", "unit": "PIEZA", "requested_quantity": "57", "awarded_quantity": null, "unit_price": "150", "subtotal": "8550", "tax": "1368", "other_taxes": null, "total": "9918" }, { "number": "0", "cucop_code": "25401-8679", "description": "GORRO DESECHABLE PARA ENFERMERIA CON RESORTE. BOLSA CON 100 PZS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "113", "subtotal": "1130", "tax": "180.8", "other_taxes": null, "total": "1310.8" }, { "number": "0", "cucop_code": "25401-0244", "description": "GUANTES DE LATEX GRANDES NO ESTERIL. CAJA 100 PZS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "100", "subtotal": "1000", "tax": "160", "other_taxes": null, "total": "1160" }, { "number": "0", "cucop_code": "25401-8247", "description": "GUANTES PARA EXPLORACION, AMBIDIESTRO, ESTERILES DE LATEX, DESECHABLE ( ENVASE 200 PIEZAS)", "unit": "PIEZA", "requested_quantity": "175", "awarded_quantity": null, "unit_price": "360", "subtotal": "63000", "tax": "10080", "other_taxes": null, "total": "73080" }, { "number": "0", "cucop_code": "25401-8253", "description": "HOJA PARA BISTURI HOJA. NO. 20. PIEZA", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "2.7", "subtotal": "540", "tax": "86.4", "other_taxes": null, "total": "626.4" }, { "number": "0", "cucop_code": "25401-3110", "description": "JERIGA DE PLASTICO CON AGUJA DE 10 ML. PIEZA", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "2.9", "subtotal": "580", "tax": "92.8", "other_taxes": null, "total": "672.8" }, { "number": "0", "cucop_code": "25401-3110", "description": "JERINGA DE PLASTICO CON AGUJA DE 5 ML. PIEZA", "unit": "PIEZA", "requested_quantity": "400", "awarded_quantity": null, "unit_price": "2.1", "subtotal": "840", "tax": "134.4", "other_taxes": null, "total": "974.4" }, { "number": "0", "cucop_code": "25401-3133", "description": "LOSETA PARA BATIR CEMENTO DE VIDRIO", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "20", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348" }, { "number": "0", "cucop_code": "21101-0142", "description": "PAPEL KRAFT 45 CM ROLLO 9 KG.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "805", "subtotal": "8050", "tax": "1288", "other_taxes": null, "total": "9338" }, { "number": "0", "cucop_code": "25901-2023", "description": "TIRA REACTIVA PARA DETERMINAR SEMICUANTITATIVA DE MICROALBUMINA EN ORINA EN UN RANFO DE 10A 100MG/L EN UN TIEMPO APROX. DE UN MINUTO. TUBO C/ 25,30 O 50 TIRAS REACTIVAS", "unit": "PIEZA", "requested_quantity": "86", "awarded_quantity": null, "unit_price": "975", "subtotal": "83850", "tax": "13416", "other_taxes": null, "total": "97266" } ] }, { "id": "C-2026-00009595", "internal_reference": "DRMSG-152/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "BIOMEDICO SLANEY SA DE CV", "normalized_name": "BIOMEDICO SLANEY", "rfc_type": null, "slug": "biomedico-slaney" }, "contract_period": { "published_at": "2026-07-17T19:16:48.000Z", "starts_at": "2025-12-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "121175.91", "tax": "19388.13", "total": "140564.04", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-1090", "description": "ALCOHOL DESNATURALIZADO 70 C/100ML", "unit": "PIEZA", "requested_quantity": "130", "awarded_quantity": null, "unit_price": "9.38", "subtotal": "1219.4", "tax": "195.1", "other_taxes": null, "total": "1414.5" }, { "number": "0", "cucop_code": "25401-1090", "description": "ALCOHOL DESNATURALIZADO 70 C/100ML", "unit": "PIEZA", "requested_quantity": "317", "awarded_quantity": null, "unit_price": "9.38", "subtotal": "2973.46", "tax": "475.75", "other_taxes": null, "total": "3449.21" }, { "number": "0", "cucop_code": "25401-1090", "description": "ANTISEPTICOS, ALCOHOL DESNATURALIZADO ENV. C/1LT.", "unit": "PIEZA", "requested_quantity": "525", "awarded_quantity": null, "unit_price": "42.19", "subtotal": "22149.75", "tax": "3543.96", "other_taxes": null, "total": "25693.71" }, { "number": "0", "cucop_code": "25401-8662", "description": "CONTENEDORES, DESECHABLES DE PUNZOCORTANTES, DE POLIPROPILENO, ESTERILIZABLE, INCINERABLE Y NO TOXICO, RESISTENTE A LA PERFORACIONAL IMPACTO Y PERDIDA DEL CONTENIDO, CON O SIN SEPARADOR DE AGUJAS Y ABERTURA PARA EL DEPOSITO DE OTROS PUNZO-CORTANTES, CON TAPA DE SEGURIDAD PARA LAS ABERTURAS DE COLOR ROJO ETIQUETADO CON LEYENDA \"PLEIGRO RESIDUOS PUNZO-CORTANTES BIOLOGICO-INFECCIOSOS\" Y MARCADO CON EL SIMBOLO UNIVERSAL DE RIESGO BIOLOGICO. DEBE CONTAR CON CERTIFICADO ANALITICO CUYAS ESPEC. TEC. DEBEN CUMPLIR LA NORMA-087-SEMARNAT-SSA1 VIG. CAPACIDAD : 0.94 A 1.90 LT.", "unit": "PIEZA", "requested_quantity": "175", "awarded_quantity": null, "unit_price": "40", "subtotal": "7000", "tax": "1120", "other_taxes": null, "total": "8120" }, { "number": "0", "cucop_code": "25401-0149", "description": "CUBRE BOCAS TRIPLE CAPA CAJA CON 50 PZAS", "unit": "PIEZA", "requested_quantity": "60", "awarded_quantity": null, "unit_price": "37.5", "subtotal": "2250", "tax": "360", "other_taxes": null, "total": "2610" }, { "number": "0", "cucop_code": "25401-0149", "description": "CUBREBOCAS DESECHABLES PARA ÁREA HOSPITALARIA. C/100 PIEZAS", "unit": "PIEZA", "requested_quantity": "66", "awarded_quantity": null, "unit_price": "37.5", "subtotal": "2475", "tax": "396", "other_taxes": null, "total": "2871" }, { "number": "0", "cucop_code": "25401-8247", "description": "GUANTES DE LATEX MEDIANO NO ESTERIL. CAJA 100 PZS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "81.88", "subtotal": "818.8", "tax": "131", "other_taxes": null, "total": "949.8" }, { "number": "0", "cucop_code": "25401-8249", "description": "GUANTES DE NITRILO MEDIANOS SIN POLVO. CAJA 100 PZS", "unit": "PIEZA", "requested_quantity": "13", "awarded_quantity": null, "unit_price": "84", "subtotal": "1092", "tax": "174.72", "other_taxes": null, "total": "1266.72" }, { "number": "0", "cucop_code": "25401-8260", "description": "JERINGA DE PLASTICO C/AGUJA CALIBRE 20G Y LONG. 32MM. ESTERIL DESECHABLE CAP. 10ML. ESCALA GRADUADA EN ML.CON DIVISIONES DE 1.0 Y SUBDIVISIONES DE 0.2 ENVASE C/100 PZAS)", "unit": "PIEZA", "requested_quantity": "86", "awarded_quantity": null, "unit_price": "247.5", "subtotal": "21285", "tax": "3405.6", "other_taxes": null, "total": "24690.6" }, { "number": "0", "cucop_code": "25401-0297", "description": "JERINGA DE PLASTICO SIN AGUJA DE 10 ML. CAJA CON 100 PZS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "181.25", "subtotal": "1812.5", "tax": "290", "other_taxes": null, "total": "2102.5" }, { "number": "0", "cucop_code": "25401-0297", "description": "JERINGA DE PLASTICO SIN AGUJA DE 20 ML ESTERIL, CAJA C/50 PIEZAS.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "181.25", "subtotal": "1812.5", "tax": "290", "other_taxes": null, "total": "2102.5" }, { "number": "0", "cucop_code": "25401-0297", "description": "JERINGA DE PLASTICO SIN AGUJA ED 5 ML. CAJA CON 100 PZS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "160", "subtotal": "1600", "tax": "256", "other_taxes": null, "total": "1856" }, { "number": "0", "cucop_code": "25401-0297", "description": "JERINGA DE PLASTICO SIN AGUJA, CON PIVOTE TIPO LUER-LOCK ESTERIL Y DESECHABLE CAP. 5ML ENVASE C/100 PZAS)", "unit": "PIEZA", "requested_quantity": "350", "awarded_quantity": null, "unit_price": "156.25", "subtotal": "54687.5", "tax": "8750", "other_taxes": null, "total": "63437.5" } ] }, { "id": "C-2026-00009598", "internal_reference": "DRMSG-153/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "CELIA GONZALEZ RODRIGUEZ", "normalized_name": "CELIA GONZALEZ RODRIGUEZ", "rfc_type": null }, "contract_period": { "published_at": "2026-07-17T19:12:16.000Z", "starts_at": "2025-12-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "492345.97", "tax": "78775.35", "total": "571121.32", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0510", "description": "BOLSAS DE POLIETILENO TRANSPARENTE AUTOSELLABLES ESTÉRILES DE 69 ONZAS CAJA CON 250 PIEZAS", "unit": "PIEZA", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "10999.9", "subtotal": "120998.9", "tax": "19359.82", "other_taxes": null, "total": "140358.72" }, { "number": "0", "cucop_code": "25401-0599", "description": "CAJA CON 50 TIRAS REACTIVAS PARA GLUCÓMETRO PARLANTE", "unit": "PIEZA", "requested_quantity": "21", "awarded_quantity": null, "unit_price": "1279.8", "subtotal": "26875.8", "tax": "4300.13", "other_taxes": null, "total": "31175.93" }, { "number": "0", "cucop_code": "25401-8154", "description": "GLUCÓMETRO PARLANTE PARA PERSONAS CON DISCAPACIDAD VISUAL QUE ASISTEN A UNIDADES MOASMI", "unit": "PIEZA", "requested_quantity": "21", "awarded_quantity": null, "unit_price": "2579.9", "subtotal": "54177.9", "tax": "8668.46", "other_taxes": null, "total": "62846.36" }, { "number": "0", "cucop_code": "25401-1092", "description": "JABONES PARA USO PREQUIRURGICO, LIQ Y NEUTRO (PH7) ENV C/3850 LTS.", "unit": "PIEZA", "requested_quantity": "105", "awarded_quantity": null, "unit_price": "140", "subtotal": "14700", "tax": "2352", "other_taxes": null, "total": "17052" }, { "number": "0", "cucop_code": "25501-0510", "description": "KIT DE MEDICIÓN DE CLORO RESIDUAL COMPARADORES COLORIMTRICOS (CL RESIDUAL Y PH) COLORIMETRO PORTATIL CHECKER MINI CLORO LIBRE 0-250PPM", "unit": "PIEZA", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "1542.95", "subtotal": "16972.45", "tax": "2715.59", "other_taxes": null, "total": "19688.04" }, { "number": "0", "cucop_code": "25501-0394", "description": "LAMINILLAS TRIGLICERIDOS C/25 LAMINILLAS", "unit": "PIEZA", "requested_quantity": "172", "awarded_quantity": null, "unit_price": "1503.61", "subtotal": "258620.92", "tax": "41379.35", "other_taxes": null, "total": "300000.27" } ] }, { "id": "C-2026-00069366", "internal_reference": "DRMSG-154/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "normalized_name": "CONTROL TECNICO Y REPRESENTACIONES", "rfc_type": null, "slug": "control-tecnico-y-representaciones" }, "contract_period": { "published_at": "2026-07-17T19:28:22.000Z", "starts_at": "2025-12-05T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1264017.9", "tax": "202242.86", "total": "1466260.76", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0510", "description": "KIT DIGITAL PARA DETERMINACIÓN DE CLORO RESIDUAL Y PH, COLORIMETRO DIGITAL PARA CLORO RESIDUAL, PORTATIL. INTERVALO DE MEDICION DE 0.0 A 2.5 PPM, RESOLUCION 0.01, EXACTITUD +/- 0.03 +/- 3% DE LAL LECTURA. FUENTE DE LUZ: LED A 525 NM, DETECTOR DE LUZ: FOTOCELDA DE SILICIO. CAT HI701", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1087.5", "subtotal": "2175", "tax": "348", "other_taxes": null, "total": "2523" }, { "number": "0", "cucop_code": "25301-3575", "description": "KIT FLU-COVID RT-PCR, KIT DE DIAGNOSTICO P/DETECCION DE RNA DEL VIRUS INFLUENZA A (FLUA) INFLUENZA B (FLUB) Y SARS-COV-2 MEDIANTE ONE-STEP REAL-TIME RT-PCR", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "26500", "subtotal": "132500", "tax": "21200", "other_taxes": null, "total": "153700" }, { "number": "0", "cucop_code": "25901-2005", "description": "AGAR DEXTROSA TRIPTONA EXTRACTO (EXTRACTO DE CARNE 3 GR, TRIPTONA 5 GR, GLUCOSA 1 GR, AGAR 15 G) CULTIVO DE BACTERIAS EN EL AGUA, LA LECHE Y OTROS PRODUCTOS LACTEOS CAT 223000 CAD. MIN. 12 MESES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2762", "subtotal": "2762", "tax": "441.92", "other_taxes": null, "total": "3203.92" }, { "number": "0", "cucop_code": "25901-2005", "description": "AGAR INDICADOR PM, FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2494.7", "subtotal": "4989.4", "tax": "798.3", "other_taxes": null, "total": "5787.7" }, { "number": "0", "cucop_code": "25401-0554", "description": "AGUJA VACUTAINER VERDE CAL 21G LONG 38 MM C/100 PZ", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "220", "subtotal": "1320", "tax": "211.2", "other_taxes": null, "total": "1531.2" }, { "number": "0", "cucop_code": "25401-0554", "description": "AGUJA VACUTAINER VERDE CAL 21G LONG 38MM", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "220", "subtotal": "3300", "tax": "528", "other_taxes": null, "total": "3828" }, { "number": "0", "cucop_code": "25401-0034", "description": "ALGODON ABSORBENTE (ENVASE CON 500 ROLLOS)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "125", "subtotal": "625", "tax": "100", "other_taxes": null, "total": "725" }, { "number": "0", "cucop_code": "25901-2005", "description": "ALMIDON REACTIVO PARA YODOMETRIA, USO DE LABORATORIO CAS 9005-85-9. FRASCO 100 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "130", "subtotal": "130", "tax": "20.8", "other_taxes": null, "total": "150.8" }, { "number": "0", "cucop_code": "25901-1189", "description": "ANTI-ZIKA VIRUS ELISA (IGM). ZIKV DETECT TM 2.0 IGM CAPTURE ELISA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "23800", "subtotal": "47600", "tax": "7616", "other_taxes": null, "total": "55216" }, { "number": "0", "cucop_code": "25401-0040", "description": "APLICADOR DE MADERA SIN ALGODON C/750 PIEZAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "110", "subtotal": "1100", "tax": "176", "other_taxes": null, "total": "1276" }, { "number": "0", "cucop_code": "25401-4569", "description": "APLICADORES DE MADERA CON ALGODON BOLSA CON 150 PZAS", "unit": "PIEZA", "requested_quantity": "25", "awarded_quantity": null, "unit_price": "115", "subtotal": "2875", "tax": "460", "other_taxes": null, "total": "3335" }, { "number": "0", "cucop_code": "25501-0039", "description": "BHQ1 HURNASE-P, TTCTGACCTGAAGGCTCTGCGCG, 200 NMOL, HPLC, NO. DE BASES 27, MODIFICACIONES 5’ FAM, 3’ BHQ1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6725", "subtotal": "6725", "tax": "1076", "other_taxes": null, "total": "7801" }, { "number": "0", "cucop_code": "25901-1270", "description": "BUFFER DE REFERENCIA CERTIFICADA PH 7 A NIST C/ CERTIFICADO. FRASCO 500 ML", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "445", "subtotal": "3560", "tax": "569.6", "other_taxes": null, "total": "4129.6" }, { "number": "0", "cucop_code": "25901-2005", "description": "BUFFER SOLUCION ESTANDAR DE CALIBRACION PARA CONDUCTIMETRO DE 1413 MS/CM (692 PPM) CON CERTIFICADO CAT. 11007", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3195", "subtotal": "3195", "tax": "511.2", "other_taxes": null, "total": "3706.2" }, { "number": "0", "cucop_code": "25401-6025", "description": "CAJA DE VIDRIO PARA TINCION HIRIZONTAL, CON TAPA Y CANASTILLA, ASA DE MATAL. CANASTILLA CON 10 RANURAS P/20 PORT DE 26X76 MMNASTILLA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2120", "subtotal": "4240", "tax": "678.4", "other_taxes": null, "total": "4918.4" }, { "number": "0", "cucop_code": "25501-0510", "description": "CALDO LAURIL SULFATO TRIPTOSA, FRASCO 450 GR.", "unit": "PIEZA", "requested_quantity": "16", "awarded_quantity": null, "unit_price": "1346", "subtotal": "21536", "tax": "3445.76", "other_taxes": null, "total": "24981.76" }, { "number": "0", "cucop_code": "25501-0479", "description": "CRIOTUBO DE 2ML CON TAPA PLANA DESMONTABLE, ESTERIL, GRADUADO. PQT CON 50 PZS", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "260", "subtotal": "1560", "tax": "249.6", "other_taxes": null, "total": "1809.6" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO COMBINADO ISE P/FLUORURO CUERPO EPOXICO 1M CABLE IMPERMEABLE CONECTOR BNC TEMPERATURA DE FUNCIONAMIENTO, CONTINUO: DE 0 °C A 80 °C. JUNTA SURE-FLOW.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "27320", "subtotal": "27320", "tax": "4371.2", "other_taxes": null, "total": "31691.2" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO COMBINADO PARA PH CON COMPENSADOR DE TEMPERATURA ATC, ELECTRODO COMBINADO DE PH/ATC CON SENSOR Y COMPENSADOR DE TEMPERATURA INTEGRADO, RELLENABLES ULTRA TRIODE CON UN CONECTOR BNC Y MINIDIN DE 8 PINES Y CABLE DE 1 METRO JUNTA FIBRA DE VIDRIO MATERIAL CUERPO EPÓXICO INTERVALO DE PH 0 A 14 TEMPERATURA DE FUNCIONAMIENTO 0 °C A 100 °C- COMPATIBLE CON MEDIDOR THERMO SCIENTIFIC™ ORION™", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "9845", "subtotal": "39380", "tax": "6300.8", "other_taxes": null, "total": "45680.8" }, { "number": "0", "cucop_code": "25901-2005", "description": "EQUIPO ESTÁNDARES DE FORMACINA PARA TURBIDEZ (ESTANDARES PRIMARIOS DE FORMACINA PARA TURBIDEZ CON CERTIFICADO PARA CADA VIAL DE: <0,1 NTU, 20 NTU, 200 NTU, 1000 NTU Y 4000 NTU) SET C/5 VIALES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4300", "subtotal": "4300", "tax": "688", "other_taxes": null, "total": "4988" }, { "number": "0", "cucop_code": "25901-2005", "description": "EQUIPO TOXINA ESTAFILOCOCCICA PARA INMUNOENSAYO VISUAL SET TOTALES KIT, CONTIENE OLACA P/96 PBS, CONTROL POSITIVO, CONTROL NEGATIVO CAT. R4105", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "34900", "subtotal": "69800", "tax": "11168", "other_taxes": null, "total": "80968" }, { "number": "0", "cucop_code": "25901-1172", "description": "FORWARD PRIMER (RV98F), GGCAGTTGGGTAAGAGACCA, 200 NMOL, HPLC, NO. DE BASES 20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1760", "subtotal": "1760", "tax": "281.6", "other_taxes": null, "total": "2041.6" }, { "number": "0", "cucop_code": "25501-0510", "description": "FRASCO PLÁSTICO BOCA ANCHA DE 1000 ML. C/TAPA DE ROSCA RESISTENTE A LA ESTERILIZACION", "unit": "PIEZA", "requested_quantity": "75", "awarded_quantity": null, "unit_price": "53", "subtotal": "3975", "tax": "636", "other_taxes": null, "total": "4611" }, { "number": "0", "cucop_code": "25901-1172", "description": "INICIADOR RNASAS P (HURNASE-P-F), AGATTTGGACCTGCGAGCG, 200 NMOL, HPLC, NO. DE BASES 19", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1733", "subtotal": "1733", "tax": "277.28", "other_taxes": null, "total": "2010.28" }, { "number": "0", "cucop_code": "25901-1172", "description": "INICIADOR RNASAS P (HURNASE-P-R), GAGCGGCTGTCTCCACAAGT, 200 NMOL, HPLC, NO. DE BASES 20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1760", "subtotal": "1760", "tax": "281.6", "other_taxes": null, "total": "2041.6" }, { "number": "0", "cucop_code": "25901-1172", "description": "INICIADOR SARAMPIÓN MVN1139-F, TGGCATCTGAACTCGGTATCAC, 200 NMOL, HPLC, NO. DE BASES 22", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1815", "subtotal": "1815", "tax": "290.4", "other_taxes": null, "total": "2105.4" }, { "number": "0", "cucop_code": "25901-1172", "description": "INICIADOR SARAMPIÓN MVN1213-R, TGTCCTCAGTAGTATGCATTGCAA, 200 NMOL, HPLC, NO. DE BASES 24", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1870", "subtotal": "1870", "tax": "299.2", "other_taxes": null, "total": "2169.2" }, { "number": "0", "cucop_code": "25501-0379", "description": "JUEGO DE REACTIVOS PARA VDRL-ANTIGENO USR ID, VDRL C/CONTROLES KIT C/250 PRUEBAS (SPINREACT, EVALUADO POR INDRE) FRASCO 5 ML (KIT 250 PBS)", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "980", "subtotal": "7840", "tax": "1254.4", "other_taxes": null, "total": "9094.4" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT AQUABC RAPID TESTING PSP (INCLUYE BUFFER, TIRAS REACTIVAS, DESECANTE AZUL E INSTRUCTIVO), PRUEBA RÁPIDA PARA PSP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERAL. CAJA CON 10 PRUEBAS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9990", "subtotal": "9990", "tax": "1598.4", "other_taxes": null, "total": "11588.4" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT DE DISOLUCIONES DECOLORANTES R-1699, (R-BIOPHARM) DECOLORANTE DE MUESTRAS (CLENBUTEROL) KIT CON 3 DISOLUCIONES ELIMINA LAS SUSTANCIAS INTERFERENTES POR PRECIPITACIÓN EN MUESTRAS DE HIGADO, KIT CON 400 PRUEBAS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7350", "subtotal": "7350", "tax": "1176", "other_taxes": null, "total": "8526" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT DE EXTRACCION QIA AMP VIRAL RNA, KIT DE PURIFICACION DE ARN VIRAL 250 PREPS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "35660", "subtotal": "356600", "tax": "57056", "other_taxes": null, "total": "413656" }, { "number": "0", "cucop_code": "25901-2033", "description": "KIT RIDASCREEN SET TOTAL, EQUIPO TOXINA ESTAF.P/INMUNOENSAYO C/96 PBAS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "34900", "subtotal": "34900", "tax": "5584", "other_taxes": null, "total": "40484" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT SCOTIA RAPID TEST-ASP (BUFFER, TIRAS REACTIVAS, DESECANTE AZUL, INSTRUCTIVO), PRUEBA RÁPIDA PARA ASP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERA. CAJA C/ 10 PRUEBAS. DETERMINACIÓN FICOTOXINAS MARINAS (ÁCIDO DOMOICO).", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984", "subtotal": "9984", "tax": "1597.44", "other_taxes": null, "total": "11581.44" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT SCOTIA RAPID TEST-ASP (BUFFER, TIRAS REACTIVAS, DESECANTE AZUL, INSTRUCTIVO), PRUEBA RÁPIDA PARA ASP EN FORMATO DE TESTS RÁPIDOS DE FLUJO LATERAL. CAJA CON 10 PRUEBAS.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9984", "subtotal": "9984", "tax": "1597.44", "other_taxes": null, "total": "11581.44" }, { "number": "0", "cucop_code": "25901-0647", "description": "LEPTOSPIRA ENRIQUECIMIENTO CAJA CON 6 FCOS. DE 100 ML. ENRIQUECIMIENTO P/LEPTOSPIRA 6 X 100ML. CAJA 6 FCOS. 100 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9540", "subtotal": "9540", "tax": "1526.4", "other_taxes": null, "total": "11066.4" }, { "number": "0", "cucop_code": "25501-0039", "description": "MAYV-FNP, ACAGATCAGACATGCAGG, 200 NMOL, HPLC, NO, DE BASES 18, MODIFICACIONES 5’ MIKE, 3’ 4BOND", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13885", "subtotal": "13885", "tax": "2221.6", "other_taxes": null, "total": "16106.6" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA 1 A 10 ML (1000 A 10000 UL) VOLUMEN VARIABLE MONOCANAL, CERTIFICADO DE CALIBRACION.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7780", "subtotal": "7780", "tax": "1244.8", "other_taxes": null, "total": "9024.8" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA AUTOMATICA VARIABLE DE 100-1000 UL", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1050", "subtotal": "3150", "tax": "504", "other_taxes": null, "total": "3654" }, { "number": "0", "cucop_code": "25501-0429", "description": "MICROTUBO CONICO DE PLASTICO 1.5ML CON TAPA. PAQ CON 500 PZS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "256", "subtotal": "256", "tax": "40.96", "other_taxes": null, "total": "296.96" }, { "number": "0", "cucop_code": "25501-0446", "description": "MICROTUBOS CON TAPÓN A PRESIÓN DE 1.5 ML, CERTIFICADO DE CALIDAD, TUBOS DE 1.5 ML DE POLIPROPILENO CÓNICO, TAPO A PRESIÓN SAFE-LOCK, PARA CENTRIFUGAR A 30000×G. CAJA DE 2X500.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1430", "subtotal": "2860", "tax": "457.6", "other_taxes": null, "total": "3317.6" }, { "number": "0", "cucop_code": "25501-0039", "description": "MVNP1163-P, CCGAGGATGCAAGGCTTGTTTCAGA, 200 NMOL, HPLC, NO. DE BASES 29, MODIFICACIONES 5’ FAM, 3’ BHQ1", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6722", "subtotal": "6722", "tax": "1075.52", "other_taxes": null, "total": "7797.52" }, { "number": "0", "cucop_code": "25501-0039", "description": "OROV_FNP, CATTTGAAGCTAGATACGG, 200 NMOL, HPLC, NO. DE BASES 19, MODIFICACIONES 5’FAM, 3’ 4BOND", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13885", "subtotal": "13885", "tax": "2221.6", "other_taxes": null, "total": "16106.6" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO NO.2 DE 125 MM. CAJA 100 PZS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "480", "subtotal": "3840", "tax": "614.4", "other_taxes": null, "total": "4454.4" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO NO.42 DE 90 MM SIN CENIZAS. CAJA CON 100 PZS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "950", "subtotal": "3800", "tax": "608", "other_taxes": null, "total": "4408" }, { "number": "0", "cucop_code": "25501-0510", "description": "PH-INDICATOR STRIPS PH 0 – 6, INCREMENTOS DE 0.5 UNIDADES. CAT. 1.09531.0001. CAJA CON 100", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "427", "subtotal": "2135", "tax": "341.6", "other_taxes": null, "total": "2476.6" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA DE TRANSFERENCIA, CAPACIDAD 5 ML, PAQUETE 500 PZS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "380", "subtotal": "380", "tax": "60.8", "other_taxes": null, "total": "440.8" }, { "number": "0", "cucop_code": "25501-0510", "description": "PIPETAS DE 1 ML. CERTIFICADO DE CALIDAD, GRADUADAS EN 0.1ML, PIPETA BACTERIOLOGICA DE VIDRIO DE 1 ML. CON SUBDIVISIONES 0.1. PIEZA", "unit": "PIEZA", "requested_quantity": "250", "awarded_quantity": null, "unit_price": "111", "subtotal": "27750", "tax": "4440", "other_taxes": null, "total": "32190" }, { "number": "0", "cucop_code": "25501-0510", "description": "PIZETA DE PLASTICO DE 100 ML", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "100", "subtotal": "400", "tax": "64", "other_taxes": null, "total": "464" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTA OBJETOS DE VIDRIO 75 X 25 MM BORDE ESMERILADO CAJA 50 PZS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "30", "subtotal": "150", "tax": "24", "other_taxes": null, "total": "174" }, { "number": "0", "cucop_code": "25501-0039", "description": "PROBE(RUV), ACATCGCGCACTTCCCACG, 200 NMOL, HPLC, NO. DE BASES 23, MODIFICACIONES 5’ FAM, 3’ BHQ", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6722", "subtotal": "6722", "tax": "1075.52", "other_taxes": null, "total": "7797.52" }, { "number": "0", "cucop_code": "25901-2005", "description": "PRUEBA RAPIDA PARA PSP EN FORMATO DE TESTS RAPIDOS DE FLUJO LATERAL, CAJA C/ 10 PRUEBAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9990", "subtotal": "19980", "tax": "3196.8", "other_taxes": null, "total": "23176.8" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS CON FILTRO 0.1-100 UL. PUNTAS 100UL CLARAS ESTERIL C/FILTRO RACK CON 960 PIEZA(S) AXYGEN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2280", "subtotal": "2280", "tax": "364.8", "other_taxes": null, "total": "2644.8" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS CON FILTRO 0.5 - 10 UL.PUNTAS 10UL CLARAS ESTERIL MAXYMUM RECOVERY C/FILTRO RACK CON 960 PIEZA(S) AXYGEN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1885", "subtotal": "1885", "tax": "301.6", "other_taxes": null, "total": "2186.6" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS CON FILTRO 2-100 UL. PUNTAS 2-100UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4960", "subtotal": "4960", "tax": "793.6", "other_taxes": null, "total": "5753.6" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS CON FILTRO 2-20 UL. PUNTAS 2-20UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4960", "subtotal": "4960", "tax": "793.6", "other_taxes": null, "total": "5753.6" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS CON FILTRO 50-1000 UL. PUNTAS 50-1000UL CLARAS ESTERIL DUALFILTER PCR CLEAN C/960 (10 RACKS C/96) EPPENDORF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5450", "subtotal": "5450", "tax": "872", "other_taxes": null, "total": "6322" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS DESECHABLES PARA PIPETORES 1-200 MICROLITROS (BLANCAS), AXIGEN", "unit": "PIEZA", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "275", "subtotal": "3025", "tax": "484", "other_taxes": null, "total": "3509" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS DESECHABLES PARA PIPETORES DE 1-200 MICROLITROS (AMARILLAS), AXIGEN. PUNTAS 200UL AMARILLAS NO ESTERIL BISELADAS PAQUETE(S) CON 1000 PIEZA(S) AXYGEN", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "290", "subtotal": "2030", "tax": "324.8", "other_taxes": null, "total": "2354.8" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS ESTERILES DE 0.5 A 20 UL PCR. PUNTAS 20UL CLARAS ESTERIL C/FILTRO PAQUETE(S) CON 960 PIEZA(S) AXYGEN", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1170", "subtotal": "1170", "tax": "187.2", "other_taxes": null, "total": "1357.2" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS ESTERILES S/FILTRO 0,1-10 UL P/PCR. PUNTAS 0.1-10UL CLARAS ESTERIL DUALFILTER PCR CLEAN 40MM C/960 (10 RACKS C/96 PIEZAS) EPPENDORF", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "5270", "subtotal": "42160", "tax": "6745.6", "other_taxes": null, "total": "48905.6" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA INCOLORA RANGO 50- 1250 UL. MARCA EPPENDORF. PUNTAS 1250UL CLARAS NO ESTERIL EPPENDORF QUALITY C/1000 EPPENDORF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2330", "subtotal": "2330", "tax": "372.8", "other_taxes": null, "total": "2702.8" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTILLAS T-1000-B AZUL. PUNTAS 1000UL AZULES NO ESTERIL PAQUETE(S) CON 1000 PIEZA(S) AXYGEN", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "540", "subtotal": "1080", "tax": "172.8", "other_taxes": null, "total": "1252.8" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO DE COLILERT C/200 PRUEBAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "35980", "subtotal": "71960", "tax": "11513.6", "other_taxes": null, "total": "83473.6" }, { "number": "0", "cucop_code": "25901-1172", "description": "REVERSE PRIMER (RV251R), CGTGGAGTGCTGGGTGAT, 200 NMOL, HPLC, NO. DE BASES 18", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1706", "subtotal": "1706", "tax": "272.96", "other_taxes": null, "total": "1978.96" }, { "number": "0", "cucop_code": "25901-1172", "description": "RNASAP_F, AGATTTGGACCTGCGAGCG, 200 NMOL, HPLC, NO. DE BASES 19", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1733", "subtotal": "1733", "tax": "277.28", "other_taxes": null, "total": "2010.28" }, { "number": "0", "cucop_code": "25501-0039", "description": "RNASAP_PB, TTCTGACCTGAAGGCTCTGCGCG, 200 NMOL, HPLC, NO. DE BASES 23, MODIFICACIONES 5’ QUASAR 705, 3’ BHQ2", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10782", "subtotal": "10782", "tax": "1725.12", "other_taxes": null, "total": "12507.12" }, { "number": "0", "cucop_code": "25901-1172", "description": "RNASAP_R, GAGCGGCTGTCTCCACAAGT, 200 NMOL, HPLC, NO. DE BASES 20", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1760", "subtotal": "1760", "tax": "281.6", "other_taxes": null, "total": "2041.6" }, { "number": "0", "cucop_code": "25501-0510", "description": "SISTEMA DE FILTRACION 500ML, MEMBRANA SFCA (ACETATO DE CELULOSA SIN SURFACTANTES) 75MM, 0.2UM ESTERIL RAPID-FLOW PIEZA(S) CON 1 PIEZA(S) NALGENE", "unit": "PIEZA", "requested_quantity": "42", "awarded_quantity": null, "unit_price": "520", "subtotal": "21840", "tax": "3494.4", "other_taxes": null, "total": "25334.4" }, { "number": "0", "cucop_code": "25901-1270", "description": "SOLUCION AMORTIGUADORA PBS 10X, PH 7.2, PARA CULTIVO DE CELULAR", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1545", "subtotal": "3090", "tax": "494.4", "other_taxes": null, "total": "3584.4" }, { "number": "0", "cucop_code": "25901-1270", "description": "SOLUCIÓN AMORTIGUADORA TISAB II, PARA ISE DE FLUORURO CON CDTA C/CERTIFICADO, FRASCO DE 3.78 LT.", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2400", "subtotal": "7200", "tax": "1152", "other_taxes": null, "total": "8352" }, { "number": "0", "cucop_code": "25901-1270", "description": "SOLUCION PARA AJUSTE DE ELECTRODO TISAB II PARA ISE DE FLUORURO CON CDTA C/CERTIFICADO FRASCO 3.78 LTS CAT. D 940909", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4108", "subtotal": "4108", "tax": "657.28", "other_taxes": null, "total": "4765.28" }, { "number": "0", "cucop_code": "25501-0510", "description": "TAPA OPTICA EN TIRA DE 8 P/TIRAS DE TUBOS MICROAMP COMPATIBLE CON TERMOCICLADORES THERMO SCIENTIFIC C/300 APPLIED BIOSYSTEMS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "4235", "subtotal": "33880", "tax": "5420.8", "other_taxes": null, "total": "39300.8" }, { "number": "0", "cucop_code": "25901-2005", "description": "TBX, FRASCO 500 GR.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10170", "subtotal": "20340", "tax": "3254.4", "other_taxes": null, "total": "23594.4" }, { "number": "0", "cucop_code": "25901-1172", "description": "TCTCATGCGTCTCCCTGGTGAATGTG 200NMOL, HPLC, 26 BASES, CY5 BHQ-2 T4 OLIGO, CAT. IAC SONDA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10780", "subtotal": "10780", "tax": "1724.8", "other_taxes": null, "total": "12504.8" }, { "number": "0", "cucop_code": "25101-0060", "description": "TIOSULFATO DE SODIO, O.1 N SOLUCION VALORADA CON CERTIFICADO, TOLERANCIA DE ± 0.005N. FRASCO DE 1LT.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "118", "subtotal": "236", "tax": "37.76", "other_taxes": null, "total": "273.76" }, { "number": "0", "cucop_code": "25401-0599", "description": "TIRAS REACTIVAS INDICADOR DE 0.0 A 6.0 (DIVISIONES DE 0.5 UNIDADES DE PH), H-INDICATOR STRIPS PH 0 – 6, INCREMENTOS DE 0.5 UNIDADES . CAJA DE 100 PIEZAS.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "425", "subtotal": "850", "tax": "136", "other_taxes": null, "total": "986" }, { "number": "0", "cucop_code": "25501-0429", "description": "TUBO CÓNICO ESTÉRIL DE 50 ML. GRADUADO DE POLIPROPILENO, BOLSA C/25 TUBOS", "unit": "PIEZA", "requested_quantity": "22", "awarded_quantity": null, "unit_price": "152", "subtotal": "3344", "tax": "535.04", "other_taxes": null, "total": "3879.04" }, { "number": "0", "cucop_code": "25501-0446", "description": "TUBO DE POLIESTIRENO CON TAPA 12 X 75 MM", "unit": "PIEZA", "requested_quantity": "3000", "awarded_quantity": null, "unit_price": "2.9", "subtotal": "8700", "tax": "1392", "other_taxes": null, "total": "10092" }, { "number": "0", "cucop_code": "25501-0510", "description": "TUBO DE VIDRIO DE 13X100 CON ROSCA TAPON DE VAQUELITA", "unit": "PIEZA", "requested_quantity": "500", "awarded_quantity": null, "unit_price": "8.2", "subtotal": "4100", "tax": "656", "other_taxes": null, "total": "4756" }, { "number": "0", "cucop_code": "25501-0429", "description": "TUBO P/CENTRIFUGA 15ML DE POLIPROPILENO FONDO CONICO ALTA CLARIDAD TAPON DE ROSCA C/SELLO DE DOMO ESTERIL PAQUETE(S) CON 50 PIEZA(S) FALCON", "unit": "PIEZA", "requested_quantity": "47", "awarded_quantity": null, "unit_price": "245.5", "subtotal": "11538.5", "tax": "1846.16", "other_taxes": null, "total": "13384.66" }, { "number": "0", "cucop_code": "25501-0429", "description": "TUBO P/CENTRIFUGA 50ML DE POLIPROPILENO ALTA CLARIDAD FONDO CONICO, GRADUADO ESTERIL C/TAPA DE POLIETILENO AZUL PAQUETE(S) CON 25.00 PIEZA(S) FALCON", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "152", "subtotal": "3040", "tax": "486.4", "other_taxes": null, "total": "3526.4" }, { "number": "0", "cucop_code": "25401-8025", "description": "TUBO POLIPROPILENO TAPÓN A PRESIÓN, 5,0 ML, CLARO, NO ESTÉRIL. CAT 0030119401. PAQUETE DE 2 BOLSAS POR 100 TUBOS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1278", "subtotal": "1278", "tax": "204.48", "other_taxes": null, "total": "1482.48" }, { "number": "0", "cucop_code": "25401-8025", "description": "TUBOS DE 1.5 ML DE POLIPROPILENO CONICO TAPON A PRESION SAFE-LOCK PRA CENTRIFUGA A 30000XG.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "259", "subtotal": "259", "tax": "41.44", "other_taxes": null, "total": "300.44" }, { "number": "0", "cucop_code": "25501-0457", "description": "TUBOS DE CENTRIFUGA CÓNICOS DE POLIPROPILENO DE 50 Y 15 ML GRADUADOS CON TAPA DE ROSCA, NO ESTÉRILES REUTILIZABLES CERTIFICADO DE CALIDAD, TUBO P/CENTRIFUGA 15 ML, POLIPROPILENO CLARO FONDO CONICO, 17X114 MM. RFC MÁXIMO: 12,000 X G, TAPON DE ROSCA. BOLSA CON 50 PIEZA.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "152", "subtotal": "304", "tax": "48.64", "other_taxes": null, "total": "352.64" }, { "number": "0", "cucop_code": "25501-0510", "description": "TUBOS PARA BIOQUÍMICASDE 13 X 100 MM, TUBO DE VIDRIO DE 13X100 CON ROSCA TAPON DE VAQUELITA. PIEZA", "unit": "PIEZA", "requested_quantity": "1000", "awarded_quantity": null, "unit_price": "8.2", "subtotal": "8200", "tax": "1312", "other_taxes": null, "total": "9512" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADOS UTILIZAR PREFERENTEMENTE DE POLIETILENO O TFE, VASOS DE PRECIPITADO DE 150 ML POLIETILENO O POLIPROPILENO. 201-0150.", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "112", "subtotal": "896", "tax": "143.36", "other_taxes": null, "total": "1039.36" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS DE PRECIPITADO DE 600 ML POLIETILENO O POLIPROPILENO,", "unit": "PIEZA", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "198", "subtotal": "1782", "tax": "285.12", "other_taxes": null, "total": "2067.12" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS DE PRECIPITADOS DE 50 ML, PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "48", "subtotal": "192", "tax": "30.72", "other_taxes": null, "total": "222.72" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS DE PRECIPITADOS DE 600 ML, CERTIFICADO DE CALIDAD (SI APLICA), VASO DE PRECIPITADO DE VIDRIO DE BOROSILICATO DE 600 ML", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "112.5", "subtotal": "675", "tax": "108", "other_taxes": null, "total": "783" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASOS DE PRECIPITADOS, CON CERTIFICADO DE CALIDAD (SI APLICA), VASOS DE PRECIPITADO DE 150 ML VIDRIO.", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "54", "subtotal": "1080", "tax": "172.8", "other_taxes": null, "total": "1252.8" }, { "number": "0", "cucop_code": "25901-0786", "description": "VERDE BRILLANTE, CALDO VERDE BRILLANTE AL 2 %,. FRASCO CON 500 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3246", "subtotal": "3246", "tax": "519.36", "other_taxes": null, "total": "3765.36" } ] }, { "id": "C-2026-00069350", "internal_reference": "DRMSG-155/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "ELEMENTOS Y COMPUESTOS QUIMICOS DE ALTO DESEMPEÑO SA DE CV", "normalized_name": "ELEMENTOS Y COMPUESTOS QUIMICOS DE ALTO DESEMPENO", "rfc_type": null, "slug": "elementos-y-compuestos-quimicos-de-alto-desempeno" }, "contract_period": { "published_at": "2026-07-17T19:07:20.000Z", "starts_at": "2025-12-05T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "11668", "tax": "1866.88", "total": "13534.88", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-1692", "description": "ÁCIDO CLORHÍDRICO, FRASCO CON 500 ML", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "119", "subtotal": "357", "tax": "57.12", "other_taxes": null, "total": "414.12" }, { "number": "0", "cucop_code": "25901-2005", "description": "ALFA NAFTOL CAT. 90-15-2.FRASCO 250 GRS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2099", "subtotal": "4198", "tax": "671.68", "other_taxes": null, "total": "4869.68" }, { "number": "0", "cucop_code": "25901-2005", "description": "CITRATO DE AMONIO Y HIERRO III. FRASCO 100 GRS. SIGMA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "220", "subtotal": "220", "tax": "35.2", "other_taxes": null, "total": "255.2" }, { "number": "0", "cucop_code": "25301-0571", "description": "CLORURO DE SODIO (NACL), GRADO REACTIVO LIBRE DE FLÚOR, NACL RA/ACS, FRASCO CON 500GR.", "unit": "PIEZA", "requested_quantity": "27", "awarded_quantity": null, "unit_price": "95", "subtotal": "2565", "tax": "410.4", "other_taxes": null, "total": "2975.4" }, { "number": "0", "cucop_code": "25901-0857", "description": "FENOLFTALEINA 1% EN SOLUCION ALOHOL 96º.FRASCO 125 ML", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "199", "subtotal": "199", "tax": "31.84", "other_taxes": null, "total": "230.84" }, { "number": "0", "cucop_code": "25901-2005", "description": "HIPOCLORITO DE SODIO, SOLUCION 4-4.99% GRADO REACTIVO, CON CERTIFICADO. FRASCO CON 500 ML.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "290", "subtotal": "290", "tax": "46.4", "other_taxes": null, "total": "336.4" }, { "number": "0", "cucop_code": "25901-1696", "description": "NARANJADO DE METILO INDOCADOR. FRASCO DE 10 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "290", "subtotal": "290", "tax": "46.4", "other_taxes": null, "total": "336.4" }, { "number": "0", "cucop_code": "25401-7653", "description": "PEROXIDO DE HIDROGENO AL 30 POR CIENTO, FRASCO 500 ML.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "129", "subtotal": "129", "tax": "20.64", "other_taxes": null, "total": "149.64" }, { "number": "0", "cucop_code": "25901-0552", "description": "PÚRPURA DE BROMOCRESOL, PRESENTACION DE 5G", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "510", "subtotal": "510", "tax": "81.6", "other_taxes": null, "total": "591.6" }, { "number": "0", "cucop_code": "25901-1849", "description": "YODATO DE POTASIO, AR CERTIFICADO, PUREZA 99.9%. MARCA FISHER CAT P/5800. FRASCO 100 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "450", "subtotal": "450", "tax": "72", "other_taxes": null, "total": "522" }, { "number": "0", "cucop_code": "25901-1780", "description": "YODURO DE POTASIO, KL RA/ACS FRASCO CON 100GR.", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "410", "subtotal": "2460", "tax": "393.6", "other_taxes": null, "total": "2853.6" } ] }, { "id": "C-2026-00009625", "internal_reference": "DRMSG-156/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "JESUS GONZALEZ RENTERIA", "normalized_name": "JESUS GONZALEZ RENTERIA", "rfc_type": null }, "contract_period": { "published_at": "2026-07-17T19:05:18.000Z", "starts_at": "2025-12-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "287741.62", "tax": "46038.66", "total": "333780.28", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0510", "description": "PASTILLAS DPD PAQUETE CON 1000 TABLETAS.", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1129.92", "subtotal": "11299.2", "tax": "1807.87", "other_taxes": null, "total": "13107.07" }, { "number": "0", "cucop_code": "25501-0510", "description": "PASTILLAS DPD PAQUETE CON 1000 TABLETAS.", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1129.92", "subtotal": "6779.52", "tax": "1084.72", "other_taxes": null, "total": "7864.24" }, { "number": "0", "cucop_code": "25401-6492", "description": "AGAR CUENTA ESTÁNDAR, FRASCO 500 GR.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1183.68", "subtotal": "1183.68", "tax": "189.39", "other_taxes": null, "total": "1373.07" }, { "number": "0", "cucop_code": "25901-0654", "description": "AGAR DE HIERRO Y LISINA (LIA), FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1359.36", "subtotal": "5437.44", "tax": "869.99", "other_taxes": null, "total": "6307.43" }, { "number": "0", "cucop_code": "25901-0018", "description": "AGAR MACCONKEY, FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "959.76", "subtotal": "959.76", "tax": "153.56", "other_taxes": null, "total": "1113.32" }, { "number": "0", "cucop_code": "25901-0658", "description": "AGAR NUTRITIVO, FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1271.52", "subtotal": "5086.08", "tax": "813.77", "other_taxes": null, "total": "5899.85" }, { "number": "0", "cucop_code": "25901-0646", "description": "AGAR SAL Y MANITOL ES UN MEDIO SELECTIVO MUY EMPLEADO PARA AISLAR ESTAFILOCOCOS PATOGENOS DE MATERIALES CLINICOS DIVERSOS (ORINAS, GENITALES, HERIDAS, EXUDADOS FARANGEOS, ETC.) CAT 214600 CAD. MIN. 12 MESES FCO 450 GRS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "617.76", "subtotal": "617.76", "tax": "98.84", "other_taxes": null, "total": "716.6" }, { "number": "0", "cucop_code": "25901-0737", "description": "AGAR SANGRE (5% CÉLULAS ROJAS DE OVEJA), FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1160.64", "subtotal": "11606.4", "tax": "1857.02", "other_taxes": null, "total": "13463.42" }, { "number": "0", "cucop_code": "25901-0783", "description": "AGAR TIOSULFATO, CITRATO, SALES BILIARES Y SACAROSA (TCBS) FRASCO 500 GR", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "1776.24", "subtotal": "26643.6", "tax": "4262.98", "other_taxes": null, "total": "30906.58" }, { "number": "0", "cucop_code": "25901-0783", "description": "AGAR TIOSULFATO, CITRATO, SALES BILIARES Y SACAROSA (TCBS), FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "1614.24", "subtotal": "32284.8", "tax": "5165.57", "other_taxes": null, "total": "37450.37" }, { "number": "0", "cucop_code": "25901-0823", "description": "AGAR XILOSA, LISINA, DESOXICOLATO XLD, FRASCO 500 GR.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1656", "subtotal": "3312", "tax": "529.92", "other_taxes": null, "total": "3841.92" }, { "number": "0", "cucop_code": "25401-0048", "description": "BARNIZ DE COPAL (USO MEDICO)", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "100.8", "subtotal": "2016", "tax": "322.56", "other_taxes": null, "total": "2338.56" }, { "number": "0", "cucop_code": "25901-0756", "description": "CALDO MR-VP, FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "936", "subtotal": "1872", "tax": "299.52", "other_taxes": null, "total": "2171.52" }, { "number": "0", "cucop_code": "25901-0834", "description": "CALDO SOYA TRIPTICASEÍNA CST, FRASCO 500 GR.", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "993.6", "subtotal": "1987.2", "tax": "317.95", "other_taxes": null, "total": "2305.15" }, { "number": "0", "cucop_code": "25401-8227", "description": "CEMENTO DE IONOMERO DE VIDRIO RESTAURATIVO", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "644.4", "subtotal": "6444", "tax": "1031.04", "other_taxes": null, "total": "7475.04" }, { "number": "0", "cucop_code": "25901-0816", "description": "CITRATO DE SIMMONS, FRASCO 450 GR.", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1321.2", "subtotal": "3963.6", "tax": "634.18", "other_taxes": null, "total": "4597.78" }, { "number": "0", "cucop_code": "25901-0009", "description": "HIPOCLORITO DE CALCIO (CUÑETE DE 45 KG)", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "6291.6", "subtotal": "37749.6", "tax": "6039.94", "other_taxes": null, "total": "43789.54" }, { "number": "0", "cucop_code": "25901-2005", "description": "KIT DE MEDICIÓN DE CLORO RESIDUAL, COMPARADOR COLORIMETRICO KIT PARA MONITOREO DE CLORO RESIDUAL CON ESCALA COLORIMETRICA DE 0.2 A 3 PARTES POR MILLON Y PH. DE 0 A14.L", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "391.62", "subtotal": "7832.4", "tax": "1253.18", "other_taxes": null, "total": "9085.58" }, { "number": "0", "cucop_code": "25901-2005", "description": "MEDIO PARA PRUEBA DE MOVILIDAD (SEMISÓLIDA), FRASCO 450 GR", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1569.6", "subtotal": "1569.6", "tax": "251.14", "other_taxes": null, "total": "1820.74" }, { "number": "0", "cucop_code": "25401-0335", "description": "PAPEL INDICADOR DE CONTACTO OCLUSAL", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "12", "subtotal": "60", "tax": "9.6", "other_taxes": null, "total": "69.6" }, { "number": "0", "cucop_code": "25901-2005", "description": "REACTIVO ENTEROLERT", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "59518.49", "subtotal": "119036.98", "tax": "19045.92", "other_taxes": null, "total": "138082.9" } ] }, { "id": "C-2026-00069323", "internal_reference": "DRMSG-157/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "KORALLMEDICS SA DE CV", "normalized_name": "KORALLMEDICS", "rfc_type": null, "slug": "korallmedics" }, "contract_period": { "published_at": "2026-07-17T19:01:37.000Z", "starts_at": "2025-12-05T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "14550", "tax": "2328", "total": "16878", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0510", "description": "BARRA MAGNÉTICA CERTIFICADO DE CALIDAD (SI APLICA), BARRA MAGNETICA OCTAGONAL DE PTFE COLOR BLANCO 10X5MM APROXIMADO. 50 PIEZAS.", "unit": "PIEZA", "requested_quantity": "50", "awarded_quantity": null, "unit_price": "200", "subtotal": "10000", "tax": "1600", "other_taxes": null, "total": "11600" }, { "number": "0", "cucop_code": "25401-0083", "description": "BURETA CLASE A, VERIFICADA, CON CERTIFICADO DE CALIDAD, BURETA GRADUADA 5ML. CLASE A ASTM; NÚMERO DE SERIE INDIVIDUAL Y CERTIFICADO*. FABRICADA EN VIDRIO DE BOROSILICATO CON BAJO CONTENIDO DE EXTRACTABLES; CONFORME A USP TIPO I Y ASTM E438, TIPO I, CLASE A. LONGITUD APROXIMADA DE 790MM. GRADUACIÓN EN COLOR BLANCO. DIVISIÓN DE 0.01ML. TOLERANCIA DE ±0.01ML. LLAVE DE PTFE. *CERTIFICADO DE PRECISIÓN DE LA GRADUACIÓN TRACEABLE A NIST.", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4550", "subtotal": "4550", "tax": "728", "other_taxes": null, "total": "5278" } ] }, { "id": "C-2026-00009629", "internal_reference": "DRMSG-158/2025", "title": "PRODUCTOS QUIMICOS, FARMACEUTICOS Y DE LABORATORIO", "status": "PUBLICADO", "contractor": { "name": "NALLELY IVONNE DOMINGUEZ ARANGO", "normalized_name": "NALLELY IVONNE DOMINGUEZ ARANGO", "rfc_type": null }, "contract_period": { "published_at": "2026-07-17T21:11:20.000Z", "starts_at": "2025-12-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "118298.58", "tax": "18927.78", "total": "137226.36", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25901-1746", "description": "ALCOHOL ETÍLICO ABSOLUTO, FRASCO DE 1000 ML", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "84.75", "subtotal": "423.75", "tax": "67.8", "other_taxes": null, "total": "491.55" }, { "number": "0", "cucop_code": "25401-0119", "description": "CINTA MOCROPOROSA", "unit": "PIEZA", "requested_quantity": "43", "awarded_quantity": null, "unit_price": "101.56", "subtotal": "4367.08", "tax": "698.73", "other_taxes": null, "total": "5065.81" }, { "number": "0", "cucop_code": "25401-0120", "description": "CINTA TESTIGO PARA ESTERILIZACION", "unit": "PIEZA", "requested_quantity": "86", "awarded_quantity": null, "unit_price": "58.96", "subtotal": "5070.56", "tax": "811.29", "other_taxes": null, "total": "5881.85" }, { "number": "0", "cucop_code": "25401-0150", "description": "CUBREOBJETOS DE 22 X 22 MM", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "27.37", "subtotal": "273.65", "tax": "43.78", "other_taxes": null, "total": "317.43" }, { "number": "0", "cucop_code": "25501-0510", "description": "FRASCO DE BOCA ANCHA CON TAPA HERMÉTICA, FRASCO O BOTELLA BOCA ANCHA DE POLIETILENO DE 250 ML DE ALTA DESINDAD.", "unit": "PIEZA", "requested_quantity": "50", "awarded_quantity": null, "unit_price": "63.39", "subtotal": "3169.5", "tax": "507.12", "other_taxes": null, "total": "3676.62" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA 48 LITROS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1353.44", "subtotal": "6767.2", "tax": "1082.75", "other_taxes": null, "total": "7849.95" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "991.37", "subtotal": "2974.11", "tax": "475.86", "other_taxes": null, "total": "3449.97" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "991.37", "subtotal": "5948.22", "tax": "951.72", "other_taxes": null, "total": "6899.94" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 28 LITROS CON MANGO PARA TRANSPORTE", "unit": "PIEZA", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "991.37", "subtotal": "8922.33", "tax": "1427.57", "other_taxes": null, "total": "10349.9" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "1353.44", "subtotal": "10827.52", "tax": "1732.4", "other_taxes": null, "total": "12559.92" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1353.44", "subtotal": "5413.76", "tax": "866.2", "other_taxes": null, "total": "6279.96" }, { "number": "0", "cucop_code": "22301-0036", "description": "HIELERA DE PLÁSTICO DE 50 LITROS", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "1353.44", "subtotal": "20301.6", "tax": "3248.26", "other_taxes": null, "total": "23549.86" }, { "number": "0", "cucop_code": "25401-1091", "description": "JABÓN NEUTRO", "unit": "PIEZA", "requested_quantity": "125", "awarded_quantity": null, "unit_price": "17.57", "subtotal": "2196.25", "tax": "351.4", "other_taxes": null, "total": "2547.65" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMÉTRICOS, CLASE A DE 100 ML, VERIFICADOS, CON CERTIFICADO DE CALIDAD, MATRAZ VOLUMETRICO DE POLIPROPILENO 100ML CLASE B C/TAPON DE ROSCA.", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "656.07", "subtotal": "11809.26", "tax": "1889.48", "other_taxes": null, "total": "13698.74" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA AUTOMATICA 20-200 UL", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1274.48", "subtotal": "1274.48", "tax": "203.92", "other_taxes": null, "total": "1478.4" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA AUTOMATICA VARIABLE DE 10-100 MICROLITROS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1274.48", "subtotal": "1274.48", "tax": "203.92", "other_taxes": null, "total": "1478.4" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA DE 1-10 MILIMETROS EPPENDORF", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1274.48", "subtotal": "1274.48", "tax": "203.92", "other_taxes": null, "total": "1478.4" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA PASTEUR DE PLASTICO DE 3 ML. PAQU 500 PZS", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "562.63", "subtotal": "562.63", "tax": "90.02", "other_taxes": null, "total": "652.65" }, { "number": "0", "cucop_code": "25501-0035", "description": "PORTA OBJETOS DE VIDRIO DE 76 X 25 MM. CAJA 50 PZS", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "35.03", "subtotal": "420.36", "tax": "67.26", "other_taxes": null, "total": "487.62" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS DE POLIPROPILENO DESECHABLES PARA PIPETORES DE 1-200 MICROLITROS (AMARILLAS) LIBRES DE DNASA / RNASA Y PIROGENOS. ACABADO BISELADO. COMPATIBLES CON PIPETAS DE GRADO DE INVESTIGACIÓN CAJA 1000 PZAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "272.88", "subtotal": "818.64", "tax": "130.98", "other_taxes": null, "total": "949.62" }, { "number": "0", "cucop_code": "25401-3647", "description": "SUTURAS CATGUT CROMICO C/AGUJA, LONG. DE HEBRA 68-75 CM.CAL. 0", "unit": "PIEZA", "requested_quantity": "50", "awarded_quantity": null, "unit_price": "283.14", "subtotal": "14157", "tax": "2265.12", "other_taxes": null, "total": "16422.12" }, { "number": "0", "cucop_code": "25401-0486", "description": "TELA ADHESIVA DE ACETATO CON ADHESIVO EN UNA DE SUS CARAS LONG. 10M X2.50 CM CAJA", "unit": "PIEZA", "requested_quantity": "35", "awarded_quantity": null, "unit_price": "260.6", "subtotal": "9121", "tax": "1459.36", "other_taxes": null, "total": "10580.36" }, { "number": "0", "cucop_code": "25501-0052", "description": "VASO DE PRECIPITADOS DE VIDRIO DE 250 ML, VASOS DE PRECIPITADO DE 250 ML VIDRIO.", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "77.56", "subtotal": "930.72", "tax": "148.92", "other_taxes": null, "total": "1079.64" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "CONVOCATORIA", "filename": "BASES T-39.doc", "availability": "available", "size_bytes": "1176064", "mime_type": "application/msword", "sha256": null, "uploaded_at": "2025-11-11T19:45:26.870Z", "updated_at": "2025-11-11T19:45:26.870Z" }, { "id": null, "annex_number": 2, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "ANEXO T-39.docx", "availability": "available", "size_bytes": "75796", "mime_type": "application/vnd.openxmlformats-officedocument.wordprocessingml.document", "sha256": null, "uploaded_at": "2025-11-11T19:45:20.772Z", "updated_at": "2025-11-11T19:45:20.773Z" }, { "id": null, "annex_number": 3, "document_type": null, "description": "MODELO DE CONTRATO", "filename": "MOD CONT T-15.doc", "availability": "available", "size_bytes": "401920", "mime_type": "application/msword", "sha256": null, "uploaded_at": "2025-11-11T19:45:23.689Z", "updated_at": "2025-11-11T19:45:23.690Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "ACTA JUNTA DE ACLARACIONES", "filename": "acta_junta_de_aclaraciones-firmada.pdf", "availability": "available", "size_bytes": "4087356", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-20T17:00:59.303Z", "updated_at": "2025-11-20T17:00:59.304Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "ACTA DE ACLARACIONES", "filename": "ac de acla.pdf", "availability": "available", "size_bytes": "2387194", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-20T17:01:01.844Z", "updated_at": "2025-11-20T17:01:01.845Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "ACTA DE APERTURA DE PROPOSICIONES", "filename": "acta_de_apertura_de_proposiciones-firmada.pdf", "availability": "available", "size_bytes": "24888181", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-22T00:08:24.122Z", "updated_at": "2025-11-22T00:08:24.123Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "ACTA DE FALLO", "filename": "acta_de_fallo-firmada.pdf", "availability": "available", "size_bytes": "17649022", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2026-01-11T01:23:39.144Z", "updated_at": "2026-01-11T01:23:39.146Z" } ], "alternates": [], "similar": [ { "numero_procedimiento": "la-77-014-918032996-n-7-2026", "nombre_procedimiento": "2000 MATERIALES Y SUMINISTROS", "dependencia": "SERVICIOS DE SALUD PÚBLICA DE NAYARIT", "siglas": "SSN", "score": 0.05725107108811134 }, { "numero_procedimiento": "la-62-o27-903006996-n-5-2023", "nombre_procedimiento": "ADQUISICIÓN DE EQUIPO MÉDICO, MATERIALES, ACCESORIOS Y SUMINISTROS PARA EL LABOR", "dependencia": "SECRETARÍA DE SALUD (BCS)", "siglas": "SSBCS", "score": 0.07067233745290691 }, { "numero_procedimiento": "la-51-gyn-051gyn052-t-39-2026", "nombre_procedimiento": "ADQUISICIÓN MATERIAL Y ACCESORIOS MÉDICOS MENORES DE REPOSICIÓN", "dependencia": "INSTITUTO DE SEGURIDAD Y SERVICIOS SOCIALES DE LOS TRABAJADORES DEL ESTADO", "siglas": "ISSSTE", "score": 0.07797003721833673 }, { "numero_procedimiento": "la-77-014-918032996-t-26-2024", "nombre_procedimiento": "MEDICINAS Y PRODUCTOS FARMACEUTICOS, MATERIALES, ACCESORIOS Y SUMINISTROS MEDICO", "dependencia": "SERVICIOS DE SALUD PÚBLICA DE NAYARIT", "siglas": "SSN", "score": 0.0791086923279185 }, { "numero_procedimiento": "la-12-nck-012nck001-i-13-2026", "nombre_procedimiento": "INSUMOS DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO PARA LAS ÁREAS ADS. DM", "dependencia": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "siglas": "INNN", "score": 0.0794827711119741 }, { "numero_procedimiento": "la-38-9zy-0389zy998-n-98-2026", "nombre_procedimiento": "2026 LP3 - PASAJES, SERVICIOS DE MANTENIMIENTO Y ADQUISICIÓN DE INSUMOS DE LAB", "dependencia": "CENTRO DE INVESTIGACION EN ALIMENTACION Y DESARROLLO, A.C.", "siglas": "CIAD", "score": 0.08206743980257991 } ] }